Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 37.5
  Temperature range (°C): 27.103 - 27.103
  Nitrate (umol/L): 1.285 - 1.285
  Salinity (PPS): 35.585 - 35.585
  Oxygen (ml/l): 4.522 - 4.522
  Phosphate (umol/l): 0.154 - 0.154
  Silicate (umol/l): 2.560 - 2.560

Graphical representation

Depth range (m): 1 - 37.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strombus raninus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATTTGGCATGTGATCTGGCTTAGTTGGAACTGCTTTGAGTCTTTTAATCCGAGCTGAACTTGGACAACCAGGAGCCTTATTAGGTGAC---GACCAGCTGTATAACGTAATTGTTACAGCTCATGCATTCGTTATAATTTTCTTTTTAGTTATACCTATAATGATTGGAGGTTTTGGTAATTGATTAGTACCATTAATGTTAGGGGCTCCTGATATAGCTTTTCCGCGATTAAATAACATAAGATTTTGATTGCTACCCCCTGCTCTCTTGTTATTACTCTCTTCCGCAGCTGTTGAAAGTGGTGTTGGTACAGGATGAACAGTTTATCCCCCATTAGCCGGTAATTTAGCTCATGCTGGTGGATCAGTTGACTTGGCTATTTTTTCTCTTCATTTAGCTGGTGTGTCTTCCATTTTAGGAGCTGTTAATTTCATTACTACAATTATTAATATACGCTGACGAGGAATGCAATTTGAGCGACTACCTCTCTTTGTATGATCAGTTAAAATTACTGCTGTCTTACTCCTGCTTTCTTTGCCTGTGTTAGCTGGTGCTATTACGATACTTCTTACAGATCGAAATTTCAATACTGCATTTTTTGATCCCGCAGGAGGAGGTGATCCTATTTTATACCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strombus raninus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lobatus magolecciai

Lobatus magolecciai is a species of sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.[2]

Contents

Description

The shell grows to a length of 93 mm. It differs from Lobatus raninus in these characteristics :

  • the alation (wing-like outer lip) ends in a single extended lobe (rather than two) beyond the height of the spire
  • the shell shows twelve nodules (a swollen knob-like structure) instead of two
  • the aperture is yellowish white (instead of red or blue) [3]

Distribution

This species is found in the Caribbean Sea along the Isla Margarita, Venezuela, found at depths up to 29 m.

References

  1. ^ Macsotay & Villarroel (2001). Representative mollucs from the Margariata shelf Venezuela. Editoria Rivolta, Valencia 280 p.. World Register of Marine Species, Retrieved 27 June 2010.
  2. ^ a b Lobatus magolecciai (Macsotay & Villarroel, 2001). WoRMS (2010). Lobatus magolecciai Ma(csotay & Villarroel, 2001). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=565372 on 26 March 2011.
  3. ^ Macsotay, O. and R. Campos Villarroel. 2001. Molucos representativos de la Plataforma de Margarita - Venezuela. [iii], iii, 280 pp., 32 pls. Editora Rivolta: Valencia, Venezuela; July 2001
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Lobatus raninus

A shell of Lobatus raninus.

Lobatus raninus, common name the hawk-wing conch, is a species of medium to large sea snail, a marine gastropod mollusk in the family Strombidae, the true conchs.[1]

Contents

Shell description

A drawing depicting the shell of Lobatus raninus from Index Testarum Conchyliorum (1742).

The maximum recorded shell length is 121 mm[2] or up to 130 mm.[3]

Like other species in the same genus, Lobatus raninus has a robust, somewhat heavy and solid shell, with a distinct stromboid notch. The body whorl is dorsally ornamented by characteristic coarse spiral ridges.[3] The posterior expansion of the flaring outer lip is always lower than the spire.[3]

The color is brownish, with several disperse white spots. Both inner and outer lips are cream or white.[3]

Phylogeny

A cladogram based on sequences of nuclear histone H3 gene and mitochondrial cytochrome-c oxidase I (COI) gene showing phylogenetic relationships of (32 analyzed) species in the genus Strombus and Lambis, including Strombus raninus, was proposed by Latiolais et al (2006)[4]:




 Eastern Pacific and Atlantic 






Strombus gallus



Strombus gigas




Strombus costatus





Strombus raninus



Strombus peruvianus





Strombus galeus




Strombus latus







Strombus pugilis



Strombus alatus




Strombus gracilior




Strobus granulatus







Strombus bulla



Strombus aurisdianae




Strombus vomer






Strombus gibberulus



Strombus luhuanus





 Lambis 


Lambis chiragra



Lambis truncata




Lambis lambis





Strombus taurus



Strombus sinuatus












Strombus maculatus



Strombus mutabilis





Strombus microurceus



Strombus labiatus







Strombus fragilis



Strombus urceus




Strombus dentatus







Strombus canarium



Strombus vittatus




Strombus epidromis






Strombus fusiformis



Strombus haemostoma





Strombus wilsoni



Distribution

This species is distributed in the Caribbean Sea, the Gulf of Mexico and the Lesser Antilles.

Ecology

Habitat

S. raninus lives near seagrass beds, usually in shallow water.[3] The minimum recorded depth is 0.3 m; the maximum recorded depth is 55 m.[2]

Feeding

Like other species of the genus Strombus, S. raninus is known to be a herbivore.

References

  1. ^ a b Bouchet, P. (2010). Lobatus raninus (Gmelin, 1791). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=531851 on 2011-03-21
  2. ^ a b Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  3. ^ a b c d e Cervigón, F. et al. (1993): FAO species identification sheets for fishery purposes. Field guide to the commercial marine and brackish-water resources of the northern coast of South America. Rome, FAO. 513 p.
  4. ^ Latiolais J. M., Taylor M. S., Roy K. & Hellberg M. E. (2006). "A molecular phylogenetic analysis of strombid gastropod morphological diversity". Molecular Phylogenetics and Evolution 41: 436-444. doi:10.1016/j.ympev.2006.05.027. PDF.
  • Rosenberg, G., F. Moretzsohn, and E. F. García. 2009. Gastropoda (Mollusca) of the Gulf of Mexico, Pp. 579–699 in Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!