Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Spiral wrack is a small version of bladder wrack, but it doesn't have inflated bladders. The bladders that you may see have a jelly-like content and are for reproduction. The bladders have a narrow rim which is lacking by bladder wrack. This brown seaweed grows in the highest part of the tidal zone, often underneath Blidingia minima. Spiral wrack is fairly common in the delta region and the Wadden Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 An intertidal brown seaweed, found on the high shore. It grows up to 40 cm long, without air bladders and lives for up to 4 years. The species can tolerate a high level of desiccation. Fronds have a characteristic ridge along the edge of the receptacles.A number of discrete forms of this species have been recorded. In the UK, a diminutive form Fucus spiralis nanus is relatively common.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, Mediterranean Sea, North West Atlantic, Oostduinkerke, Oostende, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Wimereux, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long Island Sound to Strait of Belle Isle
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

Brown colour results from the dominance of the xanthophyll fucoxanthin; this masks the other pigments, Chlorophyll a and c (no chlorophyll b), beta-carotene and other xanthophylls.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

exposed rocks, estuarine habitats
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 90 specimens in 2 taxa.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 0 - 1.25
  Temperature range (°C): 11.471 - 12.348
  Nitrate (umol/L): 4.729 - 7.121
  Salinity (PPS): 35.184 - 35.363
  Oxygen (ml/l): 6.069 - 6.200
  Phosphate (umol/l): 0.336 - 0.439
  Silicate (umol/l): 2.315 - 3.285

Graphical representation

Depth range (m): 0 - 1.25

Temperature range (°C): 11.471 - 12.348

Nitrate (umol/L): 4.729 - 7.121

Salinity (PPS): 35.184 - 35.363

Oxygen (ml/l): 6.069 - 6.200

Phosphate (umol/l): 0.336 - 0.439

Silicate (umol/l): 2.315 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Fucus spiralis attaches to rocky substrata on sheltered to moderately exposed shores. It lives on the upper shore below the zone of Pelvetia canaliculata and above Fucus vesiculosus and Ascophyllum nodosum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fucus spiralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTTATATTTACTTTTTGGGGCTTTCTCTGGAGTATTAGGAACAGCTATGTCTGTTCTTATTAGATTGCAGCTAGCAACTCCAGGAAATATGTTTTTAGGAGGCAATTATCAGCTTTACAATGTTATTGTAACAGCTCATGCTTTTCTAATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGAGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCATTTCCACGTATGAATAATATAAGCTTTTGGTTGTTACCCCCATCGCTAATTCTTCTTTTGGCATCCTCGTTGGTTGAGGCGGGAGCAGGTACTGGGWGGACTGTTTACCCGCCGCTTAGTGGTATTCAGGCGCACTCAGGACCATCAGTTGACCTAGCTATATTTAGTCTTCACCTGTCAGGTGCAGCCTCTATTCTAGGTGCTATTAATTTTATTACAACTATTTTTAATATGCGTGCCCCGGGTATGAGTATGCATCGTTTACCTTTATTTGTTTGGTCAGTTTTAATTACAGCATTCTTACTTTTGCTATCGCTTCCTGTTTTAGCCGGCGGTATTACTATGCTGTTAACTGATCGGAATTTCAATACTACGTTCTTTGATCCAGCTGGTGGTGGTGATCCTGTTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fucus spiralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fucus spiralis

Fucus spiralis is a species of seaweed, a brown alga (Heterokontophyta, Phaeophyceae), living on the littoral shore of the Atlantic coasts of Europe and North America. It has the common names of spiral wrack and flat wrack.

Contents

Description

Fucus spiralis is olive brown in colour and similar to Fucus vesiculosus and Fucus serratus. It grows to about 30 cms long and branches somewhat irregularly dichotomous and is attached, generally to rock, by a discoid holdfast. The flattened blade has a distinct mid-rib and is usually spirally twisted without a serrated edge, as are to be seen in Fucus serratus, and it does not show air-vesicles, as Fucus vesiculosus.[1][2]

Life history

The reproductive bodies form rounded swollen tips on the branches, usually in pairs. In the conceptacles oögonia and antheridia are produced after meiosis and then released. Fertilisation follows and the zygote develops directly into the diploid sporophyte plant.

Ecology

The other common species of Fucus on the coasts of British Isles: Fucus spiralis, Fucus vesiculosus and Fucus serratus along with Ascophyllum nodosum form the main and dominant seaweeds on rocky shores. These three species, along with two others Pelvetia canaliculata and Ascophyllum nodosum form the zones along the shore.[3]

Distribution

F. spiralis is common on the coasts all around the British Isles,[4] western coasts of Europe, Canary Islands and North-eastern America.

Fucus spiralis var. platycarpus

Chemistry

F. spiralis produces phlorotannins of both the fucol and fucophlorethol types.[5]

See also

References

  1. ^ Newton, L. 1931. A Handbook of the British Seaweeds. British Museum, Natural History, London
  2. ^ Taylor,W.R. 1972. Marine Algae of the Northeastern Coast of North America. Ann Arbor, University of Michigan Press
  3. ^ Lewis, J.R. 1964. The Ecology of Rocky Shores. The English Universities Press.
  4. ^ Hardy, G. and Guiry, M.D. 2003. A Check-list and Atlas of the Seaweeds of Britain and Ireland. British Phycological Society ISBN 0-9527115-1-6
  5. ^ Co-occurrence and antioxidant activities of fucol and fucophlorethol classes of polymeric phenols in Fucus spiralis. Cérantola Stéphane, Breton Florian, Ar Gall Erwan and Deslandes Eric, Botanica Marina., Volume 49, Issue 4, Pages 347–351, doi:10.1515/BOT.2006.042
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!