Evolution and Systematics

Functional Adaptations

Functional adaptation

Blades balance light interception, drag: bull kelp
 

Blades of giant bull kelp optimize the balance between light interception and hydrodynamic drag in varying conditions via shape plasticity.

           
  "Many species of macroalgae have flat, strap-like blades in habitats exposed to rapidly flowing water, but have wide, ruffled 'undulate' blades at protected sites. We used the giant bull kelp, Nereocystis luetkeana, to investigate how these ecomorphological differences are produced. The undulate blades of N. luetkeana  from sites with low flow remain spread out and flutter erratically in  moving water, thereby not only enhancing interception  of light, but also increasing drag. In contrast,  strap-like blades of kelp from habitats with rapid flow collapse into  streamlined  bundles and flutter at low amplitude in flowing  water, thus reducing both drag and interception of light. Transplant  experiments  in the field revealed that shape of the blade in N. luetkeana  is a plastic trait. Laboratory experiments in which growing blades from  different sites were subjected to tensile forces  that mimicked the hydrodynamic drag experienced by  blades in different flow regimes showed that change in shape is induced  by mechanical stress. During growth experiments in  the field and laboratory, we mapped the spatial distribution of growth  in both undulate and strap-like blades to determine  how these different morphologies were produced. The highest growth  rates  occur near the proximal ends of N. luetkeana  blades of both morphologies, but the rates of transverse growth of  narrow, strap-like blades are lower than those of wide,  undulate blades. If rates of longitudinal growth at  the edges of a blade exceed the rate of longitudinal growth along the  midline of the blade, ruffles along the edges of  the blade are produced by elastic buckling. In contrast, flat blades are  produced when rates of longitudinal growth are  similar across the width of a blade. Because ruffles are the result of  elastic  buckling, a compliant undulate N. luetkeana  blade can easily be pushed into different configurations (e.g., the  wavelengths of the ruffles along the edges of the blade  can change, and the whole blade can twist into  left- and right-handed helicoidal shapes), which may enhance movements  of the  blade in flowing water that reduce self-shading and  increase mass exchange along blade surfaces." (Koehl et al. 2008:834)
  Learn more about this functional adaptation.
  • Koehl MAR; Silk WK; Liang H; Mahadevan L. 2008. How kelp produce blade shapes suited to different flow regimes: A new wrinkle. Integr. Comp. Biol. 48(6): 834-851.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Spiral-shaped flow is optimal: bull kelp
 

Stipes of bull kelp manage turbulence, allowing optimized flow by flexing into a logarithmic spiral.

   
  Spiraling nautilus shells, swaying kelp, and skin pores all share a  fundamental spiral geometry. This same spiral moves fluids more  efficiently than the rotors and impellers humans have been designing for  centuries. The pervasive logarithmic spiral pattern found throughout  the natural world is an optimal flow form, allowing fluids to travel as  fast as possible without transitioning from a laminar to turbulent flow. (Courtesy of the  Biomimicry Guild)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Anchor has flexibility: bull kelp
 

Anchors of bull kelp protect it from torque by being flexible.

     
  "Kelp’s survival depends on flexibility and extensibility. Each alga can grow up to 20 to 45 m (22 to 49 yd) long and consists of a holdfast, stipe, float, and fronds. The holdfast uses a flexible network of root-like haptera or anchors to attach the kelp to the ocean floor. By being flexible, the haptera allow the kelp’s base to rotate slightly, thus providing some protection from the high torque created by waves." (Biomimicry Guild unpublished report)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Stretchable architecture resists breakage: bull kelp
 

Stipes of bull kelp resist breakage because of their stretchable architecture.

     
  "Many sessile marine organisms in areas subjected to wave action of swift currents avoid the large mechanical forces exerted by flowing water because they are short and squat or are hidden in holes and behind protrusions. In contrast, tall sessile organisms such as large kelp may face rapid flow at current-swept sites...these kelp thrive in beds within a few hundred meters of wave-beaten, current-swept shores from California to Alaska. Because gas-filled floats keep their fronds at or near the sea surface, large Nereocystis cannot avoid fast flow by bending flat against the substratum as many seaweeds do. Waves and tidal current continually subject the stipes to tensile forces... The mean work per volume required to break Nereocystis stipes... is similar to that of wood, bone, insect cuticle, and cast iron. Hence, Nereocystis stipes resist breakage by being stretchy rather than by having a high breaking stress." (Koehl 1977:1067)
  Learn more about this functional adaptation.
  • Koehl, M. A. R. ; Wainwright, S. A. 1977. Mechanical adaptations of a giant kelp. Limnol. Oceanogr. 22: 1067-1071.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Floats keep fronds buoyant: bull kelp
 

The fronds of giant kelp are kept at or near the sea surface via gas-filled floats.

   
  "Gas-filled floats keep [kelp] fronds at or near the sea surface." (Koehl 1977:1067)
  Learn more about this functional adaptation.
  • Koehl, M. A. R. ; Wainwright, S. A. 1977. Mechanical adaptations of a giant kelp. Limnol. Oceanogr. 22: 1067-1071.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Joint shaped as suction cup prevents peeling: bull kelp
 

The attachment site of many aquatic organisms avoids peeling via glued joints that resemble suction cups.

       
  "Loads that might cause peeling occur widely in nature. Neither the holdfast of a large marine alga nor the byssal thread of an intertidal mussel nor the foot of the wave-challenged snail can be assured of tensile forces perpendicular to its attachment surface. All respond with some tapering disk of attachment that's increasingly flexible peripherally (fig. 21.1b)--the whole thing distorts a little to avoid stress concentrations at an edge. Thus, a good shape for a glued joint may resemble (and may also function as) a suction cup, even though the two mechanisms are physically distinct." (Vogel 2003:425)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nereocystis luetkeana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTATATTTAATTTTTGGTGGTTTCTCAGGTGTCCTCGGGACAGCAATGTCTGTTCTTATCCGTTTACAATTGGCTAGCCCTGGCAATCAATTTTTAGGAGGGAACCATCAGTTATATAATGTTATTGTAACTGCACACGCTTTTTTAATGATTTTTTTTATGGTTATGCCAATTCTTATTGGTGGATTCGGGAATTGGTTTGTACCTTTAATGATTGGTGCCCCCGATATGGCTTTTCCTCGTATGAATAACATTAGTTTTTGGTTGTTGCCCCCTTCTTTAATCCTTCTTTTAGCTTCTTCATTAGTGGAATCTGGGGCTGGTACAGGTTGGACGGTATACCCACCTCTTAGTGGTATTCAAGCACACTCAGGTCCTTCTGTTGATTTAGCGATATTTAGCCTTCACCTTTCAGGTGCTGCTTCTATTTTAGGGGCTATAAATTTTATCACAACTATTTTTAACATGAGAGCTCCTGGTATGACAATGGATAGATTGCCTCTTTTTGTCTGGTCTGTTTTAATTACAGCTTTTTTATTGTTGTTATCACTTCCCGTTTTAGCAGGGGCTGTTACCATGTTATTAACAGATCGTAATTTTAATACTACTTTTTTTGACCCTGCTGGTGGTGGTGATCCAGTATTGTATCAGCATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nereocystis luetkeana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nereocystis

Nereocystis (Greek for "mermaid's bladder") is a monotypic genus of kelp. It forms thick beds on rocks, and is an important part of kelp forests. There is only one species, Nereocystis luetkeana. It can grow to a maximum of 74 meters. Nereocystis has a holdfast of about 40 centimeters, and a single stipe, topped with a pneumatocyst containing carbon monoxide, from which sprout the numerous (about 30-64) blades. The blades may be up to 4 meters long, and up to 15 centimeters wide. It is usually annual, sometimes persisting up to 18 months. Nereocystis is the only kelp which will drop spore patches, so that the right concentration of spores lands near the parent's holdfast. It is common along the coast of the northeastern Pacific Ocean, from about Monterey, California to Aleutian Islands, Alaska.

Some common names include edible kelp, bull kelp, bullwhip kelp, ribbon kelp, giant kelp, bladder wrack, and variations on these names.[1]

References

  1. ^ Angier, Bradford (1978). Field Guide to Medicinal Wild pPlants. Harrisburg, Pa.: Stackpole Books. p. 156. ISBN 978-0-8117-2076-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!