Articles on this page are available in 1 other language: Spanish (9) (learn more)
Overview
Comprehensive Description
Gymnodinium catenatum is a chain-forming naked dinoflagellate, with a variable morphology depending on whether it occurs in a chain or single cell. The cingulum is descending (displaced up to 20 % cell length). The sulcus extends from the antapex to the apex, which is surrounded by an apical groove. Cells contain many chloroplasts and have a large centrally placed nucleus
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Trusted
Distribution
Gymnodinium catenatum was first reported from California but now has a very wide distribution including Europe, Australia and Japan.
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Trusted
Physical Description
Diagnostic Description
Gymnodinium catenatum typically forms chains of up to 16 cells but chains with up to 64 cells have been reported. The cingulum is descending (displaced up to 20 % of cell length). The sulcus extends from the antapex to the apex, which is surrounded by an apical groove. It runs in a counter-clockwise direction around the apex and starts at the end of the intrusion of the sulcus into the epitheca. Cells contain many chloroplasts and have a large centrally placed nucleus. Cysts are round (42-52µm), brown and reticulated.
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Trusted
Ecology
Habitat
Depth range based on 185 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.
Environmental ranges
Depth range (m): 0 - 8
Temperature range (°C): 12.224 - 20.400
Nitrate (umol/L): 0.871 - 6.894
Salinity (PPS): 34.704 - 36.170
Oxygen (ml/l): 5.182 - 6.447
Phosphate (umol/l): 0.382 - 0.630
Silicate (umol/l): 2.591 - 4.938
Graphical representation
Depth range (m): 0 - 8
Temperature range (°C): 12.224 - 20.400
Nitrate (umol/L): 0.871 - 6.894
Salinity (PPS): 34.704 - 36.170
Oxygen (ml/l): 5.182 - 6.447
Phosphate (umol/l): 0.382 - 0.630
Silicate (umol/l): 2.591 - 4.938
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 7 samples.
Environmental ranges
Depth range (m): 0 - 8
Temperature range (°C): 12.224 - 20.400
Nitrate (umol/L): 0.871 - 6.894
Salinity (PPS): 34.704 - 36.170
Oxygen (ml/l): 5.182 - 6.447
Phosphate (umol/l): 0.382 - 0.630
Silicate (umol/l): 2.591 - 4.938
Graphical representation
Depth range (m): 0 - 8
Temperature range (°C): 12.224 - 20.400
Nitrate (umol/L): 0.871 - 6.894
Salinity (PPS): 34.704 - 36.170
Oxygen (ml/l): 5.182 - 6.447
Phosphate (umol/l): 0.382 - 0.630
Silicate (umol/l): 2.591 - 4.938
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gymnodinium catenatum
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 14 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 14 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AATAATTTTTCTATCTTAATTCTTTCTCTTTCATATCTTTTCGTAATCCTTTCTTTAATCTCAGAGTTTGGAGGTGGAACAGGATGGACATTATATCCACCATTWAGCACTTCTTTCATGAGTTTATCACCTTCAAGTACAGGATTCATGGTCTTTGGATTATTAATGTCAGGTATATCCTCATGTCTCACATCTATTAACTTTTGGACAACAATTCTAAATCTGAGATCTTATTATCTGACATTAAAGACTATCCCATTATTTCCTTGGGCTCTCTTGATAACAGGAGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTCTTCTAATGGTCTTGGCTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTTTGGTTTTTTGGACATCCAGAAGTTTACATCTTAATAATTCCAGCATTTGGGATCATTAGCATAATAATTTCTGGAATATTACAAAAAATAATCTTTGCTAACCAGTCAATGATCTTTGCCATGAGCTGTATYTCTCTTCTTGGAAGTGTTGTTTGGGGACATCATATGTATAACWGTAGGTTTAGAAACT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Gymnodinium catenatum
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Trusted
Conservation
Management
Toxicity
Gymnodinium catenatum is the only naked dinoflagellate known to produce PSP toxins
- Tomas C ed. (1996) Identifying marine diatoms and dinoflagellates. pp 598. Academic Press Ltd. London
- Hallegraeff GM and Hara Y (2003) Taxnomy of harmful marine raphidophytes. In: Hallegraeff GM, Anderson DM, Cembella AD. Manual on harmful microalgae. UNESCO Publishing
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

