Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Callionima nomius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Callionima nomius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAAACCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCCTTAATATTAGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCACCTTCTTTAACTTTACTTATTTCTAGAAGTATTGTTGAAAATGGAGCTGGAACTGGGTGAACAGTGTACCCCCCACTATCATCCAATATTGCTCATAGAGGAAGATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCCGGAATTTCTTCTATTATAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAATAGATTAACTTTTGACCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTCTTATTATTATTATCTTTACCAGTATTAGCTGGAGCAATTACAATACTTCTAACAGATCGAAATCTAAATACATCATTTTTTGACCCAGCTGGAGGAGGAGATCCCATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Callionima nomius

The Fan-tailed Bark Moth (Callionima nomius) is a moth of the Sphingidae family . It is found from Mexico and Central America to the north-western half of South America.

The wingspan is 70–80 mm. It is immediately distinguishable from all other Callionima species by the forewing upperside pattern and hindwing upperside colour. The forewing upperside is deep brown with a pale brown triangular patch on the costa and a silver discal spot represented only by a minute dot. The hindwing upperside is dark brown with a buff base.

Adults are on wing year round. Adults nectar at flowers, including Nicotiana forgetiana.[2]

The larvae probably feed on Apocynaceae species, possibly including Aspidosperma macrocarpa.

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-10-19. 
  2. ^ "Silkmoths". Silkmoths.bizland.com. Retrieved 2011-10-19. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!