Ecology

Associations

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Asteraceae
Other: major host/prey

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Magnoliopsida
Other: minor host/prey

In Great Britain and/or Ireland:
Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Arnoseris minima

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Chrysanthemum

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Hieracium

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Inula

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Lactuca

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Senecio

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Serratula tinctoria

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Sonchus

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Tanacetum

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Taraxacum

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Dendranthema

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Pericallis x hybrida

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Calendula

Foodplant / miner
larva of Chromatomyia syngenesiae mines leaf of Lactuca sativa

Animal / parasitoid
Dacnusa sibirica is parasitoid of larva of Chromatomyia syngenesiae

Animal / parasitoid
Diglyphus isaea is parasitoid of larva of Chromatomyia syngenesiae

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chromatomyia syngenesiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTCGAGCTGAATTAGGACACCCTGGTGCTTTAATTGGAGAT---GACCAAATTTATAATGTAATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTAATACTAGGAGCCCCAGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGATTACTACCTCCTGCTTTAACCTTATTGTTAATAAGCAGTATAGTTGAAAACGGAGCTGGTACAGGATGAACTGTTTACCCTCCTTTATCTTCAGTGATTGCTCATGGAGGAGCTTCAGTAGATTTAGCTATTTTTTCACTTCATTTAGCCGGGATTTCTTCAATTTTAGGAGCAGTAAATTTTATTACAACTATTATTAACATACGATCAGTAGGAATTTCTTTTGACCGAATGCCATTATTTGTGTGATCAGTTTTAATTACTGCTGTTCTATTACTTCTTTCATTACCTGTTTTAGCCGGAGCAATTACTATATTATTAACAGATCGAAATTTTAATACTTCCTTTTTCGACCCTGCTGGGGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTCTTTGGTCACCCTGAAGTATATATTTTAATTTTACCTGGGTTTGGAATAATTTCTCATATTATTAGTCAAGAATCAGGAAAAAAGGAAACTTTTGGGTCTTTAGGAATAATTTATGCTATATTAGCAATTGGTTTACTAGGATTTATTGTATGAGCTCATCATATATTTACAGTAGGATTAGATGTTGATACTCGAGCTTATTTTACTTCTGCTACAATAATTATTGCTGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCTACTTTACATGGAACT---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chromatomyia syngenesiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!