Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Callionima nomius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Callionima nomius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCCTTAATATTAGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCACCTTCTTTAACTTTACTTATTTCTAGAAGTATTGTTGAAAATGGAGCTGGAACTGGGTGAACAGTGTACCCCCCACTATCATCCAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCCGGAATTTCTTCTATTATAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAATAGATTAACTTTTGACCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTCTTATTATTATTATCTTTACCAGTATTAGCTGGAGCAATTACAATACTTCTAACAGATCGAAATCTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGATCCCATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Callionima nomius

The Fan-tailed Bark Moth (Callionima nomius) is a moth of the Sphingidae family . It is found from Mexico and Central America to the north-western half of South America.

The wingspan is 70-80 mm. It is immediately distinguishable from all other Callionima species by the forewing upperside pattern and hindwing upperside colour. The forewing upperside is deep brown with a pale brown triangular patch on the costa and a silver discal spot represented only by a minute dot. The hindwing upperside is dark brown with a buff base.

Adults are on wing year round. Adults nectar at flowers, including Nicotiana forgetiana.[2]

The larvae probably feed on Apocynaceae species, possibly including Aspidosperma macrocarpa.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!