Overview

Brief Summary

Biology

polyp colonial, medusa benthic, shallow water to intertidal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

description

Polyp stage: Hydroids forming initially stolonial, later erect colonies, arising from attached, ramified stolons. Branching of stems irregular, reaching 15 mm (up to 50 mm in very large colonies). Branches originate at acute angles and are adnate for some distance afterwards, then curving away and becoming free. Branches 160 to 200 mm in diameter, some few expanding distally; perisarc firm, mostly heavily infested with detritus and algae, without annulations, terminating below hydranths. Perisarc double-layered, inner layer corrugated. Hydranths in material from New Zealand intensively orange-red. Relaxed hydranths are spindle shaped and reach 0.8 mm in height, with 12 to 20 filiform tentacles of different length (max. 0.6 mm), highly contractile, scattered over distal 3/4 of hydranth; hypostome conical, hydranth not retractable into perisarc, stressed hydranths contract to egg shape. Medusae buds arise below hydranths in perisarc covered region, mostly one bud, occasionally more. The medusae buds arise from short stems which may also be adnate for some distance after their origin. Also hydranths arising directly from stolons but belonging to an branching colony can bear medusae buds. Nematocysts: a) microbasic euryteles, (7-8)x(3-4)um, s=0.9. b) microbasic mastigophores, rare, in body and cauli of larger polyps, (5.5-7)x(3-4)um, s=0.7. c) desmonemes, discharged with four coils, (4.5-5.5)x(2.5-3)um. Young medusa: Newly released medusa spherical, light orange in New Zealand material, manubrium with four perradial lips with nematocyst clusters, manubrial peduncule present, base of manubrium and transition to radial canals with very large vacuolated gastrodermal cells, four interradial orange pads on distal part of manubrium. With four radial canals and circular canal. With eight tentacles, arising from bulbs with an inconspicuous adaxial ocellus. The exumbrella appears granulated and is slightly opaque. Nematocysts: a) microbasic euryteles in tentacles, (7-8)x(3-4)um. b) microbasic euryteles of manubrium, (8.5-10)x(3-3.5)um. c) desmonemes, discharged with four coils, (5-6.5)x (2.5-3.5)um. Adult medusa: Adult medusa up to 7 mm high, bell-shaped, higher than wide, jelly thin, at apex thicker. Stomach cross-shaped in axial view, manubrium not longer than bell cavity. Manubrium with intensively red colour. Four radial masses of large vacuolated gastrodermal cells form a compact mass above stomach. Mouth with four lips with nematocyst clusters along margin. Four radial canals which continue through vacuolated gastrodermal masses to manubrium. Gonads on interradial walls of manubrium, in mature females with developing embryos and planulae. Many tentacles (up to 120), arising from closely spaced tentacle bulbs, these with adaxial ocelli. Nematocysts: a) microbasic euryteles in tentacles, (8-9)x(4-5)um, s=0.9. b) microbasic euryteles from manubrium, (7-9.5)x(3-4)um, s=0.7. c) desmonemes of tentacles, (5.5-7)x(3.5-4.5)um.
  • Schuchert, P., 1996. The marine fauna of New Zealand: Athecate hydroids and their medusae (Cnidaria: Hydrozoa). New Zeal. Oceanog. Inst. Mem. 106 : 1-159.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Turritopsis rubra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGAATGGTAGGAACAGCTCTAAGTATGTTAATTAGATTAGAACTAACTTCTCCAGGAGCTATGTTTGGAGAT---GATCACTTGTATAATGTTATAGTCACAGCTCATGCCTTTGTAATGATATTCTTTTTAGTAATGCCTGTATTAATAGGTGGTTTTGGTAATTGATTTATACCATTATATATAGGAGCACCTGATATGGCTTTCCCCAGATTAAATAATTTAAGTTTTTGATTATTACCACCTGCTCTGATTCTATTACTAGGCTCTTCACTAGTAGAACAAGGAGCTGGTACAGGTTGAACAGTCTATCCTCCTTTATCAGGACCACAATCACATTCTGGAGGTTCAGTAGATATGGCTATTTTTAGTTTACATTGTGCTGGAGCTTCATCAATAATGGGGGCTATAAACTTTATAACCACTATTTTTAATATGAGAGCACCTGGATTAACCTTTGATAAATTACCTCTATTTGTATGATCTGTTTTAATAACTGCTTTTTTATTACTACTATCTTTACCAGTATTAGCTGGTGCTATAACAATGTTATTAACAGATAGAAACTTCAATACTACATTCTTTGATCCAGCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Turritopsis rubra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!