Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemaris radians

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACATTATACTTCATTTTTGGGATTTGAGCAGGAATGGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGTAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCACATGCATTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGTGGATTTGGAAACTGACTTGTACCCCTAATATTAGGTGCACCTGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCACCATCTTTAACCTTACTTATTTCTAGAAGTATTGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCTAATATTGCTCATAGAGGAAGATCAGTAGATTTGGCAATTTTTTCTCTTCATTTAGCTGGTATTTCCTCAATTTTAGGGGCAATTAATTTCATTACTACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTCTATTTGTGTGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTCTCACTGACCGAAATCTAAACACATCATTTTTTGATCCTGCAGGTGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hemaris radians

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hemaris radians

Hemaris radians is a moth of the Sphingidae family. It is known from southern Siberia, Mongolia, the southern Russian Far East, north-eastern and central-eastern China, the Korean Peninsula and Japan.[2]

The wingspan is 37–40 mm. The forewing discal cell is longitudinally divided by a distinct or vestigial scale fold, rarely undivided. There are two forms, form mandarina and form radians. Adults are on wing from mid May to late July in Korea.

The larvae have been recorded feeding on Lonicera and Rubia species in the Russian Far East and Lonicera japonica in Korea.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Archived from the original on 2012-11-10. Retrieved 2011-10-19. 
  2. ^ Pittaway AR; Kitching I. "Sphingidae of the Eastern Palaearctic". Tpittaway.tripod.com. Retrieved 2011-10-19. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!