Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Some seaweeds can have a greenish color, but yet are not green seaweeds. Bladder wrack is a good example. It can vary from olive-green to brown. Like all brown seaweeds, it is much sturdier than green seaweeds, which easily tear apart. Bladder wrack is easy to recognize by its bladders along the fronds. The floating bladders help the plant to stand straight up in the water. Bladder wrack grows along dikes, on wooden poles and on mud flats. It attaches itself to mussels, stones or other objects. It can grow up to 0.5 meters long. In earlier days, bladder wrack was used as a fertilizer as well as for a remedy for pain in the joints, swellings and skin diseases. Sometimes, there are no floating bladders and then it is easily confused with spiral wrack.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The air bladders keep the fronds of the wrack in illuminated waters, where it is able to photosynthesise (3). In exposed areas, it is beneficial for the wrack to lack bladders, as this decreases the potential for severe damage, and minimises the risk of it being detached and swept away (3). Bladder wrack may live for up to three years. There are separate male and female plants, and reproduction takes place once a year (2). Sex cells are produced in structures known as 'receptacles' located at the tips of the fronds. Eggs and sperm are released simultaneously into the water; the eggs release a pheromone that attracts the sperm (4), and fertilisation occurs externally. The fertilised egg settles to the substrate where it becomes attached after just a few hours (2). Bladder wrack provides shelter for a number of marine species, including the tubeworm Spirobis spirobis, various isopods, and snails (2). It has been harvested by humans for use as a food source, and in various health products (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Bladder wrack is a familiar large olive-brown coloured seaweed (3), which attaches to rocky substrates by means of a small disc (4). The flattened, branching fronds, which grow up to 2m in length, have an obvious midrib, and are covered with spherical air bladders, which tend to occur in pairs on either side of the mid-rib (3). In small plants, however, air bladders may be entirely absent (3). Forked and pointed reproductive structures occur at the tips of the fronds (3). The appearance of bladder wrack varies depending on the environmental conditions in which it occurs; in more sheltered areas there are many air bladders, whereas there are fewer in more exposed conditions (3). In very exposed areas, a form of bladder wrack called Fucus vesiculosus forma linearis may arise, which completely lacks bladders (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The bladder wrack Fucus vesiculosus is a large brown algae, common on the middle shore. It can be found in high densities living for about 4-5 years (S. Kraan, pers. comm.). Under sheltered conditions, the fronds have been known to grow up to 2 m in Maine, America (Wippelhauser, 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, Boulogne, Pointe de la Creche, Boulogne-sur-Mer, Estonian Exclusive Economic Zone, Europe, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, Mediterranean Sea, North East Baltic Sea, North West Atlantic, Oostduinkerke, Oostende, Pointe aux Oies (point), Pointe du Nid de Corbet, Polish Exclusive Economic Zone, Sas van Goes, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux, Zeebrugge, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ellesmere Island (and into Hudson Bay) to North Carolina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs around the coastline of Britain, and is also known from Ireland, the Baltic Sea, Norway, the Atlantic coast of France, Spain and Morocco, as well as Greenland, and the eastern coasts of Canada and the USA (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

Brown colour results from the dominance of the xanthophyll fucoxanthin; this masks the other pigments, Chlorophyll a and c (no chlorophyll b), beta-carotene and other xanthophylls.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

exposed to protected coasts and in bays, estuaries and salt marshes
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 176 specimens in 6 taxa.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0 - 23.77
  Temperature range (°C): 11.471 - 12.348
  Nitrate (umol/L): 4.729 - 7.121
  Salinity (PPS): 35.035 - 35.363
  Oxygen (ml/l): 6.069 - 6.339
  Phosphate (umol/l): 0.336 - 0.439
  Silicate (umol/l): 2.315 - 3.388

Graphical representation

Depth range (m): 0 - 23.77

Temperature range (°C): 11.471 - 12.348

Nitrate (umol/L): 4.729 - 7.121

Salinity (PPS): 35.035 - 35.363

Oxygen (ml/l): 6.069 - 6.339

Phosphate (umol/l): 0.336 - 0.439

Silicate (umol/l): 2.315 - 3.388
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The species is found intertidally on rocky shores in a wide range of exposures. It is common on the mid shore often with Ascophyllum nodosum, below Fucus spiralis and in a zone further up the shore from Fucus serratus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bladder wrack occurs intertidally on the middle-shore, where it grows attached to rocky substrates, and is often associated with knotted wrack (Acophyllum nodosum) in the zone above toothed wrack (Fucus serratus) (3). It can survive in a wide range of exposures (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Foodplant / saprobe
Lulworthia salina is saprobic on very old, worn thallus stump of Fucus vesiculosus
Remarks: Other: uncertain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fucus vesiculosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTTATATTTACTTTTTGGGGCTTTCTCTGGAGTATTAGGAACAGCTATGTCTGTTCTTATTAGATTGCAGCTAGCAACTCCAGGAAATATGTTTTTAGGAGGCAATTATCAGCTTTACAATGTTATTGTAACAGCTCATGCTTTTCTAATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGAGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCATTTCCACGTATGAATAATATAAGCTTTTGGTTGTTACCCCCGTCGCTAATTCTTCTTTTGGCATCCTCGTTGGTTGAGGCGGGAGCAGGTACTGGGTGGACTGTTTACCCGCCGCTTAGTGGTATTCAGGCGCACTCAGGACCATCAGTTGACCTAGCTATATTTAGTCTTCACCTGTCAGGTGCAGCCTCTATTCTAGGTGCTATTAATTTTATTACAACTATTTTTAATATGCGTGCCCCGGGTATGAGTATGCATCGTTTACCTTTATTTGTTTGGTCAGTTTTAATTACAGCATTCTTACTTTTGCTATCGCTTCCTGTTTTAGCCGGCGGTATTACTATGCTGTTAACTGATCGGAATTTCAATACTACGTTTTTTGATCCAGCTGGTGGTGGTGATCCTGTTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Fucus vesiculosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 6 specimens with morphological vouchers housed at Australia Museum and Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This seaweed is not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fucus vesiculosus

Close-up of bladder wrack's eponymous vesicles

Fucus vesiculosus, known by the common name bladder wrack or bladderwrack, is a seaweed found on the coasts of the North Sea, the western Baltic Sea, and the Atlantic and Pacific Oceans, also known by the common names black tang, rockweed, bladder fucus, sea oak, black tany, cut weed, dyers fucus, red fucus, and rock wrack. It was the original source of iodine, discovered in 1811, and was used extensively to treat goitre, a swelling of the thyroid gland related to iodine deficiency.

Contents

Description

The fronds of F. vesiculosus have a prominent midrib and almost spherical air bladders which are usually paired but may be absent in young plants. The margin is smooth and the frond is dichotomously branched. It is sometimes confused with Fucus spiralis with which it hybridises.[1]

Distribution

Fucus vesiculosus is the most common algae on the shores of the British Isles.[2] It has been recorded from the Atlantic shores of Europe, Northern Russia, the Baltic Sea, Greenland, Azores, Canary Islands, Morocco and Madeira.[3][4] It is also found on the Atlantic coast of North America from Ellesmere Island, Hudson Bay to North Carolina.[5]

Ecology

The species is especially common on sheltered shores from the middle littoral to lower intertidal levels.[5] It is rare on exposed shores where any specimens may be short, stunted and without the air vesicles.[6] F. vesiculosus supports few colonial organisms but provides a canopy and shelter for the tube worm Spirorbis spirorbis, herbivorous isopods, such as Idotea and surface grazing snails such as Littorina obtusata.[1] Phlorotannins in Fucus vesiculosus act as chemical defences against the marine herbivorous snail Littorina littorea.[7] Nevertheless, galactolipids, rather than phlorotannins, act as herbivore deterrents in this species against the sea urchin Arbacia punctulata.[8] Methyl-jasmonate may induce the phlorotannins production.[9] Fucophlorethol A is a type of phlorotannin found in F. vesiculosus.[10]

Biology

Plants of F. vesiculosus are dioecious. Gametes are generally released into the seawater under calm conditions and the eggs are fertilised externally to produce a zygote.[1] Eggs are fertilised shortly after being released from the receptacle. A study on the coast of Maine showed that there was 100% fertilisation at both exposed and sheltered sites.[1] Continuously submerged populations in the Baltic Sea are very responsive to turbulent conditions. High fertilisation success is achieved because the gametes are only released when water velocities are low.[11]

Consumption

Primary chemical constituents of this plant include mucilage, algin, mannitol, beta-carotene, zeaxanthin, iodine, bromine, potassium, volatile oils, and many other minerals. The main use of bladder wrack (and other types of seaweed) in herbal medicine is as a source of iodine, an essential nutrient for the thyroid gland. Bladder wrack has been used in the treatment of underactive thyroid glands (hypothyroidism) and goitre.[12]

Bladder wrack has been shown to help women with abnormal menstrual cycling patterns and menstrual-related disease histories.[13] Doses of 700 to 1400 mg/day were found to increase the menstrual cycle lengths, decrease the days of menstruation per cycle, and decrease the serum levels of 17B-estradiol while was later carried out and showed similar effects.[14]

See also

References

  1. ^ a b c d Marine Life Information Network
  2. ^ F. G. Hardy & M. D. Guiry (2003). A Check-list and Atlas of the Seaweeds of Britain and Ireland. London: British Phycological Society. ISBN 0-9527115-1-6. 
  3. ^ M. D. Guiry & Wendy Guiry (January 12, 2007). "Fucus vesiculosus Linnaeus". AlgaeBase. National University of Ireland, Galway. http://www.algaebase.org/speciesdetail.lasso?species_id=87&sk=0&from=results. Retrieved April 22, 2012.
  4. ^ Charlotta A. Nygård & Matthew J. Dring (2008). "Influence of salinity, temperature, dissolved inorganic carbon and nutrient concentration on the photosynthesis and growth of Fucus vesiculosus from the Baltic an Irish Seas". European Journal of Phycology 43 (3): 253–262. doi:10.1080/09670260802172627. 
  5. ^ a b W. R. Taylor (1957). Marine Algae of the Northeastern Coast of North America. University of Michigan, Ann Arbor. ISBN 0-472-04904-6. 
  6. ^ C. S. Lobban & P. J. Harrison (1994). Seaweed Ecology and Physiology. Cambridge University Press, Cambridge. ISBN 0-521-40897-0. 
  7. ^ J. A. Geiselman & O. J. McConnell (1981). "Polyphenols in brown algae Fucus vesiculosus and Ascophyllum nodosum: chemical defenses against the marine herbivorous snail, Littorina littorea". Journal of Chemical Ecology 7 (6): 1115–1133. doi:10.1007/BF00987632. 
  8. ^ Galactolipids rather than phlorotannins as herbivore deterrents in the brown seaweed Fucus vesiculosus. Michael S. Deal, Mark E. Hay, Dean Wilson and William Fenical, Oecologia, June 2003, Volume 136, Issue 1, pages 107-114, doi:10.1007/s00442-003-1242-3
  9. ^ Evidence for methyl jasmonate-induced phlorotannin production in Fucus vesiculosus (Phaeophyceae). Thomas M. Arnold, Nancy M. Targett, Christopher E. Tanner, Walter I. Hatch and Kirstin E. Ferrari, Journal of Phycology, December 2001, Volume 37, Issue 6, pages 1026–1029, doi:10.1046/j.1529-8817.2001.01130.x
  10. ^ In vitro chemopreventive potential of fucophlorethols from the brown alga Fucus vesiculosus L. by anti-oxidant activity and inhibition of selected cytochrome P450 enzymes. Sabine Parys, Stefan Kehraus, Anja Krick, Karl-Werner Glombitza, Shmuel Carmeli, Karin Klimo, Clarissa Gerhäuser and Gabriele M. König, Phytochemistry, February 2010, Volume 71, Issues 2–3, Pages 221–229, doi:10.1016/j.phytochem.2009.10.020
  11. ^ E. A. Serrao, G. Pearson, L. Kautsky & S. H. Brawley (1996). "Successful external fertilization in turbulent environments". Proceedings of the National Academy of Sciences 93 (11): 5286–5290. Bibcode:1996PNAS...93.5286S. doi:10.1073/pnas.93.11.5286. PMC 39237. PMID 11607682. 
  12. ^ P. R. Bradley (1992). British Herbal Compendium 1. Bournemouth, England: British Herbal Medicine Association. ISBN 0-903032-09-0. 
  13. ^ Christine F. Skibola (2004). "The effect of Fucus vesiculosus, an edible brown seaweed, upon menstrual cycle length and hormonal status in three pre-menopausal women: a case report". BMC Complementary and Alternative Medicine 4: 10. doi:10.1186/1472-6882-4-10. PMC 514561. PMID 15294021. 
  14. ^ Christine F. Skibola, John D. Curry, Catherine VandeVoort, Alan Conley & Martyn T. Smith (2005). "Brown kelp modulates endocrine hormones in female Sprague–Dawley rats and in human luteinized granulosa cells". Journal of Nutrition 135 (2): 296–300. PMID 15671230. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!