Overview

Comprehensive Description

Biology

Found on continental and insular shelves, often near drop-offs on the outer edges of reefs. May rest on the bottom (Ref. 9710). Usually found in reefs, at less than 30 m deep (Ref 26938). Feed on bony fishes, including bigeyes (Priacanthidae). Viviparous (Ref. 50449). Size at birth below 73 cm. A dangerous species implicated in an abortive attack on divers in the Caribbean. Meat is prepared dried salted for human consumption, hides for leather, liver for oil, carcasses for fish meal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Caribbean reef sharks range throughout the tropical western Atlantic and Caribbean from North Carolina to Brazil and are the most common reef shark in the Caribbean. They are found near reefs in southern Florida, however surveys using longline gear off the east coast of Florida reveal that C. perezi are extremely rare north of the Florida Keys (Florida Museum of Natural History).

In Belize, recorded throughout the Belize Barrier Reef including the marine reserves of Half Moon Caye and Blue Hole (Lighthouse Reef Atoll) (Graham et al. in prep), Gladden Spit (Graham and Burgess 2004) and Glover?s Reef Atoll (Pikitch et al. submitted). Neonate, juvenile and adult reef sharks are found at several sites throughout the Barrier Reef (Glover?s Reef Atoll, Lighthouse Reef Atoll, Gladden Spit).

In Cuba, recorded in the Jardines de la Reina Archipelago and marine reserve (Graham and Pina 2004). Neonate, juvenile and adult reef sharks are commonly encountered in the Jardines de la Reina Archipelago. All sites studied in Belize and Cuba are partially or entirely encompassed in marine protected areas. However only Jardines de la Reina bans shark fishing within its borders.

In Venezuela it is one of the most frequent and abundant shark species at oceanic islands such as Los Roques (Cervigón and Alcalá 1999). It is also one of the most abundant sharks around the Bahamas and the Antilles.

In Colombia, recorded from Rosario islands, Tayrona park, La Guajira and San Andrés Archipelago (Acero and Santos-Martínez 1992, Caldas 2002, Rey and Acero in press).

In Brazil, recorded from the States of Amapá, Pará, Maranhão, Ceará, Rio Grande do Norte, Bahia, Espírito Santo, Paraná and Santa Catarina, and from the oceanic islands of Atol das Rocas, Fernando de Noronha and Trindade, and from the reef formations of Parcel Manuel Luiz and Abrolhos (Lessa et al. 1999, Sampaio et al. 2000, Garla and Amorim 2000, Rocha and Rosa 2001, Soto 2001). This species is protected at the Atol das Rocas Biological Reserve, at Fernando de Noronha and Abrolhos national marine parks, and at the Parcel Manuel Luiz state marine park.

Glover?s Reef (Belize), Gladden Spit (Belize), Jardines de la Reina (Cuba), Atol das Rocas (Brazil) and Fernando de Noronha (Brazil) archipelagos all appear to encompass breeding, pupping and nursery grounds, based on catches of neonate, juvenile and adult sharks. Parcel Manoel Luiz, Abrolhos and Trindade are possibly other nursery areas in Brazil (Garla et al., in prep).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Florida, USA to southern Brazil, including the northern Gulf of Mexico and the Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Size

Maximum size: 3000 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

300 cm TL (male/unsexed; (Ref. 9710)); 295 cm TL (female); max. published weight: 69.9 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A large, gray shark with an interdorsal ridge and short blunt snout. 1st dorsal fin small with short rear tip (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Carcharhinus perezii
Catalog Number: USNM 37141
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Collector(s): T. Bean
Year Collected: 1885
Locality: Caribean Sea: Off Yucatan, Cozumel, Yucatan, Mexico, Caribbean Sea, Atlantic
Vessel: Albatross
  • Type: Bigelow, H. B. & Schroeder, W. C. 1944. Proceedings of the New England Zoological Club. 23: 30, pls. 9-10.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Caribbean reef shark is the most common shark on or near coral reefs in the Caribbean, often found close to drop-offs on the outer edges of the reefs. It is a tropical inshore, bottom-dwelling species of the continental and insular shelves. While generally reported from depths to at least 30 m (Compagno in prep. b), in San Andrés Archipelago, Colombia it is reported from depths of 45 to 22 5m (Caldas 2002) and through satellite telemetry is now known to dive to 378 m (E. Pikitch and D. Chapman, pers. comm).

Caribbean reef sharks are caught mostly in forereef and deeper lagoonal areas and rarely in the shallow lagoons in Belizes Glover?s Reef (Pikitch et al. submitted), Lighthouse Reef (Graham et al. in prep) and Cuba?s Jardines de la Reina (Graham and Pina in prep). Although intraspecific variation in reef use exists between juveniles and adults at Glover?s Reef (Pikitch et al. submitted), and between males and females at Jardines de la Reina (Graham and Pina in prep), neonate, juvenile and adult habitat overlap at Belize?s Glover?s Reef Atoll (Pikitch et al. submitted), Gladden Spit (Graham and Burgess 2004) and in Cuba?s Jardines de la Reina Archipelago (Graham and Pina in prep) where all three size classes have been caught in forereef sites. Although adults are rarely found in shallow lagoons and juveniles are found in both lagoons and forereef areas, acoustic taqging supports overall species preference for forereef areas at Glover?s Reef (Chapman et al. submitted). In Jardines de la Reina, preliminary results further suggest sexual segregation between adults along two forereef sites located within <10 km of of each other and separated by a broad reef pass (Graham and Pina in prep).

Size at birth is from 60 to 75 cm TL (Castro 1983). Maximum size about 295 cm TL (Compagno 1984). Reproduction is placental viviparous. Difference in the size at maturity exist with 150 to 170 cm TL at Glover?s Reef (Belize) recorded by Pikitch et al. (submitted) and 170 cm TL (males) and ~200 cm TL (females) noted by Compagno (in prep b). Litter size is 3 to 6 pups and gestation period is ~1 year (Compagno in prep. b). Reproductive periodicity is biennial (Castro et al. 1999). Sex ratios from 102 sharks captured at Glover?s Reef Atoll were even from May to July (2000?2004).

Diet appears to include a wide range of reef fishes and some elasmobranchs. Stomach contents analysis in several sites reveals consumption of bony fishes (scarids, carangids and serranids) and elasmobranchs such as Aetobatus narinari and Urobatis jamaicensis (D. Chapman pers. comm.). In Fernando de Noronha archipelago, Brazil, specimens of the teleosts Caranx latus, Sparisoma spp. and Cephalopholis fulva were observed in stomach contents (R. Garla pers. comm). In Manoel Luis reefs, remains of Scaridae and cephalopods were found in stomach contents (Motta et al. 1999).

Movement is more extensive than previously thought on both the horizontal and vertical planes. Using acoustic telemetry, Chapman et al. (submitted) determined that one animal traveled 30 km over deep (>400 m) waters from Glover?s Reef Atoll to neighboring Lighthouse Reef Atoll. Within 30 hours the same individual returned to a site at Glover?s at least 50 km from the Lighthouse receiver site. On the other hand, 14 sharks fitted with acoustic transmitters in Fernando de Noronha archipelago (Brazil) showed little movement and high site fidelity, half of them remaining within areas of 0.7 km² and the other half traveling less than 3.3 km, mainly during the night (Garla et al. submitted for publication).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 65 m (Ref. 9710), usually 1 - 35 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 20 - 300
  Temperature range (°C): 16.273 - 27.777
  Nitrate (umol/L): 0.176 - 9.766
  Salinity (PPS): 35.933 - 36.324
  Oxygen (ml/l): 3.934 - 4.553
  Phosphate (umol/l): 0.063 - 0.708
  Silicate (umol/l): 1.630 - 4.409

Graphical representation

Depth range (m): 20 - 300

Temperature range (°C): 16.273 - 27.777

Nitrate (umol/L): 0.176 - 9.766

Salinity (PPS): 35.933 - 36.324

Oxygen (ml/l): 3.934 - 4.553

Phosphate (umol/l): 0.063 - 0.708

Silicate (umol/l): 1.630 - 4.409
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 65m.
Recorded at 65 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Is capable of lying motionless on the bottom like the nurse and lemon sharks (Ref. 33). Cleaned by Elacatinus randalli at Fernando de Noronha Archipelago, western south Alantic (Ref. 35860).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing with embrace (Ref. 205). Viviparous, placental (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carcharhinus perezii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGCCTCCTAATTCGAGCTGAGCTTGGGCAACCTGGATCACTTTTAGGAGATGATCAGATTTACAATGTAATCGTAACCGCCCACGCTTTCGTAATAATCTTTTTCATGGTAATACCAATTATAATTGGTGGTTTCGGAAATTGATTAGTTCCTTTAATAATTGGAGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTTCTTCTTCTTCTCGCCTCTGCTGGAGTAGAAGCTGGAGCAGGCACCGGCTGAACAGTTTATCCTCCATTAGCTAGCAACCTAGCACATGCTGGACCATCTGTTGATTTAGCTATCTTTTCTCTTCACTTAGCCGGTGTTTCATCAATTTTAGCTTCAATTAATTTTATCACAACTATTATTAACATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCTATTCTTGTAACCACTATTCTTCTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGGATTACAATATTACTTACAGATCGTAACCTCAATACTACATTCTTCGACCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carcharhinus perezii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Rosa, R.S., Mancini, P., Caldas, J.P. & Graham, R.T.

Reviewer/s
Cavanagh, R.D., Kyne, P.M., Stevens, J., Dudley, S. & Pollard, D. (Shark Red List Authority) & Pogonoski, J.

Contributor/s

Justification
Carcharhinus perezi is a large (to 295 cm TL), reef-dwelling shark found in the Western Atlantic from North Carolina (USA), throughout the Caribbean (where it is the most common reef shark) south to Brazil. Despite its widespread distribution and apparent abundance in some areas, this is a large, inshore shark with low productivity (biennial reproductive cycle with gestation ~1 year and litters of 3 to 6) taken as bycatch in artisanal and commercial fisheries throughout its range, together with demand for trade in its meat and fins. Little data are available, but in some parts of its range intense inshore fisheries exist and there is strong evidence indicating declines, e.g. off Belize and Cuba, together with the continued exploitation of this species in some marine reserves due to lack of enforcement. However, this species is protected in some areas, (e.g., Florida and Bahamas where it is a major attraction to the ecotourism diving industry). Although further information on interactions with fisheries is required before its status can be more accurately determined, at the present time this species is assessed as Near Threatened and may well be shown to meet the criteria for Vulnerable in the future, based on overall population declines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population studies are underway using tag and recapture methods at three sites in Belize: Glover?s Reef Atoll (Pikitch et al. 2001, Pikitch et al. submitted), Lighthouse Reef (Graham et al. in prep.) and Gladden Spit (Graham and Burgess 2004) as well as the Jardines de la Reina Marine Reserve in Cuba (Graham and Pina, in prep.) and Fernando de Noronha in Brazil (Garla et al., in prep). No population size estimates are currently available.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
While specific information is unavailable, it is most certainly taken as bycatch in artisanal and commercial longline and gillnet fisheries (Castro et al. 1999). In some regions (i.e., parts of Brazil and the Caribbean) fishing pressure in its area of occurrence is potentially significant. For example, in parts of its range off Brazil it is known to be captured in longline and gillnet fisheries (Sadowsky and Amorim 1977, Gadig et al. 1989, Amorim et al. 1998), although there is no information available on its population status. The species is protected in a number of marine protected areas in Brazil, but enforcement to prevent illegal fishing is required.

In Belize, reef sharks are caught on hook and line primarily as bycatch in the artisanal snapper or grouper fisheries. Pressure is maintained on these populations through local, national and international trade: Asian buyers purchase dried fins for up to USD 37.5/lb and meat is sold in Belize and adjoining Mexico and Guatemala for USD 1.25?1.75/lb to make ?panades? (tortilla-like confection). A dedicated shark fishery operated from several points throughout Belize (San Pedro, Sarteneja, Punta Gorda, Placencia, Dangriga) existed from the mid-1900s to the early 1990s. Dramatic declines in catches of all shark species including reef sharks led many dedicated shark fishers to switch effort to other species, change occupation or retire (Graham, unpublished data).

In Cuba, shark landings peaked in 1981 at 3,076t and have declined since. Although landings of Caribbean reef sharks are not disaggregated from all shark landings, catches of coastal shark species including reef-associated sharks predominated between 1986?1990 (1,187t or 54.2% of landings). Despite a decrease in the total landings for all species between 1981?2003, coastal shark species accounted for 82% of all captures between 1994?2003.

In Colombia, it is frequently captured in the bottom longline fishery of San Andrés Archipelago where it is the most common shark species, representing 39% of the catch by occurrence. Sizes of ~90?180 cm TL are taken in this fishery (Caldas 2002).

Additionally, coral reef ecosystems in the Caribbean are suffering damage from bleaching, disease and physical impacts (see for example, Garzón-Ferreira and Rodriguez-Ramírez 2001), which may affect Carcharhinus perezi through habitat degradation and loss.

Utilization
Utilized for human consumption, leather (skin), oil (livers) and fishmeal (from carcasses) (Compagno in prep. b). In the San Andrés Archipelago bottom longline fishery in Colombia the fins, jaws (for ornamental purposes) and liver (for oil) are utilized, while the meat is only occasionally used as it is not easily marketed. A gallon of liver oil is sold for USD 40?50, jaws for USD 50?60 (specimen >150 cm TL) and a pound of fins for US$45?55 (Caldas 2002). In Belize dried fins are sold to Asian buyers for USD 37.50/lb and meat if sold to Belizeans, Mexicans, Guatemalans and Hondurans for ~USD 1.25-1.75/lb (Graham, unpublished data).

This species forms the basis of several shark feeding tour operations throughout the Caribbean including Belize, Bahamas and Cuba. Although known to be lucrative ? prompting the activity and strong opposition to feeding bans - the Caribbean reef shark feeding industry has not yet been quantitatively valued.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Although this species is protected in a number of marine protected areas (MPAs) in Brazil (see Range and Population section) increased law enforcement against illegal fishing in protected areas is required. Establishment of additional protected areas (no fishing zones) on the outer banks off northern coast of Brazil is also recommended, as are MPAs in other parts of its range to protect this and other species. Shark fishing is illegal in Cuba?s Jardines de la Reina Marine Reserve and local guides have noted an increase in sightings of many species of reef-associated sharks including C. perezi since 1997 when the reserve was declared and enforcement of fishing regulations began. There are currently no conservation measures protecting sharks throughout Belize territorial waters. Despite no-take restrictions in marine reserves, illegal fishing continues to take place and reef sharks are known to be caught. As such, increased enforcement is required in Belize?s 13 marine reserves to specifically protect shark species against illegal fishing. Most sharks caught as bycatch in the hook and line fisheries could be released live but are usually landed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Caribbean reef shark

The Caribbean reef shark (Carcharhinus perezi) is a species of requiem shark, belonging to the family Carcharhinidae. It is found in the tropical waters of the western Atlantic Ocean from Florida to Brazil, and is the most commonly encountered reef shark in the Caribbean Sea. With a robust, streamlined body typical of the requiem sharks, this species is difficult to tell apart from other large members of its family such as the dusky shark (C. obscurus) and the silky shark (C. falciformis). Distinguishing characteristics include dusky-colored fins without prominent markings, a short free rear tip on the second dorsal fin, and tooth shape and number.

Measuring up to 3 m (10 ft) long, the Caribbean reef shark is one of the largest apex predators in the reef ecosystem, feeding on a variety of fishes and cephalopods. They have been documented resting motionless on the sea bottom or inside caves, unusual behavior for an active-swimming shark. If threatened, it may perform a threat display in which it frequently changes direction and dips its pectoral fins. Like other requiem sharks, it is viviparous with females giving birth to 4–6 young every other year. Caribbean reef sharks are of some importance to fisheries as a source of meat, leather, liver oil, and fishmeal, but recently they have become more valuable as an ecotourist attraction. In the Bahamas and elsewhere, bait is used to attract them to groups of divers in controversial "shark feedings". This species is responsible for a small number of attacks on humans. The shark attacks only happen usually in the spring/summer part of the year.

Taxonomy and phylogeny[edit]

The Caribbean reef shark was originally described as Platypodon perezi by Felipe Poey in 1876, in the scientific journal Anales de la Sociedad Española de Historia Natural. The type specimens were six individuals caught off the coast of Cuba. The genus Platypodon was synonymized with Carcharhinus by later authors.[2]

Based on morphological similarities, Jack Garrick in 1982 grouped this species with the bignose shark (C. altimus) and the sandbar shark (C. plumbeus), while Leonard Compagno in 1988 placed it as the sister species of the grey reef shark (C. amblyrhynchos). A phylogenetic analysis based on allozyme data, published by Gavin Naylor in 1992, indicated that the Caribbean reef shark is the sister taxon to a clade formed by the Galapagos shark (C. galapagensis), dusky shark (C. obscurus), oceanic whitetip shark (C. longimanus), and the blue shark (Prionace glauca). However, more work is required to fully resolve the interrelationships within Carcharhinus.[3]

Distribution and habitat[edit]

The Caribbean reef shark occurs throughout the tropical western Atlantic Ocean, from North Carolina in the north to Brazil in the south, including Bermuda, the northern Gulf of Mexico, and the Caribbean Sea. However, it is extremely rare north of the Florida Keys. It prefers shallow waters on or around coral reefs, and is commonly found near the drop-offs at the reefs' outer edges.[4] This shark is most common in water shallower than 30 m (98 ft), but has been known to dive to 378 m (1240 feet).[1]

Description[edit]

A heavy-bodied shark with a "typical" streamlined shape, the Caribbean reef shark is difficult to distinguish from other large requiem shark species. It usually measures 2–2.5 m (6.5–8 ft) long; the maximum recorded length is 3 m (10 ft) and the maximum reported weight is 70 kg (154 lbs).[5][6] The coloration is dark gray or gray-brown above and white or white-yellow below, with an inconspicuous white band on the flanks. The fins are not prominently marked, and the undersides of the paired fins, the anal fin, and the lower lobe of the caudal fin are dusky.[2][4]

The snout is rather short, broad, and rounded, without prominent flaps of skin beside the nostrils. The eyes are large and circular, with nictitating membranes (protective third eyelids). There are 11–13 tooth rows in either half of both jaws. The teeth have broad bases, serrated edges, and narrow cusps; the front 2–4 teeth on each side are erect and the others increasingly oblique. The five pairs of gill slits are moderately long, with the third gill slit over the origin of the pectoral fins.[4] The first dorsal fin is high and falcate (sickle-shaped). There is a low interdorsal ridge running behind it to the second dorsal fin, which is relatively large with a short free rear tip. The origin of the first dorsal fin lies over or slightly forward of the free rear tips of the pectoral fins, and that of the second dorsal fin lies over or slightly forward of the anal fin. The pectoral fins are long and narrow, tapering to a point.[2] The dermal denticles are closely spaced and overlapping, each with five (sometimes seven in large individuals) horizontal low ridges leading to marginal teeth.[4]

Biology and ecology[edit]

A Caribbean reef shark cruising over a coral reef in the Bahamas.

Despite its abundance in certain areas, the Caribbean reef shark is one of the least-studied large requiem sharks. They are believed to play a major role in shaping Caribbean reef communities. These sharks are more active at night, with no evidence of seasonal changes in activity or migration. Juveniles tend to remain in a localized area throughout the year, while adults range over a wider area.[7]

Caribbean reef sharks are sometimes seen resting motionless on the sea floor or inside caves; it is the first active shark species in which such a behavior was reported. In 1975, Eugenie Clark investigated the famed "sleeping sharks" inside the caves at Isla Mujeres off the Yucatan Peninsula, and determined that the sharks were not actually asleep as their eyes would follow divers. Clark speculated that freshwater upwellings inside the caves might loosen parasites on the sharks and produce an enjoyable "narcotic" effect.[8] If threatened, Caribbean reef sharks sometimes perform a threat display, in which they swim in a short, jerky fashion with frequent changes in direction and repeated, brief (1–1.2 second duration) drops of the pectoral fins. This display is less pronounced than the better-known display of the grey reef shark (C. amblyrhynchos).[8][9]

Juvenile Caribbean reef sharks are preyed upon by larger sharks such as the tiger shark (Galeocerdo cuvier) and the bull shark (C. leucas). Few parasites are known for this species; one is a dark variegated leech often seen trailing from its first dorsal fin.[4] Off northern Brazil, juveniles seek out cleaning stations occupied by yellownose gobies (Elacatinus randalli), which clean the sharks of parasites while they lie still on the bottom.[10] Horse-eye jacks (Caranx latus) and bar jacks (Carangoides ruber) routinely school around Caribbean reef sharks.[11]

Feeding[edit]

A Caribbean reef shark surrounded by jacks.

The Caribbean reef shark feeds on a wide variety of reef-dwelling bony fishes and cephalopods, as well as some elasmobranchs such as eagle rays (Aetobatus narinari) and yellow stingrays (Urobatis jamaicensis).[1] It is attracted to low-frequency sounds, which are indicative of struggling fish.[4] In one observation of a 2 m (6.6 ft) long male Caribbean reef shark hunting a yellowtail snapper (Lutjanus crysurus), the shark languidly circled and made several seemingly "half-hearted" turns towards its prey, before suddenly accelerating and swinging its head sideways to capture the snapper at the corner of its jaws.[8] Young sharks feed on small fishes, shrimps, and crabs.[8] Caribbean reef sharks are capable of everting their stomachs, which likely serves to cleanse indigestible particles, parasites, and mucus from the stomach lining.[11]

Life history[edit]

Reproduction is viviparous; once the developing embryos exhaust their supply of yolk, the yolk sac develops into a placental connection through which they receive nourishment from their mother. Mating is apparently an aggressive affair, as females are often found with biting scars and wounds on their sides.[4] At the Fernando de Noronha Archipelago and Atol das Rocas off Brazil, parturition takes place at the end of the dry season from February to April, while at other locations in the Southern Hemisphere, females give birth during the Amazon summer in November and December.[4][12] The average litter size is four to six, with a gestation period of one year. Females become pregnant every other year.[8] The newborns measure no more than 74 cm (29 in) long; males mature sexually at 1.5–1.7 m (60–66 in) long and females at 2–3 m (79–116 in).[4]

Human interactions[edit]

Numerous Caribbean reef sharks attracted to a bait ball.

Normally shy or indifferent to the presence of divers, the Caribbean reef shark has been known to become aggressive in the presence of food and grows sufficiently large to be considered potentially dangerous.[6] As of 2008, the International Shark Attack File lists 27 attacks attributable to this species, 4 of them unprovoked, and none fatal.[13]

This species is taken by commercial and artisanal longline and gillnet fisheries throughout its range. It is valued for meat, leather, liver oil, and fishmeal. The Caribbean reef shark is the most common shark landed in Colombia (accounting for 39% of the longline catch by occurrence), where it is utilized for its fins, oil, and jaws (sold for ornamental purposes). In Belize, this species is mainly caught as bycatch on hook-and-line intended for groupers and snappers; the fins are sold to the lucrative Asian market and the meat sold in Belize, Mexico, and Guatemala to make "panades", a tortilla-like confection. A dedicated shark fishery operated in Belize from the mid-1900s to the early 1990s, until catches of all species saw dramatic declines.[1] The flesh of this species may contain high levels of methylmercury and other heavy metals.[4]

Shark feeding[edit]

Several Caribbean reef sharks being fed at a "shark feed" in the Bahamas.

A profitable ecotourism industry has arisen around this species involving organized "shark feeds", in which groups of reef sharks are attracted to divers using bait. Some US$6,000,000 is spent annually on shark viewing in the Bahamas, where at some sites a single living Caribbean reef shark has a value between US$13,000 and US$40,000 (compared to a one-time value of US$50–60 for a dead shark).[14] This practice has drawn controversy, as opponents argue that the sharks may learn to associate humans with food, increasing the chances of a shark attack, and that the removal of reef fishes for bait may damage the local ecosystem. Conversely, proponents maintain that shark feeds contribute to conservation by incentivizing the protection of sharks and educating people about them. Thus far, there has been little evidence that shark feeds have increased the risk of attack in the surrounding area.[8][15] Shark feeding has been outlawed off the coast of Florida, but continues at other locations in the Caribbean.[4]

Conservation[edit]

The International Union for Conservation of Nature (IUCN) has assessed the Caribbean reef shark as Near Threatened; its population has declined off Belize and Cuba from overfishing and exploitation continues in other regions. They are also threatened by the degradation and destruction of their coral reef habitat.[1] Commercial fishing for this species is prohibited in United States waters.[4] They are protected in the Bahamas due to their significance to ecotourism, as well as in a number of Marine Protected Areas (MPAs) off Brazil and elsewhere. However, enforcement against illegal fishing is lacking in some of these reserves, and many areas in which this species is abundant are not yet protected.[1]

References[edit]

  1. ^ a b c d e f Rosa, R.S., Mancini, P., Caldas, J.P. and Graham, R.T. (2006). Carcharhinus perezii. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved February 14, 2009.
  2. ^ a b c Compagno, Leonard J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 492–493. ISBN 92-5-101384-5. 
  3. ^ Naylor, G.J.P. (1992). "The phylogenetic relationships among requiem and hammerhead sharks: inferring phylogeny when thousands of equally most parsimonious trees result". Cladistics 8: 295–318. doi:10.1111/j.1096-0031.1992.tb00073.x. 
  4. ^ a b c d e f g h i j k l Scharfer, A. Biological Profiles: Caribbean Reef Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on February 14, 2009.
  5. ^ Froese, Rainer and Pauly, Daniel, eds. (2009). "Carcharhinus perezii" in FishBase. February 2009 version.
  6. ^ a b Ferrari, A. and A. (2002). Sharks. New York: Firefly Books. pp. 176–177. ISBN 1-55209-629-7. 
  7. ^ Garla, R.C., Chapman, D.D., Wetherbee, B.M. and Shivji, M. (2006). "Movement patterns of young Caribbean reef sharks, Carcharhinus perezi, at Fernando de Noronha Archipelago, Brazil: the potential of marine protected areas for conservation of a nursery ground". Marine Biology 149: 189–199. doi:10.1007/s00227-005-0201-4. 
  8. ^ a b c d e f Martin, R.A. Caribbean Reef Shark. ReefQuest Centre for Shark Research. Retrieved on February 14, 2009.
  9. ^ Martin, R.A. (March 2007). "A review of shark agonistic displays: comparison of display features and implications for shark-human interactions". Marine and Freshwater Behaviour and Physiology 40 (1): 3–34. doi:10.1080/10236240601154872. 
  10. ^ Sazima, I. and Moura, R.L. (2000). "Shark (Carcharhinus perezi), Cleaned by the Goby (Elacatinus randalli), at Fernando de Noronha Archipelago, Western South Atlantic". In Ross, S. T. Copeia 2000 (1): 297–299. doi:10.1643/0045-8511(2000)2000[0297:SCPCBT]2.0.CO;2. 
  11. ^ a b Brunnschweiler, J.M., Andrews, P.L.R., Southall, E.J., Pickering, M., and Sims, D.W. (2005). "Rapid voluntary stomach eversion in a free-living shark". Journal of Marine Biology, Ass. U.K. 85: 1141–1144. 
  12. ^ Garla, R.C., Chapman, D.D., Shivji, M.S., Wetherbee, B.M., and Amorim, A.F. (2006). "Habitat of juvenile Caribbean reef sharks, Carcharhinus perezi, at two oceanic insular marine protected areas in the southwestern Atlantic Ocean: Fernando de Noronha Archipelago and Atol das Rocas, Brazil". Fisheries Research 81: 236–241. doi:10.1016/j.fishres.2006.07.003. 
  13. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on April 22, 2009.
  14. ^ Fowler, S.L., Reed, T.M. and Dipper, F. (2002). Elasmobranch Biodiversity, Conservation and Management: Proceedings of the International Seminar and Workshop, Sabah, Malaysia. International Union for Conservation of Nature and Natural Resources Species Survival Commission. pp. 47–48. ISBN 2-8317-0650-5. 
  15. ^ Murch, A. Shark Feeding. Elasmodiver.com. Retrieved on February 14, 2009
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!