Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Basileuterus fulvicauda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACAAAGACATCGGGACCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGAGACGACCAAGTCTACAACGTAGTTGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTCATGCCAATTATAATCGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGTATAAATAATATAAGCTTCTGACTACTACCACCCTCATTCCTTCTTCTCCTAGCATCCTCTACAGTTGAAGCAGGTGTCGGCACAGGCTGAACAGTGTACCCCCCACTGGCCGGCAATCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATCTTCTCTCTACACCTAGCTGGTATCTCCTCAATCCTCGGGGCAATTAACTTCATTACAACAGCAATCAACATAAAACCCCCCGCCCTCTCACAATACCAAACTCCCCTATTCGTCTGATCAGTCCTAATCACTGCAGTCCTCCTCCTCCTCTCCCTCCCAGTTCTAGCCGCAGGAATTACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCCGGAGGAGGGGATCCTGTCCTATATCAACATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Basileuterus fulvicauda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Buff-rumped warbler

The buff-rumped warbler (Myiothlypis fulvicauda) is a New World warbler is a resident bird from Honduras south to northwestern Peru and disjunctly in the western Amazon. It is found in forests at up to 1500 m altitude, always near water.

The pair builds a bulky domed nest with a side entrance on a sloping bank next to a stream or path, and the female lays two white eggs which are incubated for 16–17 days with another 13–14 days to fledging.

The buff-rumped warbler is 13-13.5 cm long and weighs 14.5 g. The nominate race M. f. fulvicauda of western Amazonia in Colombia, Ecuador, Peru and Brazil is dark olive-brown above with a grey head, buff supercilium, and the conspicuous rich buff rump and upper tail that give this species its English and scientific names. The lower half of the tail is blackish. The underparts are whitish with some buff on the flanks. The sexes are similar, but the young bird is browner on the upperparts, head and breast, and its rump is paler.

There are five other subspecies.

  • M. f. semicervina, is found in the Chocó from eastern Panama to north-western Peru. It is similar to fulvicauda, but the buff area of the tail is larger and paler, and the buff on the flanks is more extensive.
  • M. f. motacilla, from the Magdalena Valley in Colombia, is similar to semicervina, but the buff area of the tail is paler, and upperparts more olive.
  • M. f. leucopygia, from the Caribbean slope in Central America is a distinctive form, with a much paler buff rump, a white supercilium, dark legs, and dark spotting on the breast.
  • M. f. veraguensis, from the Pacific slope in Central America is like leucopygia, but less spotted and with a somewhat darker rump.
  • M. f. significans of south-eastern Peru and northern Bolivia has a less extensive buff rump than other subspecies, and olive upperparts.

This is a common species, easily seen and identified as it hops on the ground, pumping and swinging its broad tail constantly. The buff-rumped warbler primarily feeds on insects, spiders and other small invertebrates, taken on the ground or in flight in open areas along the banks of streams, puddles, roadsides or tracks. Pairs defend their linear feeding territories along a stretch of stream throughout the year.

The call note of the buff-rumped warbler is a hard tschik like northern waterthrush, and the male's song is a warble followed by a series of 8-15 ringing chew notes. The female may give a soft reply.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!