Articles on this page are available in 1 other language: Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

Biology

Male corn buntings have a colourful sex life, and individuals have been known to mate with as many as 18 different females in a single breeding season. The male plays no part in incubating the eggs but does sometimes help with feeding the young. Three to five eggs are laid between late May and July, in a nest of dried grass built by the female in arable crops or rough grassy margins. The young are fed on insects, and the birds may produce two broods in the season, although one is more usual. Whilst adult corn buntings are primarily seedeaters, like many other seed-eating birds, they feed their young on invertebrates. They take weed seeds, as well as cereal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The prolonged song of the male corn bunting, resembling nothing so much as the jangling of a bunch of keys, was once a far more familiar sound. This bird, the largest of UK's native buntings, is a fairly plain brown coloured bird, easily overlooked when compared to its more colourful relatives. The song is delivered from a perch, sometimes quite close to the ground. In short flights, corn buntings tend to fly with their legs hanging down, a feature that can help with identification in the field.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Although common in southern Europe, the corn bunting is declining throughout its northern range. This is especially true in the UK, where it has suffered a 76% decline in its breeding population between 1968 and 1991. The breeding range extends from Orkney and the Outer Hebrides to southern and eastern England, but its distribution is patchy and it is now uncommon or absent from many areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range

Grasslands and scrub of Palearctic region.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This is a lowland bird of open arable and mixed farmland. The British Trust for Ornithology (BTO) estimated that in the early 1990's there were only 20,000 breeding territories in the UK, highlighting the extent by which species has declined.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Emberiza calandra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Emberiza calandra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTGATTTTCGGCGCATGAGCCGGAATGGTAGGTACCGCCTTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATGATCGGAGGATTCGGAAACTGACTCGTCCCCCTAATAATCGGAGCCCCGGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCCCCATCCTTCCTACTCCTCCTAGCATCCTCTACCGTCGAAGCAGGTGTCGGTACAGGTTGAACAGTATACCCCCCACTGGCCGGTAACCTAGCCCACGCCGGAGCCTCAGTTGACCTAGCAATCTTCTCCCTACACCTAGCCGGTATTTCCTCAATCCTAGGAGCAATTAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTTTGATCAGTCCTAATCACAGCAGTCCTACTACTCCTATCCCTCCCAGTCCTCGCTGCAGGGATTACAATGCTTCTCACAGACCGTAACCTCAACACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCCGTCCTGTACCAACACCTCTTCTGATTCTTCGGCCACCCGGAAGTCTATATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor and winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Protected by the Wildlife and Countryside Act (1981), as amended, Schedule 1 of the Wildlife (Northern Ireland) Order 1985 and EC Birds Directive.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 7.9-22 million breeding pairs, equating to 23.7-66 million individuals (BirdLife International 2004). Europe forms 50-74% of the global range, so a very preliminary estimate of the global population size is 32-132 million individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The corn bunting has probably declined due to changes in farming practices, especially the reduction in mixed farming. Extensive use of pesticides has reduced the numbers of arable weed species, an important food source for the adults, and insects, vital for rearing chicks. The switch from spring to autumn-sown cereals and consequent loss of weeds and stubbles, is probably a vital cause of the population drop, as it has led to the loss of both nesting and feeding habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The corn bunting is listed in the UK Biodiversity Action Plan (UKBAP), and included in English Nature's Species Recovery Programme (SRP). There is no evidence that set-aside has helped improve the numbers of corn buntings, as they have continued to decline, since set-aside was compulsorily introduced in 1993. Agri-environmental schemes, such as the Countryside Stewardship Scheme and Environmentally Sensitive Areas (ESAs) provide the best hope of improving the quality of the corn bunting's farmland habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Corn Bunting

The Corn Bunting (Emberiza calandra) is a passerine bird in the bunting family Emberizidae, a group now separated by most modern authors from the finches, Fringillidae. It is usually placed in the genus Emberiza, but some taxonomists place it in the monotypic genus Miliaria.[2]

Description[edit]

This is an unusual bunting because the sexes appear similar in plumage, although the males are approximately 20% larger than females. This large bulky bunting is 16–19 cm long, has male and female plumages similar, and lacks the showy male colours, especially on the head, common in the genus Emberiza. Both sexes look something like larks, with streaked grey-brown above, and whitish underparts.

The song of the male is a repetitive metallic sound, usually likened to jangling keys, which is given from a low bush, fence post or telephone wires.


Problems playing this file? See media help.

Distribution and habitat[edit]

It breeds across southern and central Europe, north Africa and Asia across to Kazahkstan. It is mainly resident, but some birds from colder regions of central Europe and Asia migrate southwards in winter.

The Corn Bunting is a bird of open country with trees, such as farmland and weedy wasteland. It has declined greatly in northwest Europe due to intensive agricultural practices depriving it of its food supply of weed seeds and insects, the latter especially when feeding young.It has recently become extinct in Ireland, where it was previously common.

Behaviour and ecology[edit]

Food and feeding[edit]

Its natural food consists of insects when feeding young, and otherwise seeds.

Breeding[edit]

Males defend territories in the breeding season and can be polygynous, with up to three females per breeding male. The population sex ratio is generally 1:1, which means some males remain unmated during a season. Males play only a small role in parental care; they are not involved in nest building or incubation, and only feed the chicks when they are over half grown.

The nest is made of grass, lined with hair or fine grass, and is usually built on the ground. Average clutch size is 4, but commonly varies from 3 to 5, occasionally 6.

Status and conservation[edit]

In England, the governments Environmental organisation Natural England offers grants towards implementing measures to conserve this species, under the Environmental Stewardship scheme.[3]

References[edit]

  1. ^ BirdLife International (2012). "Miliaria calandra". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Allende, Luis M; Rubio I, Ruíz-del-Valle V, Guillén J, Martínez-Laso J, Ernesto L, Varela P, Zamora J, Arnaiz-Villena A. (2001). "The Old World Sparrows (Genus Passer) Phylogeography and Their Relative Abundance of Nuclear mtDNA Pseudogenes". Journal of Molecular Evolution. 53(2): 144–154. 
  3. ^ Natural England Environmental Stewardship Scheme webpages
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!