Molecular Biology and Genetics

Molecular Biology

Barcode data: Apoda limacodes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTAATAATTCGAATGGAACTCGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGAGGATTCGGTAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTGCTCCCCCCTTCCTTAATATTACTTATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTCTTTCTTCTAATATTGCTCATAGTGGAAGATCAGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTATTATTAATATACGACCTAATGGTATATCTTTCGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACCGCATTACTTCTTCTTCTTTCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAACTTAAATACTTCTTTTTTCGATCCAGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Apoda limacodes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Apoda limacodes

The Festoon (Apoda limacodes) is a moth of the family Limacodidae. It is found in Europe.

Caterpillar

The wingspan is 20–30 mm. The moth flies in June and July in Belgium and The Netherlands.

The Festoon mainly inhabits thick woodlands, and it is mainly nocturnal, but it will occasionally fly in the sun.

The larvae feed on oak and beech.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!