Ecology

Associations

Animal / parasitoid / endoparasitoid
solitary larva of Trichogramma brassicae is endoparasitoid of egg of Acanthoscelides obtectus

Animal / parasitoid / endoparasitoid
solitary larva of Trichogramma brassicae is endoparasitoid of egg of Lepidoptera
Other: sole host/prey

Animal / parasitoid / endoparasitoid
solitary larva of Trichogramma brassicae is endoparasitoid of egg of Pieris brassicae

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Trichogramma brassicae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Trichogramma brassicae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGAGACCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCAAGATTAATATTATTATTATCTAGAATATTTATTGGAACAGGAACTGGAACAGGTTGAACTGTTTACCCTCCTTTATCTTCGAATTTATCTCATAGTGGTCCTTCAGTGGATTTATCAATTTTTTCTTTACATATTGCTGGGGTTTCTTCAATTATAGGTTCAATCAATTTTATTACAACAATTTTAAATATAAAAATTTATAAAATT------GAGTTAATTTCCTTATTTTCTTGAGCTATATTATTAACAGCAATTTTATTATTATTGTCATTACCAGTTTTAGCTGGGGCAATTACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCTTCAGGGGGTGGTGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Trichogramma brassicae

Trichogramma brassicae is a wasp species.[1]

References[edit]

  1. ^ Andrew D. Austin; Mark Dowton (2000). Hymenoptera: Evolution, Biodiversity and Biological Control. CSIRO Publishing. p. 373. ISBN 0643066101. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!