Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Comprehensive Description

Gymnodinium catenatum is a chain-forming naked dinoflagellate, with a variable morphology depending on whether it occurs in a chain or single cell. The cingulum is descending (displaced up to 20 % cell length). The sulcus extends from the antapex to the apex, which is surrounded by an apical groove. Cells contain many chloroplasts and have a large centrally placed nucleus
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gymnodinium catenatum was first reported from California but now has a very wide distribution including Europe, Australia and Japan.
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Gymnodinium catenatum typically forms chains of up to 16 cells but chains with up to 64 cells have been reported. The cingulum is descending (displaced up to 20 % of cell length). The sulcus extends from the antapex to the apex, which is surrounded by an apical groove. It runs in a counter-clockwise direction around the apex and starts at the end of the intrusion of the sulcus into the epitheca. Cells contain many chloroplasts and have a large centrally placed nucleus. Cysts are round (42-52µm), brown and reticulated.
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 185 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 8
  Temperature range (°C): 12.224 - 20.400
  Nitrate (umol/L): 0.871 - 6.894
  Salinity (PPS): 34.704 - 36.170
  Oxygen (ml/l): 5.182 - 6.447
  Phosphate (umol/l): 0.382 - 0.630
  Silicate (umol/l): 2.591 - 4.938

Graphical representation

Depth range (m): 0 - 8

Temperature range (°C): 12.224 - 20.400

Nitrate (umol/L): 0.871 - 6.894

Salinity (PPS): 34.704 - 36.170

Oxygen (ml/l): 5.182 - 6.447

Phosphate (umol/l): 0.382 - 0.630

Silicate (umol/l): 2.591 - 4.938
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnodinium catenatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATAATTTTTCTATCTTAATTCTTTCTCTTTCATATCTTTTCGTAATCCTTTCTTTAATCTCAGAGTTTGGAGGTGGAACAGGATGGACATTATATCCACCATTWAGCACTTCTTTCATGAGTTTATCACCTTCAAGTACAGGATTCATGGTCTTTGGATTATTAATGTCAGGTATATCCTCATGTCTCACATCTATTAACTTTTGGACAACAATTCTAAATCTGAGATCTTATTATCTGACATTAAAGACTATCCCATTATTTCCTTGGGCTCTCTTGATAACAGGAGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTCTTCTAATGGTCTTGGCTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTTTGGTTTTTTGGACATCCAGAAGTTTACATCTTAATAATTCCAGCATTTGGGATCATTAGCATAATAATTTCTGGAATATTACAAAAAATAATCTTTGCTAACCAGTCAATGATCTTTGCCATGAGCTGTATYTCTCTTCTTGGAAGTGTTGTTTGGGGACATCATATGTATAACWGTAGGTTTAGAAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gymnodinium catenatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Management

Toxicity

Gymnodinium catenatum is the only naked dinoflagellate known to produce PSP toxins
  • Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
  • Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© University of Liverpool

Source: Harmful Phytoplankton Project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!