Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Herring live in enormous schools, sometimes containing millions of fish. They swim at deep depths during the day. In the evening, they follow their prey closer to the surface and disperse just under the water surface for the night. Herring feed on small crustaceans, free-swimming snails and fish larvae. As they swim, they sift these small animals out of the water with the help of filters located on the inside of their gills. The filter is made up of long 'thorns' which are situated as a comb on the gills. In the Netherlands, herring is particularly known as the 'Holland Nieuwe'. All the various herring sold at the fish shop, the new herring, pickled herring, rolmops, salted herring, bokking and pan herring, are all the same fish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Herrings feed mainly on small oceanic shrimps or copepods and can filter-feed if there are sufficient densities of its prey to allow this. Individuals reach maturity between the ages of three and nine years. At any month of the year, one of the many populations scattered across its vast range will be spawning. The eggs are sticky and are laid on marine vegetation or the seabed. Fish in the North Sea spawn between January and April at a depth of no more than 70 metres and a sea temperature of 4 - 7 °C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Many people will be familiar with the herring as, for many years, it has been a staple of the fishmonger's slab. It is a shoaling fish and has the classical fish shape, and is silvery and streamlined. It has a single dorsal fin, and pelvic fins positioned slightly in front of the line of the dorsal fin. The pectoral fins, like the others on the fish, are soft and not stiff and 'bony' like on many other fishes. The lower jaw protrudes forward of the upper lip, and there is no visible lateral line. The body is deeper than it is wide, improving the streamlining, and the tail is deeply forked. The colouring of the body overall is silver, but closer inspection reveals that there is a darker blue iridescence over the upper half of the body, whilst the underside is paler. This colouration is called 'countershading', and provides a way of camouflaging the fish from attacks by its many predators from all angles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clupea harenus secara umum

Clupea harengus memiliki panjang maksimum 45 cm akan tetapi panjang rata-rata ikan ini adalah 30 cm. Habitat hidup ikan dilaut,bersifat bhentopelagic dan oceanodromuous. Secara umum ikan ini dapat hidup pada selang suhu perairan 1oC -1 18oC. Ikan ini sering juga disebut dengan Hering Atlantik. Pada masa musim dingi ikan ini akan bermigrasi mengikuti pola migrasi dari ikan-ikan sebelumnya. Ikan ini memakan zooplankton dan hewan=hewan dasar perairan. Predator ikan ini diantaranya ikan karnivora, mamalia laut, serta burung laut. Secara umum ikan ini memijah pada musim dingin di derah Norwegia dan Islandia, sedangkan pada musim gugur memijah di Islandia dan Laut Baltik.

Clupe Harengus tersebar di daerah utara Atlantik, di barat ikan ini tersebar dari barat daya Greenland dan bagian selatan dai Labrador sampai ke bagian selatan dari Carolina, AS. Pada bagian timur ikan ini terseba dari Islandia sampai ke Greenland , ikan ini juga banyak ditemukan di utara Teluk Biscay, Spitbergen, dan Novaya Zemlya di Rusia.

Ikan in merupakan ikan konsumsi dan biasanya diolah dalam bentuk ikan segar, ikan asin, ikan kering, diasapi, ikan kaleng, dan dapat di goring, dikukus serta di panggang.



  • BfN 2012 Threatened Biodiversity in the German North and Baltic Seas – Sensitivities towards Human Activities and the Effects of Climate Change. In prep.
  • Blaxter, J.H.S. 1990 The herring. Biologist 37(1):27-31.
  • Frimodt, C. 1995 Multilingual illustrated guide to the world's commercial coldwater fish. Fishing News Books, Osney Mead, Oxford, England. 215 p.
  • Holst, J.C., I. Roettingen and W. Melle 2004 The herring. In The Norwegian Sea ecosystem. p. 203-226.
Creative Commons Attribution 3.0 (CC BY 3.0)

© muhammad_idris_ITK46

Supplier: muhammad_idris_ITK46

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Clupea harengus is a streamlined shoaling fish. It may reach up to 40 cm in length and 0.68 kg in weight. The overall colouring of the body is silver but a darker blue iridescence is present over the upper half of the body. The underside is considerably paler. The body is deeper than it is wide, which improves the streamlined nature of the fish. The tail is deeply forked and has a single dorsal fin. The pelvic fins are situated slightly in front of the line of the dorsal fin. These, as well as the pectoral fins are not bony, like in many other fish, but are soft.Clupea harengus is a highly commercial marine fish and is being threatened by over-harvesting by commercial fishing fleets (Whitehead, 1985). Maturity is reached between the ages of 3 and 9 years. Atlantic herring predominantly feeds on small shrimps or copepods but is also known to filter-feed should the need arise.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Herring schools move between spawning and wintering grounds in coastal areas and feeding grounds in open water by following migration patterns learned from earlier year classes (Ref. 88171). Juveniles (up to 2 years) shoal close inshore, while adults are found more offshore (Ref. 6683). Adults spend the day in deeper water, but rise to shallower water at night (Ref. 89562). Light is an important factor in controlling their vertical distribution. A facultative zooplanktivorous filter-feeder, i.e., it can switch to filter-feeding if the food density and particle size are appropriate (Ref. 28664). Feed mainly on copepods finding food by visual sense. Herring schools often attract predators such as fish, birds, and marine mammals (Ref. 89563). Schooling, silvery sides, excellent hearing (capable of detecting frequencies between 30-4,000 Hz , Refs. 89391, 89564, 89566), and very fast escape response act as anti-predator devices (Ref. 28664). The most important races in the East Atlantic are the winter-spawning Norwegian and Icelandic herring, the autumn spawning Icelandic and North Sea herring and the Baltic Sea herring. Utilized fresh, dried or salted, smoked, canned and frozen; can be fried, broiled, microwaved and baked (Ref. 9988).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

The Atlantic herring is found over much of the northern part of the Atlantic Ocean, from the Bay of Biscay northward to Iceland and southern Greenland. It extends north-eastward to Spitzbergen and Novaya Zemlya in the Arctic Ocean, as well as into the Baltic. To the west, it ranges along the east coast of North America, from south-western Greenland and Labrador, down to South Carolina. Around UK waters, the herring occurs in the English Channel, the Irish Sea and the North Sea. There are a number of different races of the fish, found across its eastern range, in the Baltic and North Sea, and in Norwegian and Icelandic waters. The various races spawn at different times of the year.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Baltic Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Baltic sea, Belgian Exclusive Economic Zone, British Isles, Canadian part of the Arctic Ocean, Davis Strait, De Haan, European waters (ERMS scope), FAO fishing area 18, FAO fishing area 21, Grevelingen, Gulf of Maine, Gulf of St. Lawrence, Hudson Bay, Hudson Strait, IJsselmeer, Irish Exclusive economic Zone, North West Atlantic, Oostende, Oosterschelde, Polish Exclusive Economic Zone, Schelde estuary, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Voordelta, Westerschelde, Wimereux, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic: in the west, it ranges from southwestern Greenland and Labrador southward to South Carolina, USA. In the east, it ranges from Iceland and southern Greenland southward to the northern Bay of Biscay and eastward to Spitsbergen and Novaya Zemlya in Russia, including the Baltic Sea (Ref. 188).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is distributed from northern Bay of Biscay to Iceland and southern Greenland, eastward to Spitsbergen and Novaya Zemlya, including the Baltic. It is also seen along southwestern Greenland and Labrador down to South Carolina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Older references of Atlantic herring indicate that populations may move between different coastal regions after a number of years, disappearing off the coast of Norway, while showing up on the shores of Germany (Buffon, 1793). This process can be explained by climatic forcing of Atlantic herring migration occuring on a decadal cycle (Alheit and Hagen, 1997) as well as fluctuations in spawning caused by switches in recruitment in between northern and southern populations in the North Sea (Corten, 1999).

Clupea harengus are closely related to the Pacific herring Clupea pallasii pallasii, which resides mainly in the northern Pacific Ocean. Recent genetic evidence indicates that these two species diverged roughly 1.3 million years ago (Domanico, et al., 1996).

Biogeographic Regions: atlantic ocean (Native )

Other Geographic Terms: holarctic

  • Buffon, G. 1793. Natural history of birds, fish, insects and reptiles. Embellished with upwards of two hundred engravings. In five volumes. .... London: J.S. Barr.
  • Alheit, J., E. Hagen. 1997. Long-term climate forcing of European herring and sardine populations. Fisheries Oceanography, 6:2: 130-139.
  • Gulf of Maine Aquarium. 2004. "Herring Biology: What is a herring?" (On-line). Accessed October 26, 2004 at http://www.gma.org/herring/biology/what/default.asp.
  • Bigelow, H., W. Schroeder. 1953. Fishes of the Gulf of Maine. FISHERY BULLETIN OF THE FISH AND WILDLIFE SERVICE, 74: 88-99. Accessed October 26, 2004 at http://www.gma.org/fogm/Clupea_harengus.htm.
  • Corten, A. 1999. The reappearance of spawning Atlantic herring (Clupea harengus) on Aberdean Bank (North Sea) in 1983 and its relationship to environmental conditions. Canadian Journal of Fisheries and Aquatic Sciences, 56: 2051-2061.
  • Domanico, M., R. Phillips, J. Schweigert. 1996. Sequence variation in ribosomal DNA of Pacific (Clupea pallasii pallasii) and Atlantic herring (Clupea harengus). Canadian Journal of Fisheries and Aquatic Sciences, 53: 2418-2423.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

southwestern Greenland and Labrador southward to South Carolina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic (including Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Both sides of the North Atlantic. Off the European coast the herring ranges north to Norway, Iceland, Spitzbergen, and the White Sea; south to the Straits of Gibraltar. On the American coast as far north as northern Labrador and the west coast of Greenland; commonly as far south as Cape Cod and Block Island.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Whitehead, P. J. P., 1985; Blaxter, J. H. S., 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 21; Analspines: 0; Analsoft rays: 12 - 23; Vertebrae: 51 - 60
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Clupea harengus grow to about 17 inches (45.72 cm) and can weigh up to 1.5 pounds (0.68 kg) (Bigelow and Schroeder, 1953; Gulf of Maine Aquarium, 2004d). Atlantic herring stocks in the Baltic Sea have recently seen significant decreases in weight-at-age in all age-classes with larger declines in northern populations than southern populations, and in younger age groups than in older groups (Cardinale and Arrhenius, 2000). The result of this decrease in weight-at-age could be indicative of a change in the average size of all Clupea harengus populations, or it may only be a case of Baltic Sea populations.

Clupea harengus are laterally compressed, with a moderatly pointed nose, a large mouth at the tip of the snout, and a projecting lower jaw. They have a "saw-toothed keel" belly and a deeply forked tail. The keel is only weakly sawtoothed as compared to other members of its family. The dorsal fin is situated roughly midway down the back, and the abdominal fins are located almost directly below it. There is no adipose fin. The scales are large and loosely attached. The key anatomical difference between Clupea harengus and other members of the family is an oval patch of small teeth on the vomer bone at the center of the roof of the mouth (Bigelow and Schroeder, 1953).

The body color is of a deep steel blue or greenish blue, with silver sides and belly. Ventral and anal fins are translucent white. The pectorals are dark at their base and along the upper edge. The caudal and dorsal fins are also dark(Bigelow and Schroeder, 1953).

Range mass: 0.68 (high) kg.

Range length: 45.72 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Cardinale, M., F. Arrhenius. 2000. Decreasing weight-at-age of Atlantic herring (Clupea harengus) from the Baltic Sea between 1986 and 1996: a statistical analysis. ICES Journal of Marine Science, 57: 882-893.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

45.0 cm SL (male/unsexed; (Ref. 37032)); max. published weight: 1,050 g (Ref. 6114); max. reported age: 25 years (Ref. 89560)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 45.0 cm SL; max. weight: 1,050 g.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Whitehead, P. J. P., 1985; Blaxter, J. H. S., 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Slender fish with a round belly. Scutes without prominent keel; 12 to 16 post-pelvic scutes (Ref. 188). No median notch in upper jaw; operculum without radiating bony striae; the posterior border of its gill opening is evenly rounded. It is blue to greenish-blue dorsally, becoming silvery ventrally. No distinctive dark spots on the body or fins (Ref. 188).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 364 m (Ref. 58426), usually 0 - 200 m (Ref. 6683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This benthopelagic, oceanodromous species, forms large schools in coastal waters. It feeds predominantly upon copepods, migrating up the water column at night to feed in shallower surface waters. The species is divided into several subspecies, with separate spawning times; these include the winter spawning Norwegian and Icelandic herrings, the autumn spawning Icelandic and North sea herrings and the Baltic herrings. Individuals mature at ages ranging from three to nine years. The Atlantic Herring ranges in depth from the surface to 200 m.

Three very large year classes were produced in 1994, 1998 and 2002 (TRAC 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic herring Clupea harengus are found in the palagic zone of marine waters, as well as coastal zones of throughout their geographic reach.

(Note: the maximum depth value given is based on a value of 50 fathoms (Bigelow and Schroeder, 1953)).

Range depth: 36.576 to 0 m.

Habitat Regions: saltwater or marine

Aquatic Biomes: pelagic ; coastal

Other Habitat Features: intertidal or littoral

  • Jones, S. 1795. A natural history of fishes, and of reptiles, insects, waters, earths, fossils, ... compiled from the best authorities, and illustrated by a great variety of copper plates, .... London: E. Newberry.
  • Leeuwenhoek, A. 1798. The select works of Antony Van Leeuwenhoek, containing his microscopical discoveries in many of the works of nature. Translated from the Dutch and Latin editions published by the author, by Samuel Hoole. .... London: Henry Fry.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found to depths of 200 m, prefer shallow inshore waters.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 506546 specimens in 3 taxa.
Water temperature and chemistry ranges based on 288146 samples.

Environmental ranges
  Depth range (m): -9 - 492
  Temperature range (°C): -1.960 - 24.323
  Nitrate (umol/L): 0.663 - 26.963
  Salinity (PPS): 5.681 - 36.264
  Oxygen (ml/l): 0.901 - 8.768
  Phosphate (umol/l): 0.114 - 2.516
  Silicate (umol/l): 0.987 - 55.359

Graphical representation

Depth range (m): -9 - 492

Temperature range (°C): -1.960 - 24.323

Nitrate (umol/L): 0.663 - 26.963

Salinity (PPS): 5.681 - 36.264

Oxygen (ml/l): 0.901 - 8.768

Phosphate (umol/l): 0.114 - 2.516

Silicate (umol/l): 0.987 - 55.359
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Clupea harengus is pelagic in its distribution and occurs in the surface waters down to a depth of around 200 m. Outside of the spawning season, Clupea harengus stays away from the immediate coastal areas. It is often found in vast near-surface shoals covering an area of several square kilometers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: pelagic. Schooling in coastal waters, with complex feeding and spawning migrations whose timing and extent correlate with the more or less distinct races recognizable on morphological grounds. Recorded in temperatures of 1°-18°C. Feeds on small planktonic copepods in the first year, thereafter mainly on copepods. At least one population spawns in any one month of the year. Eggs are laid on substrate. In Guinness Book of World Records, as the most numerous fish (Ref. 6472). Utilized fresh, dried/salted, smoked, canned and frozen; can be fried, broiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; brackish; marine. Depth range: 0-200 m. Schooling in coastal waters, with complex feeding and spawning migrations whose timing and extent correlate with the more or less distinct races recognizable on morphological grounds.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Whitehead, P. J. P., 1985; Blaxter, J. H. S., 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is 'pelagic' in its distribution throughout the ocean, in the surface waters down to a depth of about 200 metres. These fish stay away from the immediate coastal areas outside the spawning season. Herring avoid the deeper parts of the ocean, and are often found in vast surface shoals, covering several square kilometres of water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Visual size-selective plankton feeder (Ref. 89567) Has the ability to switch between particulate- and filter-feeding (Ref. 4809). Adult feed on planktonic crustaceans, mollusc larvae, arrow worms, ctenophores, small fish (incl. eggs and larvae) (Ref. 188). Preyed upon by fish, birds, and marine mammals (Ref. 89563). Parasites found are protozoans, myxosporidians, trematodes, cestodes, nematodes and copepods (Refs. 5951, 37032). Herring biomass has shown inverse correlation with the biomass of sprat, a competitor for planktonic food (Refs. 82765; 82766).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In the late 1700s, Leeuwenhoek hypothesized that Clupea harengus was a plankton feeder, stating that "Seeing these things, I did not wonder that fishermen should imagine Herrings have no food in their stomachs, because Herrings do, in my opinion, feed on such small fishes ["animacules"], that they cannot take in sufficient quantities of them to distend their stomachs, as we see in other fish; and hence it is said, that Herrings have no food in within their stomachs." (Leeuwenhoek, 1798)

With the advent of better microscopes and observational techniques, it was found that plankton (the "animaclues" of Leeuwenhoek's time) that Clupea harengus feeds upon, starting with larval snails, diatoms, peridinians when first hatched, moving on to copepods, amphipods, pelagic shrimps, and decapod crustacean larvae when they reach adulthood (Bigelow and Schroeder, 1953).

Animal Foods: fish; eggs; mollusks; aquatic or marine worms; aquatic crustaceans; other marine invertebrates; zooplankton

Plant Foods: phytoplankton

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on small planktonic copepods in the first year, thereafter mainly on copepods. A facultative zooplanktivorous filter-feeder, i.e., it can switch to filter-feeding if the food density and particle size are appropriate. Spend the day in deeper water, but rise to the surface at night. Find their food visually. Feeding and growth are decreased during winter. They can be divided into several different stocks and races.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Whitehead, P. J. P., 1985; Blaxter, J. H. S., 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
cercaria of Cryptocotyle lingua endoparasitises Clupea harengus

Animal / pathogen
Icthyophonus hoferi infects muscle of Clupea harengus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Herring are a critical part of the Atlantic ecosystem, being a prey species for a large variety of species. They are pelagic plankton feeders (Gulf of Maine Aquarium, 2004b).

Atlantic herring are also the host of several parasitic species. In a study of 220 Norwegian spring spawning herring, Tolonen and Karlsbakk (2002) detected 11 parasitic species: the coccodians Goussia clupearum and Eimeria sardinae, spores of the myxozoan Ceratomyxa auerbachi, adult trematodes Hemiurus spp., adult and larval nematodes Hysterothylacium aduncum and Anisakis simplex, and Cryptocotyle lingua metacercarial infections.

  • Tolonen, A., E. Karlsbakk. 2003. The parasite fauna of the Norwegian spring spawning herring (Clupea harengus L.). ICES Journal of Marine Science, 60: 77-84.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

As Atlantic herring are the prey species of many species of fish, mammals, and birds, herring are almost always found in schools (Bigelow and Schoreder, 1953). Some schools display elaborate patterns (Gulf of Maine Aquarium, 2004b). These schools may be quite large, stretching several miles in length and visibly darkening the waters (Jones, 1795).

Clupea harengus is a prey species of cod, pollock, haddock, silver hake, striped bass, mackerel, tuna, salmon, dogfish (Bigelow and Schroeder, 1953), harbor porpoises Phocoena phocoena, harbor seals Phoca vitulina, gray seals Halichoerus grypus, Atlantic puffins Fratercula arctica, razorbills Alca torda, common terns Sterna hirundo, arctic terns Sterna arctica, killer whales, baleen whales (Gulf of Maine Aquarium, 2004b), and humans Homo sapiens.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Clupea harengus (Clupea harengus herring) preys on:
phytoplankton
Calanus
Pteropods
Copepoda
Ctenophora
other worms
Chaetognatha
Anthozoa
Crangon
Mysidae
Pandalidae
Decapoda
Gammaridae
Hyperiidae
Caprellidae
Polychaeta
Ammodytes marinus

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Internal Fungal Infection (Ichthyophonus sp.). Fungal diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anisakis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Although little is known of the behavioral reasons behind their noise productions, Clupea harengus are known to produce and perceive sounds. Noise is usually produced at night by is probably the result of forceful ejection of air from the anal duct. The frequency of noise production did not change due to feeding. This noise production tends to increase with increasing numbers of herring in a school, leading to speculation that there is a social component to noise production (Wilson, Batty, and Dill, 2003).

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The herring matures between 2-9 years (Refs. 35388, 82767, 89571). Herring populations are known to use traditional spawning grounds, many of which are along shallow coastal areas (15-40 m depth) or on offshore banks down to 200 m (Refs. 6684, 89572). Spawning usually occurs on gravel or rock bottoms, with the exception of Baltic populations which show a preference for shallow (less than 10 m depth) seaweed beds (Refs. 89520, 89572). Each population spawns only once a year over a relatively short time period (Ref. 89573). At least one population is spawning in any one month of the year, each having a different spawning time and place. The herring is a demersal spawner that releases a ribbon of sticky eggs that sink to the sea bed (Ref. 89574) and adhere to the substrate. The eggs released by a spawning population may be several layers thick which may deprive eggs in the bottom layers of oxygen, causing egg mortality (Ref. 89563). Although higher fecundities were reported earlier (e.g. Ref. 74523), fecundity now ranges from 10,000-60,000 eggs (Ref. 89571). Hatching may take up to 3 weeks, depending on temperature (Ref. 89571). Larvae are pelagic and drift with the current. Note: it is impossible to summarize briefly the wide range of spawning strategies of Atlantic herring; the best reviews are those of Svetovidov (Refs. 4608, 4609) for the Eastern Atlantic Ocean and Hildebrand (Ref. 4607) for the Western Atlantic Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Clupea harengus eggs are laid on rocky to sandy substrate, rarely on mud, from 3.7 m to 54.9 m on the North American side of the Atlantic. In Scandinavia, depths of 182.9 m have been recorded. Fertilization may take place in spring, summer, or autumn, according to locality and subtype of Atlantic herring (Bigelow and Schroeder, 1953).

Incubation lasts anywhere from 10 to 40 days, depending on local water temperatures. Colder temperatures (roughly 3.3 deg C) indicate a longer incubtion time. Incubation can take place in water temperatures of up to 15 deg C. Temperature ranges above and below these limits produced no viable hatchings (Bigelow and Schroeder, 1953).

At the time of hatching, Clupea harengus are about 6 mm long. Their small yolk sack is usually completely absorbed by the time they reach 10 mm in length. At 15 to 17 mm, the dorsal fin forms. The anal fin forms when Atlantic herring reach about 30 mm. Ventral fins become visible at 30 to 35 mm. The tail becomes well-forked at around this length as well. Only when Atlantic herring reach 40 mm do they start to fully resemble mature herring (Bigelow and Schroeder, 1953).

At roughly 2 years of age, Clupea harenga are about 19 to 20.5 cm in length, and start to accumulate large amounts of fat in the body tissue and viscera during warm months. This fat is lost in the winter and at the approach of sexual maturity (Bigelow and Schroeder, 1953).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Clupea harengus may live up to 20 years.

Range lifespan

Status: wild:
20 (high) years.

Average lifespan

Status: wild:
22.0 years.

Average lifespan

Status: wild:
19.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Atlantic herring aggregate into massive schools in the late summer and early fall. In the western Atlantic, they move into coastal waters at various locations in the Gulf of Maine and offshore banks of Nova Scotia to spawn. Spawning times vary for different populations of Atlantic herring.

Mating System: polygynandrous (promiscuous)

Clupea harengus uses external fertilization of eggs. As female herring release eggs, male herring release clouds of milt simultaneously. Herring are fat prior to spawning, after months of eating plankton blooms.

Mature eggs make up a large portion (20%+) of the female's body weight. The fecundity of herring females is typically in the range of 20,000-50,000 eggs per female, although a large female herring can lay as many as 200,000 eggs. Herring are iteroparous and generally live to spawn repeatedly for several years. After spawning, their weight declines with the loss of gametes and associated fat content.

Breeding interval: Atlantic herring usually spawn after reaching 25.5cm.

Breeding season: Atlantic herring may spawn in spring, summer, or autmn, depending on local conditions and the subspecies of herring.

Range number of offspring: 200000 (high) .

Average number of offspring: 20000-50000.

Range time to hatching: 10 to 40 days.

Average time to hatching: 11 days.

Range age at sexual or reproductive maturity (female): 3 to 6 years.

Average age at sexual or reproductive maturity (female): 4 years.

Range age at sexual or reproductive maturity (male): 3 to 6 years.

Average age at sexual or reproductive maturity (male): 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

There is no evidence that Atlantic herring invest any energies toward parenting after they spawn.

Parental Investment: pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

At least one population is spawning in any one month of the year, each race having a different spawning time and place. Eggs adhesive on sea bed or on marine vegetation.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Whitehead, P. J. P., 1985; Blaxter, J. H. S., 1990.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clupea harengus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCAACTAATCACAAAGATATTGGTACCCTTTACCTAGTATTTGGTGCCTGAGCAGGAATGGTGGGCACAGCCCTAAGTCTCCTAATCCGTGCAGAACTTAGCCAACCTGGGGCTCTCCTTGGAGAC---GACCAGATCTATAATGTTATTGTTACTGCACATGCCTTCGTAATAATTTTCTTTATAGTAATGCCGATTCTAATTGGAGGGTTTGGAAACTGACTAATTCCTCTTATGATCGGAGCGCCAGATATGGCATTCCCTCGAATAAACAATATGAGCTTCTGACTACTTCCCCCCTCATTCCTCCTACTACTAGCCTCCTCCGGAGTTGAAGCCGGGGCGGGGACCGGGTGAACGGTATATCCTCCTCTGTCAGGAAATCTGGCCCATGCAGGAGCATCAGTTGACCTAACCATTTTTTCACTTCATCTAGCAGGTATTTCCTCTATTCTAGGGGCCATTAATTTCATTACCACAATTATTAATATGAAACCACCCGCAATCTCACAATACCAAACGCCTCTGTTTGTCTGATCCGTTCTTGTTACAGCTGTTCTACTTCTTCTATCGCTGCCTGTGCTAGCTGCCGGAATTACAATGCTTCTTACAGATCGAAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGGGGAGACCCAATTCTTTACCAACACCTATTCTGATTTTTCGGACACCCGGAAGTATATATTCTAATTCTTCCCGGGTTCGGAATGATTTCCCACATCGTAGCCTACTACGCGGGAAAGAAAGAACCCTTCGGATACATAGGAATGGTCTGAGCTATGATGGCCATCGGACTACTAGGGTTTATTGTATGAGCCCACCACATGTTCACCGTAGGAATGGATGTTGACACTCGAGCATACTTTACATCAGCAACCATAATTATTGCCATCCCAACCGGGGTTAAGGTATTTAGCTGACTTGCCACTCTCCACGGGGGC---TCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clupea harengus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clupea harengus harengus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Herdson, D. & Priede, I.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. and Livingston, F.

Justification
Clupea harengus has been assessed as Least Concern. This is one of the most commercially important species within the northern Atlantic Ocean. Since a severe population crash in the stock in the 1970s, limits were imposed on the harvest levels of this species in an attempt to rebuild the stock. Since then the biomass has shown in an increase. Current estimates suggest that only 10% of the stock is being exploited and there are no reports of over-fishing occuring. Continued monitoring Continued monitoring of the harvest levels and stock biomass is needed to ensure limits can be revised should there be changes to the levels of recruitment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clupea harengus is not an endangered species. However, with heavy fishing in the 1960s and a lack of recruitment in the 1970s, Atlantic herring fisheries crashed. Although the fishery recovered since then, its vulnerability, especially with increased potential of climate variability has lead the several countries to conduct studies looking at sustainable herring harvests (Alheit and Hagen, 1997).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not subject to specific protection, but listed by the International Council for the Exploration of the Seas (ICES) as below Safe Biological Limits (SBL).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A US stock assessment (age classes 2+) of Georges Bank, Nantucket Shoals and the Gulf of Maine, estimated there to be 1.4 million metric tonnes in 2001 (Overholtz et al. 2004). Biomass is now thought to have declined to 1 million metric tonnes in 2005.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
In the mid 20th century, the Atlantic Herring was considered to be one of the most commercially valuable food fish species.

Stocks of this species showed a strong reduction in the 1970s from global landings of 4,095,394 t in 1966, to 887,533 t in 1979. This decline was attributed to overfishing. Approximately 10-20% of these landings are taken from Area 21 (Northwest Atlantic) while the rest is taken in Area 27 (Northeast Atlantic). The largest reported catches are from Norway and Iceland. In the last 10 years global catches have shown an increase: 1998 - 2,421,462 t, 1999 - 2,411,408 t, 2000 - 2,381,011 t, 2001 - 1,952,605 t, 2002 - 1,873,503 t, 2003 - 1,958,929 t, 2004 - 2,020,111 t, 2005 - 2,316,050 t, 2006 - 2,244,595 t. While stocks hit critically low levels in the 1970s and showed signs of commercial extinction, they have since recovered (Melvin and Stephenson 2007).

The Northwest Atlantic stock is treated as two separate stocks: Gulf of Maine stock and Georges Bank-Nantucket Shoals stock. The Georges Bank stock crashed in the 1970s due to overexploitation by foreign fishers, while the Gulf of Maine stock continued to support coastal fisheries. The Georges Bank stock is now said to have fully recovered due to recolonisation from Gulf of Maine and Nantucket Shoals. The Bay of Fundy stock declined from approximately 570,000 mt in 1997 to 460,000 mt in 2000 - 2001, however in 2002/ 2003 it showed an increase (Melvin et al. 2004; NOAA 2005). Despite this increase there are concerns about the stock due to fewer adults in the population.

Current rates of fishing mortality in the U.S. fisheries are calculated to be approximately 10% indicating that stocks are under-utilised, however there is concern that the inshore Gulf of Maine stock is being over-exploited (NOAA 2005).

An average fishing mortality (F) of 0.7 was calculated for the 1970s, this declined to 0.3 in the 1980s, 0.15 in 1991 and has since remained stable at 0.1 since 2002 (TRAC 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The biggest threat to this species is over-harvesting by the fishing fleets of many nations. Although the herring is still a relatively numerous species, it is now feared that there more are being caught by trawlers than can reproduce annually, particularly in European waters. Domestic pressure on governments to support their fishing industries has led to overfishing, and agreed quotas being exceeded, depleting populations of herring across much of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In response to over-exploitation of stocks in the 1970s, Total Allowable Commercial Catch (TACC) limits were imposed. The current allowable biological catch for 2007-2009 has been set at 194,000 mt (NOAA 2007).

The Biological Maximum Sustainable Yield (BMSY) for this species has been calculated at 629,000 mt, so even with the current estimates of the stock biomass, it is still above this limit. The stock is not reported to be in an overfished condition, and no over-fishing is thought to be occurring (Overholtz 2006).

Continued monitoring of the harvest levels and stock biomass is needed to ensure limits can be revised should there be changes to the levels of recruitment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Atlantic herring is listed in the UK Biodiversity Grouped Action Plan for commercial marine fish. Being a species that is found in international waters, it has proved very difficult to impose restrictions on the number of fish that can be harvested from the sea without reducing fish stocks below the important Safe Biological Figure (SBF) limits. During the 1960s, the herring population in parts of the north Atlantic collapsed catastrophically, virtually wiping out the Icelandic herring industry, and posting a warning sign about the fragility of the marine environment. The chief cause was overfishing and, following the creation of a management plan in 1975, the Icelandic herring industry became the first to be subject to a total allowable catch (TAC) restriction. Since then, in this part of the Atlantic, herring fish stocks have recovered to sustainable levels, and the experience should serve as a lesson as to what could happen to other commercially important species. Whilst Atlantic populations of herring are currently considered to be above the SBF, those in the North Sea are giving cause for concern. Figures suggest that reproduction of many commercial fish species fell to an all-time low in the 1990s. Although populations now seem to be recovering, the herring is still covered in the part of the UK Grouped Action Plan specifically relating to North Sea fish stocks. However, it remains to be seen whether implementing the rules and recommendations in the current Common Fisheries Policy (CFP) will allow population levels to stabilise and recover. One effect of the CFP has been to remove the inefficient fishing boats from the fleets, allowing heavy overfishing by the 'factory' trawlers. This, coupled with the pressure on individual governments to support their country's own fishing fleets, has led to the harvesting of 'black fish', illegal catches above and beyond a country's legal quota, and this is still taking its toll on herring populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Before large-scale fishing operations started in North America, the vastness of the shoals of Atlantic herring "became absolutely a nuisance" in the Chesapeake Bay area (Buffon, 1793). Clupea harengus can be very susceptible to pollution and being beached during large storms. Bigelow and Schoreder (1953) describe a "slaughter of herring" that started in October 5, 1920 and resulted in a tidal harbor becoming completely covered with dead herring. The large anoxic zone resulting from the decomposition of the massive number of dead herring caused even more fish kills.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Herring fisheries in both Europe and North America have been important sources of protein in diets going back centuries. Jones (1795) indicates that the Dutch fishery dates back to 1167, and Alheit and Hagen (1997) indicate the presence of a Swedish fishery dating back to the 10th Century. In North America, the Native Americans were the first ones to use a system of weirs to catch herrings, as they were difficult to catch using the traditional methods of hook or spear (Gulf of Maine Aquarium, 2004).

The love of Atlantic herring as a foodstuff in Britain was well captured by Jones (1795): "Yarmouth has long been famous for its herring [fare], which was regulated by an act in the 31st [year] of Edward the Third: and that town is obliged, by its charter, to send to the sheriffs of Norwich 100 herrings, to be made into twenty-four pies, by them to be delivered to the lord of the manor of East Carleton, who is to convey them to the king."

The Atlantic fishery continues to be a popular, if not a highly economic, one. In 2001, the New England herring fishery had an estimated total value of $15,615,237 in U. S. dollars (Parker, 2003). Similar fisheries are found throughout the range of Clupea harengus.

The nutritional information for raw Atlantic herring is: 158 Calories/100g, 17.96g protien/100g, 0.0g carbohydrate/100g, 2.04g saturated fatty acid/100g, 3.736g monosaturated fatty acid/100g, 2.133g polyunsaturated fatty acid/100g

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic herring

Clupea harengus in a barrel

Atlantic herring (Clupea harengus) is a herring in the family Clupeidae. It is one of the most abundant fish species in the world. Atlantic herrings can be found on both sides of the Atlantic Ocean, congregating in large schools. They can grow up to 45 centimetres (18 in) in length and weigh more than 0.5 kilograms (1.1 lb). They feed on copepods, krill and small fish, while their natural predators are seals, whales, cod and other larger fish.

The Atlantic herring fishery has long been an important part of the economy of New England and the Canadian Maritime provinces. This is because the fish congregate relatively near to the coast in massive schools, notably in the cold waters of the semi-enclosed Gulf of Maine and Gulf of St. Lawrence. North Atlantic herring schools have been measured up to 4 cubic kilometres (0.96 cu mi) in size, containing an estimated 4 billion fish.

Contents

Description [edit]

Atlantic herring have a fusiform body. Gill rakers in their mouths filter incoming water, trapping any zooplankton and phytoplankton.

Atlantic herring are in general fragile. They have large and delicate gill surfaces, and contact with foreign matter can strip away their large scales.

They have retreated from many estuaries worldwide due to excess water pollution although in some estuaries that have been cleaned up, herring have returned. The presence of their larvae indicates cleaner and more–oxygenated waters.

Range and habitat [edit]

Atlantic herring can be found on both sides of the ocean. They range across North Atlantic waters such as the Gulf of Maine, the Gulf of St Lawrence, the Bay of Fundy, the Labrador Sea, the Davis Straits, the Beaufort Sea, the Denmark Straits, the Norwegian Sea, the North Sea, the English Channel, the Celtic Sea, the Irish Sea, the Bay of Biscay and Sea of the Hebrides.[1] Although Atlantic herring are found in the northern waters surrounding the Arctic, they are not considered to be an Arctic species.


Baltic herring [edit]

The small-sized herring in the inner parts of the Baltic Sea, which is also less fatty than the true Atlantic herring, is considered a distinct subspecies (Clupea harengus membras) ("Baltic herring"), despite the lack of a distinctive genome. The Baltic herring has a specific name in many local languages (Swedish strömming, Finnish silakka, Estonian räim, silk, Livonian siļk, Russian салака, Polish sałaka, Latvian reņģes, Lithuanian strimelė) and is popularly considered distinct from herring.

Ecology [edit]

Herring-like fish are the most important fish group on the planet. They are also the most populous fish.[2] They are the dominant converter of zooplankton into fish, consuming copepods, arrow worms chaetognatha, pelagic amphipods hyperiidae, mysids and krill in the pelagic zone. Conversely, they are a central prey item or forage fish for higher trophic levels. The reasons for this success is still enigmatic; one speculation attributes their dominance to the huge, extremely fast cruising schools they inhabit.

Orca, cod, dolphins, porpoises, sharks, Rockfish, seabird, Whale, squid, Sea Lion, Seal, tuna, Salmon, and fishermen are among the predators of these fishes.

Herring are pelagic–prey includes copepods, amphipods, larvalsnails, diatoms by larvae below 20 millimetres (0.79 in), peridinians, molluscan larvae, fish eggs, euphausids, mysids, small fishes, menhadenlarvae, pteropods, annelids, tintinnids by larvae below 45 millimetres (1.8 in), Haplosphaera, Calanus, Pseudocalanus, Acartia, Hyperia, Centropagidae, Temora, Meganyctiphanes norvegica.

Schooling [edit]

School of juvenile herring ram feeding close to the surface

Atlantic herring can school in huge numbers. Radakov estimated herring schools in the North Atlantic can occupy up to 4.8 cubic kilometres with fish densities between 0.5 and 1.0 fish/cubic metre. That's several billion fish in one school.[3]

Herring are amongst the most spectacular schoolers ("obligate schoolers" under older terminology). They aggregate in groups that consist of thousands to hundreds of thousands or even millions of individuals. The schools traverse the open oceans.

Schools have a very precise spatial arrangement that allows the school to maintain a relatively constant cruising speed. Schools from an individual stock generally travel in a triangular pattern between their spawning grounds, e.g. Southern Norway, their feeding grounds (Iceland) and their nursery grounds (Northern Norway). Such wide triangular journeys are probably important because feeding herrings cannot distinguish their own offspring. They have excellent hearing, and a school can react very quickly to evade predators. Herring schools keep a certain distance from a moving scuba diver or a cruising predator like a killer whale, forming a vacuole which looks like a doughnut from a spotter plane.[4] The phenomenon of schooling is far from understood, especially the implications on swimming and feeding-energetics. Many hypotheses have been put forward to explain the function of schooling, such as predator confusion, reduced risk of being found, better orientation, and synchronized hunting. However, schooling has disadvantages such as: oxygen- and food-depletion and excretion buildup in the breathing media. The school-array probably gives advantages in energy saving although this is a highly controversial and much debated field.

Schools of herring can on calm days sometimes be detected at the surface from more than a mile away by the little waves they form, or from a few meters at night when they trigger bioluminescence in surrounding plankton ("firing"). All underwater recordings show herring constantly cruising reaching speeds up to 108 centimetres (43 in) per second, and much higher escape speeds.

Fisheries [edit]

Global capture of Atlantic herring in tonnes reported by the FAO, 1950–2010[5]

The Atlantic herring fishery is managed by multiple organizations that work together on the rules and regulations applying to herring. As of 2010 the species was not threatened by overfishing.[6]

Aquariums [edit]

Because of their feeding habits, cruising desire, collective behavior and fragility they survive in very few aquaria worldwide despite their abundance in the ocean. Even the best facilities leave them slim and slow compared to healthy wild schools.

Notes [edit]

  1. ^ C.Michael Hogan, (2011) Sea of the Hebrides. Eds. P.Saundry & C.J.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC.
  2. ^ Guinness Book of Records
  3. ^ Radakov DV (1973) Schooling in the ecology of fish. Israel Program for Scientific Translation, translated by Mill H. Halsted Press, New York. ISBN 978-0-7065-1351-6
  4. ^ Nøttestad, L.; Axelsen, B. E. (1999). "Herring schooling manoeuvres in response to killer whale attacks". Canadian Journal of Zoology 77: 1540–1546. 
  5. ^ Clupea harengus (Linnaeus, 1758) FAO, Species Fact Sheet. Retrieved April 2012.
  6. ^ "Atlantic States Marine Fisheries Commission: Atlantic Herring". Retrieved 2009-07-02. 

Other references [edit]

Further reading [edit]

  • Bigelow, H.B., M.G. Bradbury, J.R. Dymond, J.R. Greeley, S.F. Hildebrand, G.W. Mead, R.R. Miller, L.R. Rivas, W.L. Schroeder, R.D. Suttkus and V.D. Vladykov (1963) Fishes of the western North Atlantic. Part three New Haven, Sears Found. Mar. Res., Yale Univ.
  • Eschmeyer, William N., ed. 1998 Catalog of Fishes Special Publication of the Center for Biodiversity Research and Information, no. 1, vol 1-3. California Academy of Sciences. San Francisco, California, USA. 2905. ISBN 0-940228-47-5.
  • Fish, M.P. and W.H. Mowbray (1970) Sounds of Western North Atlantic fishes. A reference file of biological underwater sounds The Johns Hopkins Press, Baltimore.
  • Flower, S.S. (1935) Further notes on the duration of life in animals. I. Fishes: as determined by otolith and scale-readings and direct observations on living individuals Proc. Zool. Soc. London 2:265-304.
  • Food and Agriculture Organization (1992). FAO yearbook 1990. Fishery statistics. Catches and landings FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p.
  • Joensen, J.S. and Å. Vedel Tåning (1970) Marine and freshwater fishes. Zoology of the Faroes LXII - LXIII, 241 p. Reprinted from,
  • Jonsson, G. (1992). Islenskir fiskar. Fiolvi, Reykjavik, 568 pp.
  • Kinzer, J. (1983) Aquarium Kiel: Beschreibungen zur Biologie der ausgestellten Tierarten. Institut für Meereskunde an der Universität Kiel. pag. var.
  • Koli, L. (1990) Suomen kalat. [Fishes of Finland] Werner Söderström Osakeyhtiö. Helsinki. 357 p. (in Finnish).
  • Laffaille, P., E. Feunteun and J.C. Lefeuvre (2000) Composition of fish communities in a European macrotidal salt marsh (the Mont Saint-Michel Bay, France) Estuar. Coast. Shelf Sci. 51(4):429-438.
  • Landbrugs -og Fiskeriministeriet. (1995). Fiskeriårbogen 1996 Årbog for den danske fiskerflåde Fiskeriårbogens Forlag ved Iver C. Weilbach & Co A/S, Toldbodgade 35, Postbox 1560, DK-1253 København K, Denmark. p 333-338, 388, 389 (in Danish).
  • Linnaeus, C. (1758) Systema Naturae per Regna Tria Naturae secundum Classes, Ordinus, Genera, Species cum Characteribus, Differentiis Synonymis, Locis 10th ed., Vol. 1. Holmiae Salvii. 824 p.
  • Munroe, Thomas, A. / Collette, Bruce B., and Grace Klein-MacPhee, eds. 2002 Herrings: Family Clupeidae. Bigelow and Schroeder's Fishes of the Gulf of Maine, Third Edition. Smithsonian Institution Press. Washington, DC, USA. 111-160. ISBN 1-56098-951-3.
  • Murdy, Edward O., Ray S. Birdsong, and John A. Musick 1997 Fishes of Chesapeake Bay Smithsonian Institution Press. Washington, DC, USA. xi + 324. ISBN 1-56098-638-7.
  • Muus, B., F. Salomonsen and C. Vibe (1990) Grønlands fauna (Fisk, Fugle, Pattedyr) Gyldendalske Boghandel, Nordisk Forlag A/S København, 464 p. (in Danish).
  • Muus, B.J. and J.G. Nielsen (1999) Sea fish. Scandinavian Fishing Year Book Hedehusene, Denmark. 340 p.
  • Muus, B.J. and P. Dahlström (1974) Collins guide to the sea fishes of Britain and North-Western Europe Collins, London, UK. 244 p.
  • Reid RN, Cargnelli LM, Griesbach SJ, Packer DB, Johnson DL, Zetlin CA, Morse WW and Berrien PL (1999) Atlantic Herring, Clupea harengus, Life History and Habitat Characteristics NOAA Technical Memorandum NMFS-NE-126, NOAA.
  • Robins, Richard C., Reeve M. Bailey, Carl E. Bond, James R. Brooker, Ernest A. Lachner, et al. 1991 Common and Scientific Names of Fishes from the United States and Canada, Fifth Edition. American Fisheries Society Special Publication, no. 20. American Fisheries Society. Bethesda, Maryland, USA. 183. ISBN 0-913235-70-9.
  • Robins, Richard C., Reeve M. Bailey, Carl E. Bond, James R. Brooker, Ernest A. Lachner, et al. 1991 Common and Scientific Names of Fishes from the United States and Canada, Fifth Edition. American Fisheries Society Special Publication, no. 20. American Fisheries Society. Bethesda, Maryland, USA. 183. ISBN 0-913235-70-9.
  • Whitehead, Peter J. P. 1985. Clupeoid Fishes of the World (Suborder Clupeoidei): An Annotated and Illustrated Catalogue of the Herrings, Sardines, Pilchards, Sprats, Shads, Anchovies and Wolf-herrings: Part 1 - Chirocentridae, Clupeidae and Pristigasteridae FAO Fisheries Synopsis, no. 125, vol. 7, pt. 1. Food and Agriculture Organization of the United Nations. Rome, Italy. x + 303. ISBN 92-5-102340-9.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly regarded as conspecific with the Pacific herring, C. PALLASI. Based on a study of biochemical genetics, Grant (Copeia 1986:714) recognized HARENGUS and PALLASI as distinct species, an action followed in the 1991 AFS checklist (Robins et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!