Ecology

Associations

In Great Britain and/or Ireland:
Animal / predator / stocks nest with
female of Arachnospila trivialis stocks nest with Xysticus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,204Public Records:267
Specimens with Sequences:1,110Public Species:32
Specimens with Barcodes:1,103Public BINs:38
Species:63         
Species With Barcodes:58         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xysticus sp. 1GAB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Xysticus sp. SPB-2007

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTGCTCATGCTTTTGTAATAATTTTTTTNATAGTTATACCTATTTTGATCGGTGGATTTGGTAATTGATTAGTTCCTTTAATA---TTAGGTGCGCCTGATATGTCTTTTCCTCGGATAAATAATTTGTCGTTTTGATTACTTCCTCCTTCATTATTCTTATTATTTATATCATCTTTAGTAGAAATAGGGGTAGGAGCTGGGTGAACTGTTTATCCTCCGTTAGCGTCAAGTTTAGGGCATATAGGGAGATCTATGGATTTT---GCTATTTTTTCTCTTCATTTAGCGGGGGCTTCTTCTATTATAGGGGCTGTTAATTTTATTTCTACAATTATTAATATACGAGTAAGAGGGATATCTATAGAGAGGGTGCCTTTATTTGTATGATCTGTTTTGATTACAGCTATTTTACTTCTTTTATCTTTACCTGTTTTGGCAGGG---GCTATTACAATATTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCGGGAGGGGGAGATCCAATTTTGTTTCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xysticus sp. SPB-2007

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Xysticus sp. MCH-2003

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AY--------YSTIC-S-S---MCH------C-I------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCTTTTTGGTTACTTCCTCCTTCGTTATTTTTATTATTTATATCATCTATAGTAGAAATAGGTGTTGGGGCTGGTTGAACTGTTTATCCTCCTTTAGCTTCTAGTTTGGGACATATAGGAAGATCTATGGATTTTGCTATTTTTTCTCTTCACTTAGCAGGTGCTTCTTCAATTATAGGGGCTGTAAATTTTATTTCTACTATTATTAATATACGGGTTGTTGGGATATCTATAGAAAAGGTGCCTCTTTTTGTTTGATCTGTTTTAATTACAGCTATTTTACTTCTTTTATCTCTTCCTGTTTTAGCAGGAGCTATTACAATATTACTTACTGATCGGAATTTTAATACTTCTTTTTTTGACCCTGCTGGAAGGGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGACATCCTGAGGTTTATATTTTAATTTTACCAGGATTTGGTATTGTTTCTCATGTAATTAGTTCTTCTGTAGGAAAGCGAGAACCTTTTGGGAGATTAGGAATAATTTATGCAATAGTGGGAATTGGAGGAATAGGATTTGTTGTTTGAGCTCATCATATATTTTCGGTAGGGATAGATGTTGATACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xysticus sp. MCH-2003

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Xysticus sp. 3GAB

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTACTTTTTGGGGCTTGATCTGCTATAGTAGGTACTGCAATAAGAGTTTTAATTCGAATAGAGTTAGGTAATGTAGGAAGATTATTAGGGAATGATCATTTATATAATGTTATTGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTTTAATTGGGGGATTTGGAAATTGGTTAGTACCATTAATATTAGGTGCTCCTGATATATCATTTCCTCGCATAAATAATTTATCTTTTTGGTTACTTCCACCTTCTTTATTTTTATTATTTATATCATCTTTAGTAGAAATAGGTGTAGGAGCTGGATGAACTGTATATCCTCCTCTAGTATCTAGTGTAGGTCATATAGGAAGATCTATAGATTTTGCTATTTTTTCTCTTCATTTGGCAGGTGCTTCTTCTATTATAGGAGCTGTAAATTTTATTTCTACAATTATTAACATGCGAGTGACTGGAATGTCTATAGAAAAAGTACCTTTATTTGTTTGATCTGTCTTAATTACAGCTATTTTACTTCTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGTAATTTTAATACTTCTTTTTTTGACCCTGCAGGAGGAGGGGATCCTATTTTATTTCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xysticus sp. 3GAB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Xysticus sp. 2GAB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Xysticus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Xysticus

Xysticus is a genus of ground crab spiders described by C. L. Koch in 1835, belonging to the order Araneae, family Thomisidae. The genus name is derived from the Ancient Greek root xyst, meaning "scraped, scraper".


Distribution[edit]

The genus Xysticus is distributed almost worldwide, but has not been recorded from South America. Of the about 360 species of the genus currently described, about 71 are present in Europe.

Description[edit]

Xysticus species
Xysticus species eating a beetle

Xysticus and Coriarachne are dark brown or reddish-brown crab spiders often encountered on weeds or trees. While similar to the 'flower spiders', they tend to have shorter, sturdier legs. Many, but not all, species have abdomens more patterned than most Thomisus species, rather like some of the Synema species. Some however, that are more terrestrial, resemble earth in colour and texture.

Ground Crab Spider in genus Xysticus, with earthy coloration

Most species of the genus Xysticus are small to medium sized spiders. They show a sexual dimorphism in size. Females of typical species reach a maximum of 10 millimetres (0.39 in) of body length, while their males are about 3–5 millimetres (0.12–0.20 in) long, about half the size of the females.

The basic colour of these species is usually brown, beige or gray. The prosoma is sometimes slightly smaller than the opisthosoma. In many species the front body shows in the middle a broad, pale longitudinal band. The opisthosoma is clearly flattened in most species and shows a median broad and dark leaf marking.

The species are often very similar to each other, and in most cases can be distinguished only by a microscopic examination of the reproductive organs.

Behaviour[edit]

The spiders of the genus Xysticus do not build webs; like most Thomisidae they are ambush hunters and prefer to hunt near the ground (hence the common name "ground crab spiders"). They move slowly, and commonly hunt by stationing themselves in a high-traffic area and grabbing whatever arthropod passes close enough. Also like most other Thomisidae, they seize prey with their enlarged anterior two pairs of legs and kill it by a venomous bite.

References[edit]

  • Norman I. Platnick - Thomisidae
  • J. H. Redner and C. D. Dondale - A New Species of The Spider Genus Xysticus (Araneae: Thomisidae) From Arizona - PsycheVolume 72 (1965), Issue 4, Pages 291-294
  • H. Demir, O. Seyyar, and M. Aktaş - A Poorly Known Species of the Spider Genus Xysticus C. L. Koch (Araneae, Thomisidae) in Turkey - Arch. Biol. Sci., Belgrade, 60 (4), 17P-18P, 2008
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!