Evolution and Systematics

Functional Adaptations

Functional adaptation

Footpads dampen shock: bush-cricket
 

The tissue structure of cricket footpads dampens the shock of jumping due to a flexible exocuticle and dense fibers.

   
  "The fluid within the pad between the filaments contributes to the visco-elastic behaviour of the pad, because the fluid is able to flow through the gaps between the rods, when the pad deforms during contact formation and breakage (Gorb et al. 2000). The interconnecting filaments presumably prevent rod buckling, when these are bending during contact. The pad presumably works as a damper during jump or landing at high speed of the deformation, as well as a means of replicating a complex substratum profile at slow deformation speeds. Also, the rod-like organization of the pad architecture would allow an independent local load distribution over the area of contact between pad and substrate. This would aid in an enhancement of the adaptation of the pad to imperfections of natural substrata…The structural principle, based on branching rods, contributes to holding the shape of the pad. This principle, combined with the presence of a relatively stiff superficial layer, provides the adaptability of the attachment pad to unevenness of natural substrata." (Perez Goodwyn et al. 2006:1241)
  Learn more about this functional adaptation.
  • Perez Goodwyn, P.; Peressadko, A.; Schwarz, H.; Kastner, V.; Gorb, S. 2006. Material structure, stiffness, and adhesion: Why attachment pads of the grasshopper (Tettigonia viridissima) adhere more strongly than those of the locust (Locusta migratoria) (Insecta: Orthoptera). Journal of Comparative Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology. 192(11): 1233-1243.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Footpads stick to vertical surfaces: great green bushcricket
 

Pads on bushcricket feet stick to vertical surfaces due to angled rods and a secreted viscous fluid.

   
  "Like the gecko, the great green bushcricket (Tettigonia viridissima) is endowed with 'sticky' feet. It can walk on smooth vertical surfaces, and even upside down, with no trouble. Unlike the gecko, the bushcricket has smooth footpads. It relies not on van der Waals forces between the footpad and the substrate, but on design of the footpad itself. The cuticle of an insect's footpad is comprised of the soft material found just below the exoskeleton elsewhere in the body. In the bushcricket, this soft material covers another cuticle layer: a thicket of fine, branching rods that slope forwards at an angle of around 60 degrees. As the foot presses down, the rods bend and the pad molds itself around the irregular surface below, achieving the maximum contact. As a final adhesive measure, the bushcricket secretes a viscous fluid onto its pads. It actually leaves footprints when it walks. This design has an advantage over the hairy-sole system used by geckos in that the bushcricket can easily lift its legs. It does not need to 'peel' its feet off the substrate." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tettigonia viridissima

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCATTCCCTCGAATAAATAATATAAGATTCTGATTACTACCCCNTTCTTTAACCCTTTNATTAAGAAGTAGCCTAGTAGAAAATGGTGCTGGTACTGGTTGAACGGTTTACCCTCCTTTATCATCAGGTATTGCTCATGCAGGGGCCTCAGTAGATTTA---GCAATCTTCTCACTACATTTAGCCGGAGTTTCATCCATCCTAGGAGCAGTAAACTTTATTACAACAACCATTAATATACGAGCTCCTGGTATATCATTAGATCAAACACCTTTATTTGTATGAGCTGTTGCAATCACTGCTCTACTGCTTCTTCTTTCACTACCCGTATTGGCTGGG---GCTATTACAATACTACTAACCGATCGAAATTTAAATACCTCATTCTTTGATCCAGCAGGAGGAGGGGATCCTATTTTATACCAACATCTCTTCTGATTCTTCGGCCACCCTGAGGTGTATATTCTAATTCTTCCAGGATTTGGTATAGTTTCACACATTATTAGTCAAGAAAGAGGAAAGAAG---GAAGCATTCGGAACATTAGGAATAATCTATGCAATAATAGCAATTGGATTATTAGGTTTTGTTGTATGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGGGCTTACTTTACTTCAGCCACTATAATTATTGCCGTACCTACTGGTATTAAAATTTTTAGTTGATTA---GCAACT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tettigonia viridissima

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tettigonia viridissima

Tettigonia viridissima, the Great Green Bush-Cricket, is a species of 'katydids crickets' belonging to the family Tettigoniidae, subfamily Tettigoniinae. This species can be encountered from Europe to Mongolia, especially in meadows, grasslands, prairies and occasionally in gardens.

The adult males grow up to 28–36 millimetres (1.1–1.4 in) long, while females reach 32–42 millimetres (1.3–1.7 in). This insect is most often completely green (but there are specimens completely yellowish or with yellow legs), excluding a rust-colored band on top of the body. The organ of the stridulation of the males is generally brown.

Tettigonia viridissima is distinguished by its very long and thin antennae, which can sometimes reach up to three times the length of the body, thus differentiating them from grasshoppers, which always carry short antennae. Possible confusion with Tettigonia cantans, whose wings are shorter than the ovipositor of a centimeter and Tettigonia caudata whose hind femurs bear very visible black spines.

The morphology of both sexes is very similar, but the female has an egg-laying organ (ovipositor) that can reach a length of 23–32 millimetres (0.91–1.26 in). It reaches the end of the elytra and is slightly curved downward. The larvae are green and as the imago show on their back a thin brown longitudinal stripe. The ovipositor can be seen from the fifth stage; the wings appear in both genders from the sixth stage.

Tettigonia viridissima is carnivorous and arboreal. Its diet is mostly composed of flies, caterpillars and larvae. Unlike many grasshoppers, it is essentially active in day and night, as testified by its endless crepuscular and nocturnal singing.

Stridulating Green Bush-Crickets

This grasshopper can bite painfully but it is not particularly aggressive. It is better to avoid holding the insect in the fist, because the bite is almost assured. They are fit to flight, but their real performances are quite modest. Most often it moves "on foot" or jumps, which allows it to easily explore the bushes, trees and shrubs.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!