Articles on this page are available in 1 other language: Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

Biology

Male corn buntings have a colourful sex life, and individuals have been known to mate with as many as 18 different females in a single breeding season. The male plays no part in incubating the eggs but does sometimes help with feeding the young. Three to five eggs are laid between late May and July, in a nest of dried grass built by the female in arable crops or rough grassy margins. The young are fed on insects, and the birds may produce two broods in the season, although one is more usual. Whilst adult corn buntings are primarily seedeaters, like many other seed-eating birds, they feed their young on invertebrates. They take weed seeds, as well as cereal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The prolonged song of the male corn bunting, resembling nothing so much as the jangling of a bunch of keys, was once a far more familiar sound. This bird, the largest of UK's native buntings, is a fairly plain brown coloured bird, easily overlooked when compared to its more colourful relatives. The song is delivered from a perch, sometimes quite close to the ground. In short flights, corn buntings tend to fly with their legs hanging down, a feature that can help with identification in the field.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Although common in southern Europe, the corn bunting is declining throughout its northern range. This is especially true in the UK, where it has suffered a 76% decline in its breeding population between 1968 and 1991. The breeding range extends from Orkney and the Outer Hebrides to southern and eastern England, but its distribution is patchy and it is now uncommon or absent from many areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range

Grasslands and scrub of Palearctic region.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This is a lowland bird of open arable and mixed farmland. The British Trust for Ornithology (BTO) estimated that in the early 1990's there were only 20,000 breeding territories in the UK, highlighting the extent by which species has declined.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Emberiza calandra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTGATTTTCGGCGCATGAGCCGGAATGGTAGGTACCGCCTTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGAGGATTCGGAAACTGACTCGTCCCCCTAATAATCGGAGCCCCGGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTACTCCTCCTAGCATCCTCTACCGTCGAAGCAGGTGTCGGTACAGGTTGAACAGTATACCCCCCACTGGCCGGTAACCTAGCCCACGCCGGAGCCTCAGTTGACCTAGCAATCTTCTCCCTACACCTAGCCGGTATTTCCTCAATCCTAGGAGCAATTAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTTTGATCAGTCCTAATCACAGCAGTCCTACTACTCCTATCCCTCCCAGTCCTCGCTGCAGGGATTACAATGCTTCTCACAGACCGTAACCTCAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCCGTCCTGTACCAACACCTCTTCTGATTCTTCGGCCACCCGGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Emberiza calandra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5