Articles on this page are available in 1 other language: Spanish (1) (learn more)
Physical Description
Type Information
Isotype for Rhodymenia attenuata E.Y. Dawson
Catalog Number: US 39756
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Verification Degree: Original publication and alleged type specimen examined
Preparation: Pressed specimen
Collector(s): N. Gardner
Year Collected: 1912
Locality: White's Point, west of San Pedro., Los Angeles County, California, United States, North America
Catalog Number: US 39756
Collection: Smithsonian Institution, National Museum of Natural History, Department of Botany
Verification Degree: Original publication and alleged type specimen examined
Preparation: Pressed specimen
Collector(s): N. Gardner
Year Collected: 1912
Locality: White's Point, west of San Pedro., Los Angeles County, California, United States, North America
- Isotype: Dawson, E. Y. 1941. Allan Hancock Pacific Exped. 3: 139.
© Smithsonian Institution, National Museum of Natural History, Department of Botany
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Rhodymenia californica
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TACCTTATATTTAGTCTTTGGTGCATTTTCTGGAATTTTAGGAGGTTGCATGTCAATGTTAATTCGTATGGAATTATCTCAACCAGGTAATCATTTACTTACTGGTAATCATCAACTTTATAATGTTTTAATAACAGCACATGCTTTTTTAATGATTTTTTTTATGGTAATGCCTGTAATGATTGGAGGCTTTGGTAACTGATTGGTTCCTATTATGATAGGTAGTCCAGATATGGCTTTTCCTAGACTAAATAATATCTCTTTTTGATTGCTACCTCCTTCATTATGCTTACTTCTTACTTCAGCTTTTGTAGAAGTAGGAGTTGGAACCGGCTGAACCGTTTATCCTCCTCTTAGCTCAATACAAAGTCATTCTGGAGCTGCTGTGGATCTTGCTATATTTAGTCTTCATATTGCTGGCGCTTCGTCTATCCTAGGAGCAATTAATTTTATTTCAACTATCATTAATATGCGTAATTCTGGACAAAGTATGTATAGAATGCCTCTATTCGTTTGGTCTATTTTCGTTACTGCATTTTTGCTTTTATTAGCGGTTCCCGTATTAGCTGGAGCAATTACAATGCTTTTAACAGATCGCAATTTTAATACTGCATTTTTTGATCCCGCAGGTGGAGGAGATCCTGTTTTATACCAACACTTATTTTGATTTTTTGGTCATCCAGAAGT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Rhodymenia californica
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 101
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 101
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
