Overview

Brief Summary

Biology

A migratory species, the giant catfish is thought to move from the Tonle Sap Lake in Cambodia from October to December each year and into the Mekong River from which it progresses upstream into northeastern Cambodia, Laos or Thailand to spawn (1). The giant catfish eats the vegetation growing on the river bed (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The giant catfish is the world's largest freshwater fish (1). It has a whitish underside and the back and fins are grey. The eyes are located low on the head and point downwards. Whilst juveniles have barbels, adults can be distinguished from other large catfish by their reduced barbels and lack of teeth (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

A migratory species (Ref. 37772) which occurs in medium to large-sized rivers (Ref. 12975). Feeds on detritus and algae on the bottom (Ref. 58784); feeds only on vegetation in the river but takes other food in captivity; little is known on its general pattern of life and migratory journeys for spawning (Ref. 2686). Shows one of the fastest growth rates of any fish in the world, reaching 150 to 200 kg in 6 years (Ref. 12693). Cited in the Guinness Book of Records as largest freshwater fish (Ref. 6472). Marketed fresh (Ref. 12693). Maximum length of 300 cm needs confirmation. Threatened due to over harvesting and habitat loss (Ref. 58490).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Asia: endemic to the Mekong basin where it has become rare due to overexploitation. International trade banned (CITES I, since 1.7.1975; CMS Appendix I).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This is a Mekong endemic species (Rainboth 1996). Historically, it was distributed throughout the Mekong River basin from the coast of Viet Nam to northern Lao PDR. Past reports of the species occurring as far north as southern Yunnan Province in China (Smith 1945, Roberts and Vidthayanon 1991) remain unconfirmed. The species' migration patterns are unknown. However, based on catch information provided by Roberts (1993) and others, it is believed that this fish migrates from the deep pools of the lower Mekong, upstream into northeast Cambodia and possibly up to Lao PDR or Thailand to spawn (Hogan et al. 2001). At least one spawning site is known (northern Thailand/Lao PDR), with a further possible spawning area in northeast Cambodia (Z. Hogan, pers. comm. 2003). There may have been other (lost) spawning sites in the middle and lower reaches of the Mekong (M. Kottelat pers. comm.). Its extent of occurrence is estimated at around 4,150 km² (Z. Hogan, pers. comm. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Thailand

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mekong River basin, southeastern Asia; stocked in various reservoirs in Thailand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The giant catfish is endemic to the parts of the Mekong River basin that run through Cambodia, Laos, Thailand, Viet Nam and possibly Burma and China. It is primarily found in the Tonle Sap River, the Tonle Sap Lake and the Mekong River (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 7 - 8; Analsoft rays: 35; Vertebrae: 48
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 3000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 30857)); 235 cm SL (female); max. published weight: 350.0 kg (Ref. 43281)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body without stripes; posterior nostril located near anterior nostril; 7 branched dorsal-fin rays; gill rakers rudimentary or absent; fins grey, never black (Ref. 12693). The center of the eye above the horizontal line through the mouth angle in juveniles; eye totally below the level of mouth angle in subadults and adults. The maxillary and mandibulary pairs of barbels well developed in juveniles; mandibulary barbels become rudimentary in subadults and adults (Ref. 9448). Gigantic size; oral teeth and gill rakers present in small juveniles, absent at about 30-50 cm SL; dorsal, pelvic and pectoral fins without filamentous extensions (Ref. 43281). Distinguished from other large catfish in the Mekong by its lack of teeth and the almost complete absence of barbels (Ref. 2686)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species is one of the world's largest freshwater fish, measuring up to three meters in length and weighing in excess of 300 kg (Smith 1945, Roberts and Vidthayanon 1991). It is a migratory species. From October to December each year, the species moves out of the lower Mekong, it is believed to migrate upstream into northeastern Cambodia and possibly Lao PDR, or Thailand to spawn (Z. Hogan et al. 2001).

The fish was bred in captivity for the first time in 2001. Individuals artificially spawned from wild-caught parents have been released into the Mekong since 1985, however this practice is now thought to have stopped and fish are now only introduced into reservoirs and not into the Mekong (Z. Hogan pers. comm. 2011). The fish almost certainly spawns upstream of Chiang Khong, Thailand. Possible spawning sites include the Kok River near Chiang Saen, Thailand, although this site requires confirmation (C. Vidthayanon pers. comm. 2011). Previously known spawning sites in the Mekong River are between Loei and Nong Khai Provinces, and in Ubon Ratchathani Province before the river fully enters Lao

First maturation is 17 years, from artificial breeding recorded of the first offspring from wild spawners in the Thai Department of Fishery's ponds. Generation length for captive fish is possibly 35 years, but this is probably not representative of the wild fish. For wild individuals, generation length has been reported as less than ten years, however this is difficult to verify. The best estimate of generation length is between 10 and 15 years (Z. Hogan pers. comm. 2003), but this is a very uncertain estimate and further research on the life history of this species is needed to confirm this.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits freshwater rivers and lakes (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds heavily on fruit in high water when it enters the flooded forest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pangasianodon gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCGCTGATTTTTCTCGACTAACCATAAAGACATTGGCACCCTCTACCTAGTGTTTGGTGCCTGAGCCGGAATAGTTGGCACAGCCCTTAGCCTGCTAATTCGGGCAGAGCTAGCCCAACCCGGTGCCCTCCTGGGCGAT---GACCAAATCTATAATGTTATTGTCACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTTGGAAACTGACTCGTCCCCCTAATAATCGGAGCACCCGATATGGCATTCCCCCGAATAAATAATATGAGCTTTTGACTGCTTCCGCCCTCCTTCCTACTTCTGCTCGCCTCATCTGGAGTCGAGGCGGGAGCAGGAACAGGATGAACTGTCTACCCCCCTCTTGCAGGAAACCTTGCACATGCTGGTGCTTCTGTGGATTTAACTATTTTCTCCCTTCATCTTGCGGGGGTATCATCCATTCTAGGGGCCATTAACTTTATTACAACCATTATTAACATAAAACCTCCAGCAATTTCACAGTATCAGACACCCTTATTTGTATGAGCTGTCCTAATTACAGCCGTACTTCTACTATTATCTCTACCAGTACTGGCCGCCGGCATTACTATACTTCTAACAGATCGAAACCTAAACACTACATTCTTCGACCCCGCAGGAGGGGGAGATCCCATTCTATACCAACACCTCTTCTGATTCTTTGGGCACCCAGAAGTATACATTTTAATTCTACCAGGGTTTGGAATAATTTCTCATATTGTAGCCTATTATGCCGGCAAAAAAGAACCATTCGGTTACATAGGAATAGTATGAGCTATGATGGCTATTGGTCTCTTAGGCTTTATTGTCTGAGCCCACCACATATTTACAGTGGGAATAGACGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pangasianodon gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A4abcd

Version
3.1

Year Assessed
2011

Assessor/s
Hogan, Z.

Reviewer/s
Vidthayanon, C. & Allen, D.

Contributor/s

Justification
This species is endemic to the Mekong basin. It is known from the Tonle Sap Lake, Tonle Sap River, and the Mekong River. It is not known to occur in the upper 2,000 km of the Mekong River. The current extent of occurrence is estimated at around 4,150 km².

Historical reports indicate that the species was abundant in the early 1900s. However, in the 1970s, local fisheries began to report the disappearance of this fish. Generation length for the species is thought to be between 10 and 15 years. Current population size is unknown, but a decline of more than 80% over the last 21 years (since 1990) can be estimated from past annual catch records, qualifying the species for Critically Endangered under criterion A.

Fishing effort in the Mekong basin in general is increasing. Fishing effort specifically for this species in the Mekong River remains constant, although it may be increasing in some areas, such as in the Tonle Sap Lake. Habitat loss and degradation are also serious threats to this fish. There has been increasing siltation of the Mekong mainstream through past deforestation practices in the northern parts of the Mekong River area. The planned destruction of rapids in the stretch of the Mekong River in the northern Lao PDR, northern Thailand and southern China may also pose a serious threat to the species' spawning habitat. The loss of migratory routes through the construction of dams may also have a negative impact on fish abundance in the river.

Given the ongoing threats to the species and its habitat, the population decline rate seen over the last 21 years is not expected to diminish over the next 24 years. Therefore, the species is assessed as Critically Endangered A4bcde.

History
  • 2003
    Critically Endangered
    (IUCN 2003)
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Pangasianodon gigas , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The giant catfish is classified as Critically Endangered (CR A4bcde) on the IUCN Red List 2004 (1). It is listed on Appendix I of the Convention on the Conservation of Migratory Species of Wild Animals (2) and on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The current population size is unknown. A rate of population decline of over 80% can be estimated from combining annual catch data over the last thirteen years in the Mekong River Basin area:

From Thailand, there were 428 fish landed between 1983 and 2009. The species is targeted during the spawning season in Thailand and Lao (for roe). In 2010, no specimens were caught as fishing was banned. There is a quota set each year (catchment wide); in 2010 the quota was zero.

1983 - 2 landings
1990 - 65 landings
1993 - 22
1994-96 - zero
2004 - 7
2009 - 1

In Chiang Khong (northern Thailand), the catch has declined from a peak of 69 fish in 1990 to just seven fish in 1997 (Sretthachuea 1995, Hogan 1998). In 1999, 20 fish were captured in Chiang Khong, however no fish were caught in the area in 2001 (Hogan et al. 2001) or in 2002. In Nong Khai Province (northeast Thailand) 40-50 fish were caught per year in the early 1900s. However, since that time the number of fish caught has declined. In 1967, fishermen captured 11 fish in the area (Pookaswan 1969), and by 1970, the species occurred only rarely as bycatch in the beach seine fisheries (Pholprasith and Tavarutmaneegul 1998). Today, very few individuals are reported from Nong Khai Province.

In Luang Prabang (northern Lao PDR) the catch declined from 12 fish per year to just three fish caught in 1968. No fish were caught in 1972, 1973, or 1974 (Davidson 1975) and there has been no significant catch of the species reported since that time (Hogan et al. 2001). There are no recent data available on P. gigas catches in this area, but catches here are likely to be rare (Z. Hogan pers. comm. 2011).

In the Khone Falls (southern Lao PDR), a few fish were reported by fishermen each year prior to 1993, almost all of them in the first half of the year. No fish were reported in 1993. The status of the species in the Khone Falls area has not been assessed since 1993 (Baird, pers. comm. 2003). Since 2005, there have been some catches in the Khone Falls area; around 0-2 fish are caught each year as they move upstream and possibly over the falls (Z. Hogan pers. comm. 2011).

In the Tonle Sap River (Cambodia), four fish were captured in the bagnet fishery in 1999 and eleven fish reported in 2000. Fishermen report that they catch a few individuals each year (Hogan et al. 2001, Pengbun et al. 2001). No recent data are available from this area, but it is still likely that less than 10 Giant Catfish are caught here each year (Z. Hogan pers. comm. 2011).

Anecdotal information suggests that the species was once present in the Mekong Delta (Viet Nam), but is now reported as being very rare. One fish was caught close to, but not in, Viet Nam in 2003 (Z. Hogan, pers. comm. 2003). No significant fishery for the species exists in Viet Nam (Lenormand 1996).

Overall annual catch data for the Mekong River area indicate that around ten years ago 40-50 fish were caught each year. By 2003, the figure had dropped to approximately 5-8 catches per year (Z. Hogan, pers. comm. 2003). Since 2003, efforts to gather catch data for Giant Catfish have reduced and as a result very little data is available for recent years. However annual catches are still likely to be very low. The Tonle Sap River is one of the last places where the fish is caught in appreciable numbers. Although the species has been disappearing from Lao PDR, Thailand, and Viet Nam, there is little information on population trends in Cambodia (Hogan et al. 2001). In 2001 and 2002, no specimens were caught in northern Thailand. Annual catch figures for the Tonle Sap River in Cambodia over recent years were, four in 2000, 11 in 2001 and five in 2002.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A4abcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The major threat to the species is overfishing. The major future threat to this fish is the damming of the main stream Mekong River. Proposed dams that could impact the species if they are built include the Pak Lay, Pak Beng, Sayaboury, Luang Prabang, Latsua and Don Sahong in Laos, and the Stung Treng and Sambor in Cambodia. It is believed that sedimentation is not a threat the species, as the areas where it spawns have relatively strong currents and would stop excessive sediments from settling (W. Rainboth pers. comm.)

Alongside overfishing, main threats to the species include habitat loss and degradation (for example, as a result of damming of the Mun River and clearance of flooded forest in the Tonle Sap Great Lake), and genetic introgression with cultured stocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The giant catfish has been subject to over-fishing for many years. Catches at the beginning of the 20th century were in the thousands each year but declines have been so severe that less than ten are now caught per year (1). Habitat loss and degradation as a result of damming and the clearance of flooded forest near the Tonle Sap Lake (1) have disrupted the giant catfish's migration, spawning, eating and breeding habits (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been listed on CITES Appendix I since 1975. The species occurs in a Biosphere Reserve in the Tonle Sap Lake, and a Ramsar site in northeastern Cambodia, although neither of these sites offers real protection for the species. In Cambodia, it is illegal to capture, sell, or transport the species, although bagnet fisheries in the area still catch and sell the species. In Thailand, fishing for this species is regulated based on a quota license of less than 20 catches annually (C. Vidthayanon pers. comm. 2010). The species is also protected in Laos (M. Kottelat pers. comm. 2003) although this does not prevent the species being fished there.

The Thai Department of Fisheries began releasing captive-bred individuals in 1985. Between 2000 and 2003, approximately 10,000 captive-bred fish were released into the Mekong. Captive-bred individuals are no longer released into the Mekong, however they are released into reservoirs in Thailand. Large fish are now caught regularly in some Thai reservoirs but there is no evidence of self-sustaining populations. The fish have also been artificial hybridized with P. hypophthalmus for aquaculture purposes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The giant catfish has been listed on Appendix I of the Convention on International Trade in Endangered Species since 1975 when it first became apparent that it had seriously declined. It occurs in a Biosphere Reserve and a RAMSAR site (for wetlands of international significance), but both fail to provide active protection. In Cambodia and Thailand it is illegal to catch the giant catfish but this legislation is not enforced. In Laos it is protected, but again, this has no practical effect (1). Artificially spawned individuals have been released into the River Mekong since 1985, and captive breeding has been taking place since 2001 (1). The Mekong Fish Conservation Project works in cooperation with the Cambodian Department of Fisheries to conduct research and educate the public. This project has released 20 catfish into the river system since 2000 (5). Studies have provided evidence that it spawns in areas that will be impacted by the Mekong Navigation Improvement Project which plans to dredge long stretches of river and blast away areas with rapids that obstruct the passage of large ships. The project was partially underway before the reliability of the Environmental Impact Report was questioned, and the project was put on hold (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: experimental
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Mekong giant catfish

The Mekong giant catfish, Pangasianodon gigas, (Thai: ปลาบึก /ˈplaa bʉ̀k/; Lao: ປາບຶກ /pàː bɨ̆k/; Khmer: ត្រីរាជ /trəy riec/; Vietnamese: Cá tra dầu) is a species of catfish (order Siluriformes) in the shark catfish family (family Pangasiidae), native to the Mekong basin in Southeast Asia.

In Thai folklore, this fish is regarded with reverence, and special rituals are followed and offerings are made before fishing it.[2]

Contents

Species characteristics

The Mekong giant catfish is perhaps the most interesting and most threatened species in the Mekong River. For this reason, conservationists have chosen it as a sort of "flagship" species to promote conservation on the Mekong.[3][4] With recorded sizes of up to 10.5 ft (3.2 m) and 660 lb (300 kg), the Mekong giant catfish currently holds the Guinness Book of World Records' position for the world's largest freshwater fish.[5][3][6][full citation needed] Although research projects are currently ongoing, relatively little is known about this species. Historically, the fish's natural range reached from the lower Mekong in Vietnam (above the tidally influenced brackish water of the river's delta) all the way to the northern reaches of the river in the Yunnan province of China, spanning almost the entire 4,800-km length of the river.[7][full citation needed] Due to threats, this species no longer inhabits the majority of its original habitat; it is now believed to only exist in small, isolated populations in the middle Mekong region.[3] Fish congregate during the beginning of the rainy season and migrate upstream to spawn.[3] They live primarily in the main channel of the river, where the water depth is over 10 m,[8][full citation needed] while researchers, fishermen and officials have found this species in the Tonle Sap River and Lake in Cambodia, a UNESCO Biosphere reserve. In the past, fishermen have reported the fish in a number of the Mekong's tributaries; today,[when?] however, essentially no sightings are reported outside of the main Mekong river channel and the Tonle Sap region.

In infancy, this species feeds on zooplankton in the river and is known to be cannibalistic.[9][full citation needed] After approximately one year, the fish becomes herbivorous, feeding on filamentous algae, probably ingesting larvae and periphyton accidentally.[10][full citation needed] The fish likely obtains its food from algae growing on submerged rocky surfaces, as it does not have any sort of dentition.[9]

Conservation

Endemic to the lower half of the Mekong river, this catfish is in danger of extinction due to overfishing, as well as the decrease in water quality due to development and upstream damming by the People's Republic of China. The current IUCN Red List for fishes classes the species as Critically Endangered; the number living in the wild is unknown, but catch data indicate the population has fallen by 80% in the last 14 years.[1][11] It is also listed in Appendix I of CITES, banning international trade.[12]

In The Anthropologists' Cookbook (1977), Jessica Kuper noted the importance of the pa beuk to the Lao people and remarked, "In times gone by, this huge fish, which is found only in the Mekong, was fairly plentiful; but in the last few years the number taken annually has dwindled to forty, thirty or twenty, and perhaps in 1976 even fewer. This is sad, as it is a noble fish and a mysterious one, revered by the Lao."[13]

Fishing for the Mekong giant catfish is illegal in the wild in Thailand, Laos, and Cambodia, but the bans appear to be ineffective, and the fish continue to be caught in all three countries.[1] However, in recognition of the threat to the species, nearly 60 Thai fishermen agreed to stop catching the endangered catfish in June 2006, to mark the 60th anniversary of Bhumibol Adulyadej's ascension to the throne of Thailand.[14] Thailand is the only country to allow fishing for private stocks of Mekong giant catfish. This helps save the species, as lakes purchase the small fry from the government breeding program, generating extra income that allows the breeding program to function.[citation needed] Fishing lakes, such as Bung Sam Ran in Bangkok, have the species up to 140 kg. The most common size landed is 18 kg, although some companies specialise in landing the larger fish.

The species needs to reach 50 to 70 kg to breed, and unfortunately it does not breed in lakes. The Thailand Fishery Department has instituted a breeding program to restock the Mekong River. However, it is yet to be seen if the fish will spawn.

Size

Attaining an unconfirmed length of 3 m (9.8 ft), the Mekong giant catfish grows extremely quickly, reaching a mass of 150 to 200 kg (330 to 440 lb) in six years.[15] The largest catch recorded in Thailand since record-keeping began in 1981 was a female measuring 2.7 m (8 ft 10 in) in length and weighing 293 kg (650 lb). This specimen, caught in 2005, is widely recognized as the largest freshwater fish ever caught (although sturgeon can far exceed this size, they can be anadromous). Thai Fisheries officials stripped the fish of its eggs as part of a breeding programme, intending then to release it, but the fish died in captivity and was sold as food to local villagers.[16][17][5]

Grey to white in colour and lacking stripes, the Mekong giant catfish is distinguished by the near-total lack of barbels and the absence of teeth.[15]

Footnotes

  1. ^ a b c Hogan, Z. (2011). "Pangasianodon gigas". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 16 April 2012. 
  2. ^ Pla Buek: The Giant Catfish of the Mae Khong River Chiangrai
  3. ^ a b c d Hogan, Z. S. (2004). "Threatened Fishes of the World: Pangasianodon gigas Chevey, 1931 (Pangasiidae)". Environmental Biology of Fishes 70 (3): 210–210. doi:10.1023/B:EBFI.0000033487.97350.4c.  edit
  4. ^ MGCCG, 2005
  5. ^ a b Mydans, Seth (2005-08-25). "Hunt for the big fish becomes a race". The New York Times. Retrieved 3 March 2013. 
  6. ^ Hogan et al. 2007
  7. ^ (Lopez et al. 2007, Hogan et al. 2007)
  8. ^ (Mattson et al. 2002)
  9. ^ a b (Pholprasith, 1983 as cited in Mattson et al. 2002)
  10. ^ (Pookaswan, 1989 and Jensen, 1997 as cited in Mattson et al. 2002)
  11. ^ "Giant Catfish Critically Endangered, Group Says". National Geographic News. 2003-11-18. Retrieved 2006-06-29. 
  12. ^ "CITES Appendices I, II and III". CITES. 2006-06-14. Retrieved 2006-06-29. 
  13. ^ Kuper, Jessica (1977). The Anthropologists' Cookbook. Universe Books. p. 167. 
  14. ^ "Giant Mekong catfish off the hook". BBC News. 2006-06-10. Retrieved 2006-06-29. 
  15. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2006). "Pangasianodon gigas" in FishBase. March 2006 version.
  16. ^ Owen, James (2005-06-29). "Grizzly Bear-Size Catfish Caught in Thailand". National Geographic News. Retrieved 2006-06-29. 
  17. ^ "Fish whopper: 646 pounds a freshwater record". 2005-07-01. Retrieved 2006-06-29. 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!