Overview

Comprehensive Description

Protoconch II about 0.4 mm in length, which indicates a long planktonic larval stage with a high dispersal capability. The extremely enlarged gills contain sulphide oxidizing chemoautotrophic symbiotic bacteria. A commensal polychaete of the genus Branchipolynoe was encountered within the mantle cavity of most specimens. Mussels of the genus Gigantidas are found on warm seeps near active submarine volcanoes and therefore are included herein. The species lives in dense populations at sulphur-rich hydrothermal seepings, they are partly buried in sediment.
  • COSEL R. VON & B.R. MARSHALL (2003) Nautilus 117: 31-46.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southwestern Pacific: Rumble III and Rumble V submarine volcanoes, S-Kermadec Ridge, New Zealand; Western Pacific: Kaikata Seamount, SW of Ogasawara (Bonin) Island.
  • COSEL R. VON & B.R. MARSHALL (2003) Nautilus 117: 31-46.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Shells large to very large, aduliform, extremely long, elongate and sword-shaped, rather thin for the size but solid, with flattened and very broad umbones situated well subterminally in the anterior half of the valves. Ventral margin well concave. Periostracum strong and dark brown; valves dull white beneath the periostracum. Inner mantle folds separate along whole length of the ventral margin their edges frilled along the posterior fifth of the shell length or less. Valvular siphonal membrane almost absent, but a deep cleft between inner mantle fold of right and left valve. Attachment point of the anterior foot-byssus retractor muscle directly above the anterior adductor scar and united with it; posterior byssus retractor complex multibundle with two principle diverging muscle bundles and two additional thin bundles.
  • COSEL R. VON & B.R. MARSHALL (2003) Nautilus 117: 31-46.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Shell length up to 31.6 cm.
  • COSEL R. VON & B.R. MARSHALL (2003) Nautilus 117: 31-46.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gigantidas gladius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAATAATTGGTACAAGCTTAAGTATACTAATTCGTATTGAATTAGCGCGTTCTGGAAGATTTTTAGGAGAT---GATCAACTTTATAATGTCATTGTGACTGCTCATGCCTTGGTTATAATTTTTTTTATGGTTATACCTTTAATAGTAGGGGGCTTTGGAAATTGGTTACTTCCCTTAATGATGGGTTCAATTGACATAATTTTTCCACGCTTAAATAACTTAAGCTTTTGATTTTTACCTGCATCTCTCTTTACTCTTTTGTTATCTACATTTATTGAGAGTGGTGCCGGAACTGGTTGAACTTTATACCCCCCTTTATCTTCTTATACCGGGCATAGGGGCCCAGCAGTTGATATATCTCTGTTTTCTTTACATTTAGCAGGTGCTTCTTCTATTGGAGGGTCAATTAATTTTCTTACAAGGATGAAGAATATGTCCGTTGAAAGAATACGAGGAGAGCGAATAGTCCTATTCGTTTGGTCTATGGCCGTAACAGCGGTTTTATTACTAGTTTCTCTACCTGTACTAGCAGGAGGAATTACCATGTTGATTTTTGATCGCCATTTTAATACCTCTTTTTATGACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gigantidas gladius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gigantidas gladius

Gigantidas gladius is a species of large, deepwater, hydrothermal vent mussel, a marine bivalve mollusc in the family Mytilidae, the mussels.

Distribution and habitat[edit]

These mussels are found around deep-sea hydrotherma vents on the southern Kermadec Ridge, New Zealand. They form dense beds in these sites.

Description[edit]

The shells of this species are up to 30 cm long.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!