Molecular Biology and Genetics

Molecular Biology

Barcode data: Dovania poecila

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATTGGTGATGATCAAATCTATAATACAATTGTTACAGCACATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGGCTCCTACCCCCCTCATTAATGCTATTAATTTCTAGTAGTATTGTTGAAAACGGAGCTGGAACAGGTTGAACAGTATATCCGCCACTATCTTCAAATATTGCTCATAGAGGAAGATCTGTTGACTTAGCTATCTTCTCATTACATTTAGCTGGTATTTCATCTATTTTAGGAGCAATTAACTTTATTACCACAATTATTAACATACGAATTAATAACATATCATTTGATCAAATACCATTATTTGTTTGAGCAGTTGGAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCAATTACTATATTACTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGGGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dovania poecila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dovania poecila

Dovania poecila is a moth of the Sphingidae family. It is known from forests (usually above 4,000 feet) in Kenya, Uganda, Rwanda, Burundi, Tanzania and Malawi.[2]

The length of the forewings is 30–35 mm. The head and body are blackish, woolly, with a series of white transverse bands interrupted at the dorsum on the abdomen. The forewings are very dark purplish brown with faint, irregular paler transverse bands, a small white stigma and two prominent white lines at the apex. The hindwings are bright coppery, but blackish near the inner margin.

The larvae feed on Acanthus pubescens.[3]

References[edit]

  1. ^ "CATE Creating a Taxonomic eScience - Sphingidae". Cate-sphingidae.org. Retrieved 2011-11-01. 
  2. ^ "Revised Catalogue of the African Sphingidae (Lepidoptera) with Descriptions of the East African species". Biodiversitylibrary.org. Retrieved 2011-11-01. 
  3. ^ Afromoths[dead link]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!