Overview

Brief Summary

Summary

Mauremys reevesii, Reeves’ Turtle (or Chinese Three-keeled Pond Turtle) (Family Geoemydidae), is a moderate-sized aquatic species (carapace length to 300 mm) widely distributed in East Asia throughout central and eastern continental China, exclusive of the most southern, western, and northern regions, and including Taiwan, southern Japan, and part of the Korean peninsula. However, the native distribution has been extended by human-aided translocations. The turtle lives in freshwater habitats in lowland areas with still or slowly moving water. Although no concrete data are available regarding the status of most populations, it is apparent that most have experienced major declines as a result of habitat destruction and/or commercial over-exploitation. Intentional and accidental releases of specimens from continental Asia may be altering the genetic stock of Japanese populations. Effective conservation of the species will require habitat protection and regulations to control the collection and transportation of wild animals. Additional studies are needed on the status, life history, and demography of the species.
  • Lovich, J.E., Yasukawa, Y., and Ota, H. 2011. Mauremys reevesii (Gray 1831) – Reeves’ Turtle, Chinese Three-keeled Pond Turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., Iverson, J.B., and Mittermeier, R.A. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 050.1–050.10, doi:10.3854/crm.5.050.reevesii.v1.2011, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The Chinese pond turtle mates in spring, with nesting occurring in June and July, and up to three clutches of four to nine eggs are laid each season. Newly hatched young in Japan reportedly spend the winter in the nest and emerge in March or April the following spring (2). This is an omnivorous species that feeds on aquatic plants and fruits as well as worms, aquatic insects, frogs and fishes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The diminutive Chinese pond turtle has a somewhat rectangular upper shell (carapace) with three distinct keels, or ridges, running down its length, which become worn and less pronounced with age (4) (5). The upper shell typically ranges from tan to dark brown (4) (5), while the skin is usually grey-green with yellowish spots and a distinctive pattern of yellow stripes running along the sides of the head and neck (5) (6). However, the shell and skin of melanistic individuals may be completely black and lack this striping (2) (6). Melanism occurs very rarely in females, but is common in older males. The lower shell (plastron) is generally yellow with a large brown blotch on each scute, but is dark brown or black in melanistic individuals (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Mauremys reevesii is native to most of temperate and subtropical China, North Korea and South Korea; populations also occur in Taiwan, Hong Kong and Japan, though these may be historic introductions by humans (Fong and Chen 2010). Populations recorded from Timor (Indonesia), Timor Leste and Palau certainly originated from human introductions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

China, Japan (introduced?), North Korea, South Korea, Taiwan (introduced?); introduced in Indonesia, Japan, Palau, Timor-Leste. Native distribution includes most of central and eastern continental China and the Korean peninsula, with populations in Taiwan and southern Japan possibly introduced in prehistoric and historic times.
  • Lovich, J.E., Yasukawa, Y., and Ota, H. 2011. Mauremys reevesii (Gray 1831) – Reeves’ Turtle, Chinese Three-keeled Pond Turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., Iverson, J.B., and Mittermeier, R.A. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 050.1–050.10, doi:10.3854/crm.5.050.reevesii.v1.2011, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Asia
Distribution: Japan (Honshu, Kyushu) [?], Korea, Taiwan, China (south of the Yangtze River west to Canton: Sichuan, Shaanxi, Hubei, Henan, Anhui, Zhejiang, Jiangxi, Hong Kong, Fujian), Timor-Leste.  "The three main islands of Honshu, Kyushu, and Shikoku, and many of the smaller offshore islands, including Sadogashima, Oki, Tsushima, Iki, Awajishima, and the Goto Archipelago” (Goris and Maeda 2004: 139)  
Type locality: “China”  megalocephala: China (Nanking region, Hubei, Henan, Hebei, Jiangxi, Hunan), SW North Korea, NW South Korea, Japan (Hokkaido, Kyushu, Shikoku, Honshu);
Type locality: "hillsides of the vicinity of Nanking City," Jiangsu Province, China. Type: MASN, according to Fang 1934.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Recorded from mainland China, Hong Kong, Taiwan, Japan and Korea (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Mauremys reevesii is a generalist inhabitant of vegetated shallow lowland ponds, pools and marshes, including wetlands in agricultural landscapes if the species is not collected. It feeds on a variety of plant and small animal matter, with snails possibly representing a significant part of the diet of mature females.

Males rarely exceed 11 cm carapace length (CL), females can reach up to 24 cm CL. Females reach maturity in about five to six years in captivity and may produce several clutches of three to five eggs annually; reproductive data of wild populations appear unreported.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually found in relatively shallow ponds, marshes, streams and canals that have muddy or sandy bottoms (2) (5). These semi-aquatic turtles will frequently leave the water to bask on rocks or logs (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 24.2 years (captivity) Observations: A wild caught adult animal has been kept in captivity for over 24 years (http://www.pondturtle.com/). It is then likely that maximum longevity in this species is underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chinemys reevesi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chinemys reevesi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Mauremys reevesii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTTTTTAACCCGCTGATTTTTTTCTACAAACCACAAAGACATTGGCACCCTATATTTGATTTTCGGGGCCTGAGCAGGTATAGTAGGCACAGCATTAAGTTTATTAATCCGCGCAGAATTAAGCCAACCTGGAGCCCTCCTAGGGGACGACCAAATCTATAATGTTATCGTTACAGCCCATGCCTTTATCATAATTTTCTTCATGGTTATACCCGTTATAATCGGCGGCTTTGGAAACTGACTTGTACCTTTAATGATCGGAGCGCCAGATATGGCATTCCCACGTATAAACAATATAAGCTTCTGGCTTCTACCCCCATCCCTACTTTTACTTCTGGCCTCCTCAGGAATTGAAGCAGGCGCAGGCACAGGCTGAACTGTGTACCCACCATTAGCTGGAAACCTAGCCCACGCTGGCGCCTCTGTAGATCTAACTATCTTTTCCCTTCACCTAGCAGGTGTGTCATCAATTTTAGGGGCCATCAACTTTATCACCACAGCAATTAACATAAAATCTCCAGCTATATCACAGTACCAAACACCCTTATTTGTGTGATCTGTACTTATTACAGCCGTCCTATTACTACTCTCGCTACCAGTACTCACCGCAGGTATTACTATATTACTCACAGACCGAAACCTAAATACAACCTTCTTCGACCCTTCAGGGGGAGGGGACCCAATTTTATATCAACACCTGTTTTGATTCTTTGGTCATCCTGAAGTATACATCCTAATCTTACCAGGATTCGGCATGATCTCACATGTTGTCACCTATTACGCTGGTAAAAAAGAACCATTTGGGTACATAGGAATAGTTTGAGCAATAATATCTATCGGATTCCTGGGCTTTATTGTATGGGCCCACCACATATTTACTGTTGGGATAGATGTAGACACCCGAGCTTATTTTACATCCGCAACAATAATTATTGCTATCCCAACAGGAGTAAAAGTATTTAGCTGGCTAGCCACCCTTCATGGAGGGATAATTAAATGAGACGCCGCTATGTTATGAGCACTTGGCTTTATCTTTCTATTTACTATTGGAGGTCTTACAGGCATCGTGCTAGCCAATTCATCCTTAGATATTGTATTACATGATACCTACTACGTAGTAGCACACTTCCATTATGTTCTCTCTATGGGAGCTGTATTCGCTATTATAGCAGGATTCACTCATTGATTCCCACTCTTCACTGGATACTCATTACACCAAACTTGAGCGAAAATCCACTTTGGGGTAATATTTGCAGGCGTTAACATCACCTTTTTCCCCCAACATTTCTTAGGCTTAGCCGGAATACCACGACGTTACTCTGACTACCCAGATGCATACACCCTATGAAATTCTATCTCATCAATCGGATCTCTAATCTCCCTAATAGCAGTAATTATAATAATATTCATTATTTGAGAAGCATTCTCTTCAAAACGAAAAGTAATAACAGTTGAACTCACAACTACTAATGTTGAATGATTACACGGCTGCCCACCCCCATACCACACCTACGAAGAGCCAGCCCATGTTCAAACCCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mauremys reevesii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bcd+4bcd

Version
3.1

Year Assessed
2011

Assessor/s
van Dijk, P.P.

Reviewer/s
Horne, B.D., Lau, M.W.N., Mittermeier, R.A., Philippen, H.-D., Quinn, H.R. & Rhodin, A.G.J.

Contributor/s

Justification
Mauremys reevesii has become subject to intensive exploitation for food and medicine and to supply the aquaculture industry with breeding animals, as well as being extensively impact by habitat degradation and loss; it has declined to extinction across most of its range in P.R. China, with only outlying (and possibly historically introduced) populations in Taiwan (offshore islands only) and Japan remaining at reasonably original densities. Generation time is estimated at a minimum of 10 years. Over the past 30 years the species has disappeared from at least half its original area of occurrence as a result of targeted collection, and collection pressures continue, qualifying the species for EN A2bcd+A4bcd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

  • Lovich, J.E., Yasukawa, Y., and Ota, H. 2011. Mauremys reevesii (Gray 1831) – Reeves’ Turtle, Chinese Three-keeled Pond Turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., Iverson, J.B., and Mittermeier, R.A. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 050.1–050.10, doi:10.3854/crm.5.050.reevesii.v1.2011, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1) and listed on Appendix III of CITES in China (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Historically a common and widespread species, Mauremys reevesii is now a rare species in the wild. The species is commercially farmed in vast quantities in P.R. China and captive populations likely amount to millions of individuals.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Wild populations of Mauremys reevesii are threatened first and foremost by intensive targeted collection to supply the consumption, medicinal and aquaculture supply trades.

In addition, habitat destruction and degradation due to urbanization and pollution is also an important threat for this lowland species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Chinese pond turtle makes a popular pet and this has led to its over-collection in China, where the species is also eaten. Elsewhere, the turtle is considered to be under little risk (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Mauremys reevesii is listed in CITES Appendix III (China). Assurance colonies (comprising animals of generally unknown geographic origin and genetic profile) and large-scale commercial farm holdings will ensure that the species itself will not go extinct anytime soon, but it has already disappeared as a common landscape species across most of its range; its best prospects for survival in the wild lies in strict protection and appropriate management of lowland wetland protected areas within its original range, and eventually re-introduction into regions where the species has been extirpated by overexploitation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Its listing on Appendix III of the Convention on International Trade in Endangered Species (CITES) in China helps regulate the number of Chinese pond turtles that can be exported (3). Fortunately, this species breeds well in captivity and captive-bred individuals now supply much of the demand in the pet market (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chinese pond turtle

Mauremys reevesii in East Timor

The Chinese pond turtle, Reeves' turtle, or Chinese three-keeled pond turtle (Mauremys reevesii)[1] is a species of turtles in the family Geoemydidae (formerly called Bataguridae). It is found in China, Japan, Korea and Taiwan.[1][4] This species is semiaquatic, and basks in the sun on rocks or logs and can often be found leaving water to do so. They can usually be found in marshes, relatively shallow ponds, streams, and canals with muddy or sandy bottoms.

The Chinese pond turtle is threatened by overhunting (its plastron is used in traditional Chinese medicine)[5][6] and habitat destruction in the wild. The IUCN considers C. reevesii an endangered species.[4] This species, fortunately, breeds well in captivity, and is at risk the most in China.

Hybridization[edit]

This species is notorious for its ability to produce hybrids with other Geoemydidae, even species that are only distantly related. The supposed new species "Mauremys" pritchardi was based on a hybrid of unknown origin between a male of this species and a female yellow pond turtle (Mauremys mutica). Furthermore, it has hybridized with the Chinese stripe-necked turtle (Ocadia sinensis), female Malayan box turtles (Cuora amboinensis), a male four-eyed turtle (Sacalia quadriocellata), and the Japanese pond turtle (Mauremys japonica) in captivity.[7][8]

Any individuals that are available as pets therefore need to be kept separate from other members of the family.

Farming[edit]

M. reevesii is one of the species raised on China's turtle farms. According to a 1998 survey, 548 farms raised this turtle species in four provinces in China. The statistical data from different provinces were in different formats; however, two provinces reported 20,650 turtles living on 26 farms, with 5,000 animals reproduced annually; the other two provinces reported the total weight of their turtles, namely some 260 tons of these animals on 522 farms. Over the five-year period, 1990–1995, 13 traditional Chinese medicine factories consumed 430 tons of C. reevesii plastrons.[9]

Based on a more recent (2002) survey of 684 Chinese turtle farms (less than half of all 1,499 turtle farms that were registered at the time), researchers found that 2.8 million of turtles of this species (reported there as Chinemys reevesii) lived on these farms, with some 566,000 specimens sold by farmers every year. The total weight of the annual product was 320 tons, with the estimated value of over US$6 million, which makes the market value of a Chinese pond turtle equal to around $12—about twice as much that of the most common farmed species, Pelodiscus sinensis.) Taking into account the registered farms that did not respond to the survey, as well as the unregistered producers, the total amounts must be considerably higher.[10]

References[edit]

  1. ^ a b c d e Rhodin, Anders G.J.; van Dijk, Peter Paul; Inverson, John B.; Shaffer, H. Bradley (2010-12-14). "Turtles of the world, 2010 update: Annotated checklist of taxonomy, synonymy, distribution and conservation status". Chelonian Research Monographs 5: 000.112. doi:10.3854/crm.5.000.checklist.v3.2010. Archived from the original on 2010-12-15. 
  2. ^ Asian Turtle Trade Working Group (ATTWG) (2000). Chinemys reevesii. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 29 July 2007.
  3. ^ Fritz Uwe; Peter Havaš (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 232–233. ISSN 18640-5755. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 
  4. ^ a b ATTWG (2000)
  5. ^ da Nóbrega Alves, Rômulo Romeu; da Silva Vieira; Washington Luiz & Gomes Santana, Gindomar (2008): Reptiles used in traditional folk medicine: conservation implications. Biodiversity and Conservation 17(8): 2037–2049. doi:10.1007/s10531-007-9305-0 (HTML abstract, PDF first page)
  6. ^ Subhuti Dharmananda. "Endangered species issues affecting turtles and tortoises used in Chinese medicine". 
  7. ^ * Parham, James Ford; Simison, W. Brian; Kozak, Kenneth H.; Feldman, Chris R. & Shi, Haitao (2001): New Chinese turtles: endangered or invalid? A reassessment of two species using mitochondrial DNA, allozyme electrophoresis and known-locality specimens. Animal Conservation 4(4): 357–367. PDF fulltext Erratum: Animal Conservation 5(1): 86 HTML abstract
  8. ^ Buskirk, James R.; Parham, James F. & Feldman, Chris R. (2005): On the hybridisation between two distantly related Asian turtles (Testudines: Sacalia × Mauremys). Salamandra 41: 21-26. PDF fulltext
  9. ^ GUO Yinfeng, ZOU Xueying, CHEN Yan, WANG Di & WANG Sung. "Sustainability of Wildlife Use in Traditional Chinese Medicine". 1998. ; also quoted in: Subhuti Dharmananda. "Endangered species issues affecting turtles and tortoises used in Chinese medicine". 
  10. ^ Shi, Haitao; Parham, James F; Fan, Zhiyong; Hong, Meiling; Yin, Feng (2008-01-01), "Evidence for the massive scale of turtle farming in China", Oryx (Cambridge University Press) 42: 147–150, doi:10.1017/S0030605308000562, retrieved 2009-12-26 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!