Overview

Brief Summary

The fish known as the Red Irish Lord (Hemilepidotus hemilepidiotus) is a large sculpin (family Cottidae). Like most sculpins, Red Irish Lords are only partially scaled. In the case of the Irish Lords group (Hemilepidotus species) there is a band of scales on the back and a second band below the lateral line. In H. hemilepidotus, the back band is 4 to 5 scale rows wide (with much smaller scales above); the band below the lateral line is around 10 scale rows wide. Red Irish Lords are reddish, with brown, white, and black mottling above; whitish below. There are usually four dark saddles on the back. Maximumum length is around 50 cm, but fish over 30 cm are rare.



Red Irish Lords range from the Bering Sea (Russia) south to Monterey Bay (California, U.S.A.) (this species is common in Alaska, but rare in California).They are found near shore in rocky areas from the intertidal zone to around 50 m. This is the most common Hemilepidotus species and is sometimes caught on baited hooks; it is reportedly good eating.



These colorful fish lay their egg masses in intertidal areas during the spring. Adults feed on crabs, barnacles, and mussels.

(Boschung et al. 1983; Eschmeyer and Herald 1983)

  • Boschung, H.T., Jr., Williams, J.D., Gotshall, D.W., Caldwell, D.K., and M.C. Caldwell. 1983. The Audubon Society Field Guide to North American Fishes, Whales, and Dolphins. Alfred A, Knopf, New York.
  • Eschmeyer, W.N. and E.S. Herald. 1983. A Field Guide to Pacific Coast Fishes of North America. Houghton Mifflin, Boston.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Usually near shore in rocky areas (Ref. 2850), from intertidal areas to 275 m depth (Ref. 6793). Adults feed on crabs, barnacles, and mussels (Ref. 6885). Good eating (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Kamchatka, Russia and along the Commander and Aleutian Islands to St. Paul Island in the Bering Sea and to Monterey Bay, California, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: southern Bering Sea and Aleutian and Commander Islands to central California and to southeastern Kamchatka.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10 - 12; Dorsal soft rays (total): 18 - 20; Analspines: 0; Analsoft rays: 13 - 16; Vertebrae: 35
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 510 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

51.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 1,110 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Dorsal with moderate notches in the spinous part after the third spine, and between the spinous and rayed parts; caudal bluntly rounded; pelvic fins larger in males (Ref. 6885). Color variable, predominately red, sometimes brilliant red, with brown, white, and black mottling and spotting all over; there are four irregular dark saddles across back; the caudal fin with darker rays, sometimes with vertical light bars; some large males with darkly spotted pelvic fins (including base of pectorals) (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 0 - 450 m (Ref. 58496)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 0 - 139.5
  Temperature range (°C): 4.743 - 10.476
  Nitrate (umol/L): 4.616 - 23.683
  Salinity (PPS): 31.499 - 32.792
  Oxygen (ml/l): 5.643 - 7.285
  Phosphate (umol/l): 0.748 - 1.923
  Silicate (umol/l): 10.583 - 29.445

Graphical representation

Depth range (m): 0 - 139.5

Temperature range (°C): 4.743 - 10.476

Nitrate (umol/L): 4.616 - 23.683

Salinity (PPS): 31.499 - 32.792

Oxygen (ml/l): 5.643 - 7.285

Phosphate (umol/l): 0.748 - 1.923

Silicate (umol/l): 10.583 - 29.445
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 275m.
Recorded at 275 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemilepidotus hemilepidotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTAAGCCTCTTAATTCGAGCTGAACTGAGCCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTATAACGTAATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGCTTTGGAAACTGACTCATCCCTCTGATGATCGGCGCCCCCGACATAGCATTTCCTCGAATAAATAACATGAGCTTCTGGCTTCTTCCTCCCTCCTTTCTACTGCTTCTCGCCTCTTCAGGGGTAGAAGCAGGGGCCGGAACGGGATGAACAGTCTACCCCCCTCTCGCTGGCAATCTGGCTCATGCAGGAGCCTCTGTTGACCTGACAATTTTCTCCCTACATTTGGCAGGGATCTCCTCAATTCTTGGGGCAATTAATTTTATCACAACCATCATCAATATGAAACCCCCTGCCATCTCTCAATACCAGACACCTCTTTTCGTGTGATCCGTCCTCATCACGGCCGTCTTACTGCTTCTCTCCCTGCCAGTCCTTGCTGCCGGCATCACAATGCTCCTAACAGACCGCAATCTTAACACCACCTTTTTCGACCCGGCGGGAGGTGGGGACCCCATTCTCTACCAACACCTCTTTTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hemilepidotus hemilepidotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hemilepidotus hemilepidotus

Hemilepidotus hemilepidotus, the red Irish lord (US) or bullhead, is a species of fish in the family Cottidae. It is found in the northern Pacific ocean, from Russia to Alaska and as far south as Monterey Bay.

Physical description [edit]

Hemilepidotus hemilepidotus has a maximum recorded length of 51.0 cm, and a maximum recorded weight of 1,110 grams.[2] It is predominantly red, with white, brown and black mottling and has 10-12 dorsal spines, 18-20 dorsal soft rays and 35 vertebrae.

Habitat and behavior [edit]

Hemilepidotus hemilepidotus lives in temperate, demersal marine environments between 66°N - 34°N. It usually lives close to rocky shores but can survive at depths as low as 450 meters. Adults feed on mussels, crabs, and barnacles. They are not harmful to humans, with the possible exception of injuring oneself on their various barbs and spines while handling one barehanded.

References [edit]

  1. ^ Tilesius, W. G. von 1811 Piscium Camtschaticorum descriptiones et icones. Mémoires de l'Académie Impériale des Sciences de St. Petersbourg v. 3: 225-285, Pls. 8-13.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Hemilepidotus hemilepidotus" in FishBase. December 2008 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!