Overview

Brief Summary

The American Alligator is one of the largest North American reptiles. This species is native to the South-East United States, where it inhabits wetlands on the Atlantic coast from North Carolina to Florida, and in the Northern Gulf of Mexico west to Texas (Scott 2004). Alligators mostly inhabit marshes and swamps, but can also be found in rivers, streams, lakes, and ponds. Although they cannot survive in seawater, they do tolerate brackish water and venture into salt marshes, mangrove swamps, and other estuarine habitats (Scott 2004).

Adults and subadult alligators prey on a variety of aquatic organism including fish, crabs, snakes, turtles, mammals, birds, and other alligators (Jensen et al. 2008). Juveniles eat insects, amphibians, crayfish, molluscs and small fish (Jensen et al. 2008, Scott 2004).

  • Jensen, J. B., C. D. Camp, J. W. Gibbons, and M. J. Elliott, eds. 2008. Amphibians and Reptiles of Georgia. University of Georgia Press.
  • Scott, C. 2004. Endangered and Threatened Animals of Florida and Their Habitats. University of Texas Press.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Katja Schulz

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

American Alligator: A Brief History

Crocodilia, originating more than 200 million years ago in the late Triassic Period natives to the super continent Pangea. Fossils of these early crocodilians were among the first vertebrates to be scientifically studied by pioneers of paleontology in the early 19th century. Unlike present crocodilians, their predecessor's had longer limbs and shorter snouts, making them more equipped for a terrestrial life.

This genus represents evolution at it's best. These living fossils have survived an array of mass extinctions including continental drift. Spawning 22 different species, all adapted to a more Amphibious life style, most well know being the American Alligator mississippiensis).

The American Alligator typically ranges from 10 to 15 feet, the largest being male, although the biggest on record ranges to 20 feet long. This unique animal has internal sexual organs, so a probe is needed to determine sex. Running down the entire back side of the alligator is a protective bony plate called osteoderms. On land they can reach speeds between 9 to 19 miles an hour, surprisgly they have also been known to survive temperatures as low as 26.5 degrees Fahrenheit.

In early June most of the Florida population of Alligators lay their eggs. The female will pile various vegetation from her environment together, then will repeatedly drag her body over to create a mound to nest her eggs. The eggs are about the size of an ostrich egg and she will lay between 30 to 40 eggs. They incubate for about 65 days. The temperature of the incubation determines the sex of the hatchlings. 90 to 93 for a male, 82 to 86 a female, with Crocodiles it is the opposite, the warmer eggs will be females, the cooler eggs will be males, this phenomenom is referred to as Temperature-Dependant Sex Determination or (TSD). When born these hatchlings are prey to anything in the environment so, evolution has equppied them with yellowish bands to camouflage them with their environment. Unusual for the reptile kingdom, the American Alligator is very protective of it's young and will guard the nest.
  • Crocodiles and Alligators/ Consulting Editor Charles A. Ross/Editorial Adviser Dr. Stephen Garnett/ Illustrations Tony Pyrzakowsk
  • eol.org
  • Tim Walsh/ co - founder of The Florida Turtle Conservation Trust/Exhibit Manager of Nature Works at The Orlando Science Center in Orlando, Florida
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Martin Srain

Supplier: Martin Strain

Unreviewed

Article rating from 1 person

Average rating: 2.5 of 5

Distribution

Geographic Range

American alligators are found from the southern Virginia-North Carolina border, along the Atlantic coast to Florida and along the Gulf of Mexico as far west as the Rio Grande in Texas.

Biogeographic Regions: nearctic (Native )

  • Britton, A. 1999. "Alligator mississippiensis in the Crocodilians, Natural History and Conservation" (On-line). Accessed 31 March 2000 at http://www.flmnh.ufl.edu/cnhc/csp_amis.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Range extends from coastal North Carolina (O'Brien and Doerr 1986) to the Florida Keys, and west to southern Texas, north to southeastern Oklahoma and Arkansas (Trauth and McCallum 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: SE USA (Alabama, Arkansas, North Carolina, South Carolina, Florida, Georgia, Louisiana, Mississippi, Oklahoma, Texas), Mexico  
Type locality: "les bords du Mississipi," U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Southeastern U.S.A.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average size for an adult female is just under 3 meters (9.8 feet), while the adult male usually falls between 4 and 4.5 meters (13 to 14.7 feet). American alligators reaching lengths of 5-6 meters (16 to 20 feet) have been reported in the past, but there have been no recent recordings equaling those lengths.

Legs of American alligators are characteristically short, though capable of carrying the animal at a gallop. The front legs have five toes while the back legs have only four. The snout of this alligator species is also distinct, being significantly broader for those in captive, mainly due to a difference in diet.

Nostrils at the end of the snout allow for breathing while the alligator is otherwise fully submerged beneath the water's surface. During times of hibernation, alligators keep these nostrils just above the water's surface, allowing the top part of the body to freeze in ice. The large fourth tooth in the lower jaw fits into a socket in the upper jaw and is not visible when the mouth is closed.

Both males and females have an "armored" body with a muscular flat tail, used in propelling the animal forward while swimming. The skin on their back is armored with embedded bony plates called osteoderms or scutes. Adult males and females have an olive brown or black color with a creamy white underside. The young can be distinguished from adults because they have bright yellow stripes on their tails. Eye color of American alligators is generally silverish.

Range length: 3 to 4.5 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 150000 g.

Average basal metabolic rate: 0.1539 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 400 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species differs from the American crocodile in having a broader snout and in not having the 4th lower jaw tooth protruding conspicuously upward near the end of the snout (tooth may be inconspicuous in small crocodiles). It differs from the spectacled caiman in lacking a curved, bony, crosswise ridge in front of the eyes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

American alligators are usually found in freshwater swamps, marshes, rivers, lakes, and occasionally, smaller bodies of water. It is believed that this preference for calm waters has to do with their swimming and breathing. In areas of protected water, an American alligator has only to keep its nasal disk above water to breath, whereas in rough water the snout must be at a steeper angle, making it more difficult to swim. They can also tolerate reasonable amounts of salinity, but only for short amounts of time due to their lack of buccal glands.

American alligators are also known to modify their enivironment by creating burrows. These are created using both snout and tail and are used for shelter and hibernation during freezing temperatures. If the water they live in dries out, alligators will swim or walk to other bodies of water, sometimes even taking shelter in swimming pools.

Habitat Regions: temperate ; tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: American alligators inhabit fresh and brackish marshes, ponds, lakes, rivers, swamps, bayous, canals, and large spring runs. They often bask on partially submerged logs or on land next to the water. Alligators dig dens in river or lake margins or in marshes; they spend cold winter and drought periods in the den They depend on access to air holes to survive in ice-covered ponds (Brandt and Mazotti 1990).

Copulation occurs in shallow water. Females deposit eggs in large mounded nests made of leaves, mud, rotting vegetation, rocks, or other debris. Nests are built in marshes or at lake or river margins. In north-central Florida, alligators nested in close proximity to permanent water, used a wide variety of available plant materials and soil in constructing nest (Goodwin and Marion 1978). Turtles (e.g., Pseudemys nelsoni) often lay eggs in alligator nests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Alligators are basically carnivores, but they eat more than just meat, feeding on anything from sticks to fishing lures to aluminum cans. Mostly, they consume fish, turtles, snakes, and small mammals. When they are young they feed on insects, snails, and small fish.

Alligators hunt primarily in the water at night, snapping up small prey and swallowing it whole. Large prey are dragged under water, drowned and then devoured in pieces. Alligators have also been known to hold food in their mouth until it deteriorates enough to swallow. They also have a specialized valve in the throat called a glottis, which allows them to capture prey underwater.

With regards to hunting animals on land, alligators are usually considered idle hunters, waiting offshore for unsuspecting prey to drink at the water's edge. With this approach an alligator is likely to grab the drinking animal's head, slowly pulling it underwater until it drowns. In this way alligators exert minimal energy in capturing prey.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; insects; mollusks

Plant Foods: wood, bark, or stems

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic feeder. Juveniles eat mainly invertebrates: crayfish, aquatic and terrestrial insects, and mollusks; also small fishes, amphibians, and small mammals. Larger individuals eat vertebrates, including birds, reptiles (infrequently conspecifics), mammals (up to the size of deer), and fishes (USFWS 1980); also observed eating horseshoe crabs in eastern Florida. Smaller prey is swallowed whole; twists off chunks off flesh from larger prey. Digestive system commonly contains small stones.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

American alligators have proven to be an important part of the environment, and therefor, are considered by many to be a "keystone" species. Not only do they control populations of prey species, they also create peat and "alligator holes" which are invaluable to other species. Red-bellied turtles, for example, incubates its own eggs in old alligator nests. Alligators also are good indicators of environmental factors, such as toxin levels. Increased levels of mercury have been found in recent blood samples.

Ecosystem Impact: creates habitat; keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The first few years of a hatchlings life are the most dangerous, as anything that can eat a small alligator will. Snakes, wading birds, osprey, raccoons, otters, large bass, garfish, even larger alligators will feed upon young alligators. Once the alligator reaches about 4 feet, its only real predator is man. Extremely thick skin protected by bony plates called scutes prevent harm from most attacks. It is this skin, though, which attracts man to alligators. It is commercially used for the creation of wallets, purses, boots, and other textiles.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Present range of EOs approximates historical range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population is 1 million or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

During periods of drought, "gator holes" (deep areas wallowed out by alligators) are important to the survival of individuals of many aquatic animal species.

In Louisiana (Joanen and McNease 1970, 1972), nesting females had a minimum home range of 6.4-41.0 acres; males had minimum home range sizes of 452-12,560 acres and sometimes traveled over 8 km in a day.

Also in Louisiana, annual home range size of 15 radiotracked adult females was 6-166 ha; 12 of the 15 had home ranges under 50 ha (Rootes and Chabreck 1993).

See Brandt (1991) for information on the population biology of an increasing population in South Carolina.

In Georgia, nests incurred a high rate of predation by black bears (Hunt and Ogden 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

American alligators are the most vocal of all crocodilians, and communication begins early in life, while alligators are still in eggs. When they are ready to hatch, the young will make high pitched whining noises. Alligators commonly bellow and roar at one another. The bellow is loud and throaty, and can be heard from up to 165 yards away. Alligators also emit sounds called chumpfs. These are cough like purrs made during courting.

Other communication during mating season includes non-verbal forms such as lifting the head out of the water to show honorable intentions, headslapping by males as a sign of aggression to ward off intruders, and perhaps most notably, the virbrations, bubbles, and ripples seen in the water as a result of subaudible noises.

Communication Channels: tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: In the northern part of the range, alligators are generally inactive or at least less active from about late November to March.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The temperature at which American alligator eggs develop determines their sex. Those eggs which are hatched in temperatures ranging from 90 to 93 degrees Fahrenheit turn out to be male, while those in temperatures from 82 to 86 degrees Fehrenheit end up being female. Intermediate temperature ranges have proven to yield a mix of both male and females. After hatching, alligators can grow rapidly, espectially during the first four years of life, averaging over 1 foot of growth for each year of life. Both sexes reach sexual maturity at around 6 feet in length, however, this occurs earlier in males because they reach this length sooner than females.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

While there are currently no methods for determining the age of an alligator while still alive, it is known that those in the wild tend to live to between 35 and 50 year, while those in captive generally live longer, around 65-80 years. Factors which can lead to earlier mortality include successful predation early in life and hunting by humans.

Typical lifespan

Status: wild:
35 to 50 years.

Typical lifespan

Status: captivity:
65 to 80 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 73.1 years (captivity) Observations: These are long-lived animals that appear to show indeterminate growth. In captivity, they can reach sexual maturity at 6 years of age. In the wild, food availability influences growth and sexual maturation with food scarcity being linked to a slower growth and a delayed maturity (Lance 2003). A decline in egg production in females over 30 years of age has been reported (Castanet 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Breeding takes place during the night, in shallow waters. Females usually initiate courtship during peak activity. When males (bulls) wish to attract females, they often roar or bellow, emmitting subaudible vibrations which can be seen by the bubbles and ripples they produce. Other courtship rituals include rubbing, touching, blowing bubbles, and vocalizing. It is also common for males to raise their heads out of the water, exposing their vulnerable necks as an expression of "good intentions". It is also quite common for both partners to try and push one another underwater in an attempt to judge eachothers strength.

Alligators are not monogamous, but rather, polygynous, which means one male may service up to ten or more females in his territory. This maximizes chances for successful breeding. Male alligators are territorial animals during the breeding season, and will defend their area against other male intruders, often displaying acts of headramming and sparring with open jaws.

Mating System: polygynous

Both males and females reach sexual maturity when they are about six feet long, a length attained at about 10 to 12 years, earlier for males than females. Courtship starts in April, with mating occuring in early May. After mating has taken place, the female builds a nest of vegetation. Then, around late June and early July, the female lays 35 to 50 eggs. Some females have been reported as laying up to 88 eggs. The eggs are then covered with the vegetation nest through the 65-day incubation period.

Towards the end of August, the young alligators begin to make high-pitched noises from inside of the egg. This lets the mother know that it is time to remove the nesting material, and the six to eight inch alligator is hatched. Newly hatched alligators live in small groups, call "pods." Eighty percent of young alligators fall victim to birds and raccoons. Other predators include bobcats, otters, snakes, large bass and larger alligators. Females have been known to aggressively defend their young during these first few months and, in some cases, years. Maturity is generally reached during the sixth year.

Breeding interval: American alligators breed once yearly.

Breeding season: Breeding occurs in early May, with egg laying occuring in late June and early July.

Range number of offspring: 35 to 88.

Range age at sexual or reproductive maturity (female): 10 to 12 years.

Range age at sexual or reproductive maturity (male): 10 to 12 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); oviparous

Males provide no parental care, and parental care by the female is limited to the first year of life. She is responsible for removing any vegetation covering the nest when her young are ready to hatch, and she will often bring them to water after hatching. During the first year or so she will defend her hatchlings from predators. After the first year, the female leaves her young to tend to new hatchlings of the next breeding season.

Parental Investment: pre-weaning/fledging (Protecting: Female)

  • Britton, A. 1999. "Alligator mississippiensis in the Crocodilians, Natural History and Conservation" (On-line). Accessed 31 March 2000 at http://www.flmnh.ufl.edu/cnhc/csp_amis.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spring courtship involves loud bellowing and slapping of the head against the water surface. Reproductive females deposit clutches of usually about 20-60 eggs in May, June, or July (peak in late June-early July in the Everglades, north-central Florida, and Georgia). Eggs hatch in about 9 weeks. Female stays near the nest and may protect it during incubation, and she assists the emergence of the young by opening the nest mound; sometimes she carries the young in her mouth to water. Hatchlings may stay together in the vicinity of the nest and mother for 1-3 years (Behler and King 1979, USFWS 1980). Sexually mature in about 6-7 years.

In most areas, about 25-30% of the adult females nest in a particular year (Rootes and Chabreck 1993); a nesting rate of up to 68% was recorded in one area in southwestern Louisiana (see Taylor et al. 1991).

Reproductive success in the Everglades was constrained primarily by egg mortality caused by flooding (Kushlan and Jacobsen 1990). In north-central Florida, 31% of nests with complete clutches were destroyed by mammalian predators (Goodwin and Marion 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Blood flow regulates heat exchange: alligator
 

Skin of alligators regulates heat exchange by increasing blood flow.

   
  "Alligators possess several thermoregulatory abilities that may be of interest to architects. First, alligators have the ability to drop their body temperature when they are not receiving enough oxygen. This seems to offset changes that would otherwise occur in ventilation, oxygen consumption, acid-base balance, and lactate levels. Second, alligators warm their bodies much more quickly than they cool off. The ratio of rate of heating to rate of cooling is dependent on body mass, but is generally 2-3. The ratio is maximal when the alligator is 5 kg, indicating that there is an optimal size for control of heat exchange. The speedy rate of warming in alligators can be attributed to increased blood flow in the skin. During cooling, blood flow does not change. In fact, the results of one study suggest that blood flow is not at all involved in cooling. When blood flow to the appendages was occluded, the rate of warming dropped significantly, while the rate of cooling did not change. There may be an optimum body size for the control of heat exchange. The ratio of rate of heating to rate of cooling is maximum when the alligator is 5 kg. Alligators warm their bodies up to twice as fast as they cool down. There is greater blood flow in the skin during warming than during cooling." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
  • Branco LGS; Poertner HO; Wood SC. 1993. Interaction between temperature and hypoxia in the alligator. 265(6): 1339-1343.
  • Turner JS; Tracy CR. 1985. Body size and the control of heat exchange in alligators. Journal of Thermal Biology. 10: 9-12.
  • Turner JS; Tracy CR. 1983. Blood flow to appendages and the control of heat exchange in the American alligator. Physiological Zoology. 56: 195-200.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Receptors detect minuscule vibrations: alligator
 

Faces of alligators detect miniscule vibrations on air water interfaces via dome pressure receptors

   
  "Crocodilians have organ dome pressure receptors (DPRs) on their faces that are connected to the hypertrophied nerve system, and are capable of detecting very small disruptions in the surface of the surrounding water, caused by location of their prey. The faces of alligators (Alligator mississippiensis) are covered with small-pigmented domes, outside and inside the mouth. Experiments in full darkness with half submerged alligators revealed that they are sensitive to single water droplets, with their hearing organs shut. Soares [29] investigated this effect in crocodilians and lizards and found that only animals that are semi-aquatic show the same pattern of vibration perception as that of the crocodilians." (Collins 2004:170)
  Learn more about this functional adaptation.
  • Collins, M. 2004. Design and nature II: comparing design in nature with science and engineering. Southampton: WIT.
  • Soares, D. 2002. Neurology: An ancient sensory organ in crocodilians. Nature. 417(16 May): 241-242.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology

Studies by Farmer and Sanders (2010) revealed that the lungs of the American Alligator--like those of birds, but unlike those of mammals--move air in only one direction during both inspiration and expiration through most of the tubular gas-exchanging bronchi (parabronchi). (In mammals, air moves tidally into and out of terminal gas-exchange structures, which are cul-de-sacs.) Given the phylogenetic relationship between crocodilians and birds, which are both archosaurs, Farmer and Sanders suggest that this air flow pattern may date back to the basal archosaurs of the Triassic and may have been present in their non-dinosaur descendants (phytosaurs, aetosaurs, rauisuchians, crocodylomorphs, and pterosaurs) as well as in dinosaurs, including birds (the avian dinosaurs).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alligator mississippiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC1498-06|NC_001922|Alligator mississippiensis| CACCGTTGACTCTTCTCTACTAACCACAAAGACATTGGCACCCTTTACTTCATTTTCGGAACTTGAGCCGGAATGGTGGGAACAGCACTT---AGCCTCCTTATTCGGACAGAATTAAGCCAGCCCGGACCTCTATTAGGTGAT---GACCAAATTTATAACGTAATTGTCACCGCCCATGCCTTCATTATAATCTTTTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAACTGGCTATTACCCCTAATA---ATCGGAGCCCCAGACATGGCATTCCCCCGAATAAACAACATAAGTTTCTGATTACTCCCCCCATCTTTCACACTACTACTCTCCTCAGCCTGCATCGAAGCAGGTGCTGGAACAGGGTGAACCGTCTACCCTCCCCTAGCCGGAAACCTAGCCCACGCCGGGCCATCCGTAGATTTA---ACTATCTTCTCTCTACACTTAGCCGGAGTATCTTCCATCCTCGGAGCAATTAACTTTATTACAACAGCAATCAACATAAAACCCCCAGCAATATCCCAATACCAAACACCACTATTTGTGTGATCCGTCCTAATTACAGCTGTACTTCTCCTACTATCCCTACCAGTACTAGCTGCT---GGAATTACAATACTACTCACAGACCGCAACTTAAACACAACCTTCTTTGACCCCGCAGGGGGAGGAGATCCCATCCTATACCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTATATATCCTAATTCTTCCAGGGTTCGGAATAATTTCCCACGTAGTAGCCTTTTATTCAGGCAAAAAA---GAACCATTCGGCTATATAGGAATAGCATGAGCCATATTATCCATTGGATTCTTAGGGTTCATCGTCTGAGCCCACCACATATTTACAGTCGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alligator mississippiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

American alligators are listed as threatened by the federal government because they are similar in appearance to American crocodiles (Crocodylus acutus). American crocodiles are endangered and the government does not want hunters to confuse the two species. Hunting is allowed in some states, but is is heavily controlled.

US Federal List: threatened

CITES: no special status

IUCN Red List of Threatened Species: lower risk - least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Occurs in southeastern North America; population has shown rapid recovery with enforcement of protective legislation; populations are stable or increasing in most of range; there are currently fourteen million acres of alligator habitat; no longer biologically endangered or threatened; however, listed by USFWS as Threatened throughout entire range due to similarity of appearance to other endangered or threatened crocodilians.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Similarity of Appearance (Threatened)
Date Listed: 07/27/1979
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: entire
Listing status: SAT

For most current information and documents related to the conservation status and management of Alligator mississippiensis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Declined due to overharvest and habitat loss. Has increased with protection. Current primary threat is loss and degradation of habitat due to recreational use and agricultural and other development. In Louisiana, fire ants detrimentally affected nest success to a significant degree by killing hatchlings in the nest and possibly by deterring opening of nests by maternal females (Reagan et al. 2000). Resistant to human incursion as long as habitat (especially nest sites) are not disturbed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Can be managed as a game species, at least in the main part of the range. See Woodward et al. (1989) for information on egg collecting for commercial use and restocking.

In the Everglades, alligator conservation depends on restoration of more predictable hydrological fluctuations than have occurred recently as a result of water management (Kushlan and Jacobsen 1990).

Biological Research Needs: Further studies on alligator behavior and ecology.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Protected occurrences occur throughout much of the alligator`s range.

Needs: Restrict wetland development. Enforce anti-poaching laws. Regulate harvest on sustained yield basis. Prevent/limit altered water flow to prevent flooding and inundation of nests in low lying areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Since the alligator will feed on almost anything, they pose a threat to humans. In Florida, where there is the greatest alligator population, there were five deaths to alligator attacks from 1973 to 1990. Dogs and other pets are also sometimes killed. (University of Florida)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Alligators are hunted mostly for their skin, but also they are hunted for their meat. Today, there is a multimillion dollar industry in which alligators are raised in captivity for the production of their meat and skin. Also, alligators are a tourist attraction, especially in Florida.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: See Thorbjarnarson (1999) for a discussion of the limits to sustainable use of crocodilians.

See Conover and Dubow (1997) for information on alligator attacks on humans in the United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American alligator

The American alligator (Alligator mississippiensis), sometimes referred to colloquially as a gator, is a reptile endemic only to the Southeastern United States. It is one of the two living species of alligator, in the genus Alligator, within the family Alligatoridae. It is larger than the other extant alligator species, the Chinese alligator.

The American alligator inhabits wetlands that frequently overlap with human-populated areas.

Contents

Description

Forelimb showing the large claws and slight webbing between the toes
Tail which is for aquatic propulsion and as a weapon of defense

|

A partially submerged alligator displaying a typical ambush position

The American alligator has a large, slightly rounded body, with thick limbs, a broad head, and a very powerful tail. Adult Alligators generally have dark gray or nearly black color. They may at times appear to be lighter based on detritus or algae in the water covering their skin. Juvenile alligators have a striped pattern for camouflage that they lose as they mature. Averaging about 9.5 in (24 cm) in length when newly hatched, alligators reach sexual maturity when they measure about 5–7 ft (1.5–2.1 m).[2] Adult male alligators average 11.2 ft (3.4 m) in length, while adult females average 8.2 to 9.8 ft (2.5 to 3.0 m).[3][4][5][6] Average adult body weights are reported from 270 to 800 lb (120 to 360 kg), with a few exceptionally large and old males exceeding 14 ft (4.3 m) and 1,000 pounds (450 kg).[7][8][9] One American Alligator reached a length of 19 feet 2 inches (5.84 m) and 2,200 lb (1,000 kg),[10] which made it not only the largest alligator ever recorded, but also among the largest crocodilians on record (although the related Black Caiman and 5 other crocodilians are believed to equal or exceed this size and prehistoric crocodilians such as Sarcosuchus, Deinosuchus, and Purussaurus reached much greater size). The tail, which accounts for half of the alligator's total length, is primarily used for aquatic propulsion. The tail can also be used as a weapon of defense when an alligator feels threatened. Alligators travel very quickly in water and while they are generally slow-moving on land, alligators can lunge short distances very quickly. They have five claws on each front foot and four on each rear foot. American Alligators have the strongest laboratory measured bite of any living animal, measured at up to 9,452 newtons (2,125 lbf) in laboratory conditions. It should be noted that this experiment has not (at the time of the paper published) been replicated in any other crocodilians.[11]

Some alligators are missing an inhibited gene for melanin, which makes them albino. These alligators are extremely rare and almost impossible to find in the wild. They could survive only in captivity. Like all albino animals, they are very vulnerable to the sun and predators.[12] American Alligators can remain underwater for several hours if not actively swimming or hunting (then it is only about 20 minutes); they do this by rerouting blood to reduce circulation to the lungs, and thus the need for oxygen.

Habitat

American alligators are mostly found in the Southeastern United States, from Great Dismal Swamp in North Carolina south to Everglades National Park in Florida and west to the southern tip of Texas. They are found in the U.S. states of North Carolina, South Carolina, Georgia, Florida, Louisiana, Alabama, Mississippi, Arkansas, Texas, and Oklahoma. Florida and Louisiana currently have the largest population of alligators. Florida has an estimated population of 1 to 1.5 million while Louisiana has an estimated population of 1.5 million

Although primarily freshwater animals, alligators will occasionally venture into brackish water.[13] Alligators live in wetlands and this is the vital habitat that holds the key to their continued long-term survival. Alligators depend on the wetlands, and in some ways the wetlands depend on them. As apex predators, they help control the population of rodents and other animals that might overtax the marshland vegetation.

American alligators are less prone to cold than American crocodiles. Unlike the American crocodile, which would immediately succumb to the cold and drown in water of 45 °F (7.2 °C), an alligator can survive in such temperatures for some time without any signs of evident discomfort.[14] It is thought that this adaptiveness is the reason why American alligators spread farther north than the American crocodile.[14] In fact, the American alligator is found farther from the equator and is more equipped to deal with cooler conditions than any other crocodilian.[15]

In Florida, alligators face ambient temperature patterns unlike elsewhere in their range. The consistently high temperatures lead to increased metabolic cost. Alligators in the Everglades have reduced length to weight ratio, reduced total length, and delayed onset of sexual maturity compared with other parts of their range. The reason for this poor condition is currently suspected to be a combination of low food availability and sustained high temperatures.

Diet

Alligators are apex predators capable of killing large terrestrial prey. This large American alligator has caught or scavenged an adult deer.

Alligators eat fish, birds, turtles, snakes, mammals, and amphibians. Hatchlings diet on invertebrates, insects, larvae, snails, spiders, worms, and other small prey. They will also eat small fish at any opportunity. As they grow, they gradually move on to larger fish, mollusks, frogs and small mammals like rats, and mice. Some adult alligators take a larger variety of prey ranging from a snake or turtle to a bird and moderate sized mammals like a raccoon or deer.

Once an alligator reaches adulthood, any animal living in the water or coming to the water to drink is potential prey. Adult alligators will eat wild boars, deer, dogs of all sizes, livestock including cattle and sheep, and are often known to kill and eat smaller alligators. In rare instances, large male alligators have been known to prey on the Florida panther and American black bear, making the American alligator the apex predator throughout its distribution.[16] The American alligator is known as King of the Everglades, although the American crocodile, which shares parts of the Everglades with the alligator, is capable of growing larger (over 5 meters), mostly in warmer regions like Central America, Mexico, and the Caribbean.

Although fish and other prey taken in the water or at the water edge form the major part of alligator's diet, adult alligators also spend considerable time hunting on land, up to 50 m (170 feet) from water, ambushing terrestrial animals on trailsides and road shoulders on warm nights.[17]

The gizzards (stomachs) of alligators often contain gastroliths. The function of these stones is to grind up food in the stomach and help with digestion. This is important because gators swallow their food whole. These gastroliths are also used in buoyancy control.

In 2005, the bite force of a 12-foot (3.7 m), 450-pound (200 kg) alligator was measured to be 2209 pounds-force (9.826 kN)by Greg Ericson.[18] American alligators cruise through water at just over 1 mph (0.4 m/s); in pursuit of prey they can swim much faster over short distances.

Reproduction

Young American Alligators basking

The breeding season begins in the spring. Although alligators have no vocal cords, males bellow loudly to attract mates and warn off other males during this time by sucking air into their lungs and blowing it out in intermittent, deep-toned roars. Male alligators are also known to use infrasound during their mating behavior, as one of their routines is to engage in bellowing in infrasound while their head and tail are above the water, with their midsection very slightly submerged, making the surface of the water that is directly over their back literally "sprinkle" from their infrasound bellowing, in a so-called "water dance".[19] Recently it was discovered that on spring nights alligators gather in large numbers for group courtship, the so-called "alligator dances".[20]

Alligator nest and young in Florida

The female builds a nest of vegetation, sticks, leaves, and mud in a sheltered spot in or near the water. After she lays her 20 to 50 white, goose egg-sized eggs, she covers them under more vegetation, which, like mulch, heats as it decays, helping to keep the eggs warm. This differs from Nile crocodiles who lay their eggs in pits.[14]

The temperature at which alligator eggs develop determines their sex. Those eggs which are hatched in temperatures ranging from 90 to 93 degrees Fahrenheit (32 to 34 °C) become males, while those in temperatures from 82 to 86 °F (23 to 30 °C) become female. Intermediate temperature ranges have proven to yield a mix of both male and females. The female will remain near the nest throughout the 65-day incubation period, protecting the nest from intruders. When the young begin to hatch they emit a high-pitched croaking noise, and the mother quickly digs them out.

Juvenile American alligator swimming, showing the distinctive yellow striping found on juveniles

The young are tiny replicas of adult alligators with a series of yellow bands around their bodies. They find their way to water after hatching. For several days they continue to live on yolk masses within their stomachs. The baby spends about five months with the mother before leaving her. Snapping turtles, large snakes, raccoons, largemouth bass, American black bears and large raptorial birds like great horned owls and bald eagles prey upon the young. The adult alligator grows up to prey upon many of the same species.

Alligators reach breeding maturity at about 6 to 10 years of age, at which time they are about 6 to 7 feet (1.8–2.1 m) long. From then on, growth continues at a slower rate. The oldest males may grow to be 16 feet (4.85 m)[21] long and weigh up to 1,200 pounds (510 kg) during a lifespan of 30 or more years. A recent study by scientists from the Savannah River Ecology Laboratory in South Carolina reveals that up to 70 percent of A. mississippiensis females chose to remain with their partner, often for many years.[22]

Relationships with humans

Human deaths and injuries

Alligators are capable of killing humans, but are generally wary enough not to see them as a potential prey. Alligators are often less aggressive towards humans than large crocodile species, a few of which (mainly the Nile and Saltwater Crocodiles) may prey on humans with some regularity.[23][24] Alligator bites are serious injuries due to the reptile's sheer bite force and risk of infection. Even with medical treatment, an alligator bite may still result in a fatal infection.[25] The alligator's tail is a formidable weapon that can easily knock a person down and break their bones. Alligators are protective parents who will protect their young by attacking anything that comes too close or poses threats to baby alligators.

Since 1948, there have been more than 275 unprovoked attacks on humans in Florida, of which at least 17 resulted in death.[26] There were only nine fatal attacks in the U.S. throughout the 70s, 80s, and 90s, but alligators killed 12 people from 2001 to 2007. In May 2006, alligators killed three Floridians in less than a week.[27]

Alligator wrestling

Several Florida tourist attractions have taken advantage of fears and myths about alligators—as well as the reality of their danger—through a practice known as alligator wrestling. Created in the early 20th century by some members of the Miccosukee and Seminole Tribe of Florida, this tourism tradition continues to the present day.

Endangered species recovery

An albino alligator could survive only in captivity.

Historically, alligators were depleted from many parts of their range as a result of market hunting and loss of habitat, and 30 years ago many people believed their population would never recover. In 1967, the alligator was listed as an endangered species (under a law that preceded the Endangered Species Act of 1973), meaning it was considered in danger of extinction throughout all or a significant portion of its range.

A combined effort by the United States Fish and Wildlife Service, state wildlife agencies in the South, and the creation of large, commercial alligator farms were instrumental in aiding the American alligator's recovery. The Endangered Species Act outlawed alligator hunting, allowing the species to rebound in numbers in many areas where it had been depleted. As the alligator began to make a comeback, states established alligator population monitoring programs and used this information to ensure alligator numbers continued to increase. In 1987, the Fish and Wildlife Service pronounced the American alligator fully recovered and consequently removed the animal from the list of endangered species. The Fish and Wildlife Service still regulates the legal trade in alligator skins and products made from them.

Recently, a population of non-native Burmese Pythons has become established in Everglades National Park. While there have been observed events of predation by Burmese pythons on alligators and vice versa, there is currently no evidence of a net negative effect on alligator populations.[28][29][30]

Alligator farming

Alligator farming is a big and growing industry in Georgia, Florida, Texas and Louisiana. These states produce a combined annual total of some 45,000 alligator hides. Alligator hides bring good prices and hides in the 6 to 7 feet (1.8 to 2.1 m) range have sold for $300 each, though the price can fluctuate considerably from year to year. The market for alligator meat is growing and approximately 300,000 pounds (140,000 kg) of meat is produced annually. According to the Florida Department of Agriculture and Consumer Services, raw alligator meat contains roughly 200 calories (840 kJ) per 3 ounces (85 g) serving size, of which 27 calories (130 kJ) come from fat.[31]

Alligator meat is sometimes used in jambalayas, soups, and stew.

Symbol

Two alligator mascots with their arms wrapped around each other posing for a photo.
Albert and Alberta Gator, the mascots of the University of Florida; the school chose the alligator as mascot 75 years before the state of Florida named it as official state reptile.

The American alligator is the official state reptile of three states: Florida, Louisiana, and Mississippi. In addition, the Gators have titled the University of Florida's teams since 1911. In that year, a printer made a spur-of-the-moment decision to print an alligator emblem on a shipment of the schools football pennants; the mascot stuck, perhaps because the team captain's nickname was Gator.[32]

See also

Notes

  1. ^ Crocodile Specialist Group (1996). Alligator mississippiensis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 24 February 2009.
  2. ^ Alligator Profile (2011).
  3. ^ "Crocodilian Species—American Alligator mississippiensis)". Flmnh.ufl.edu. http://www.flmnh.ufl.edu/cnhc/csp_amis.htm. Retrieved 2008-10-14. 
  4. ^ Woodward, Allan R.; White, John H.; Linda, Stephen B. (1995). "Maximum Size of the Alligator (Alligator mississippiensis)". Journal of Herpetology 29 (4): 507–513. doi:10.2307/1564733. JSTOR 1564733. 
  5. ^ http://nationalzoo.si.edu/Anis highmals/ReptilesAmphibians/Facts/FactSheets/Americanalligator.cfm
  6. ^ [1] (2011).
  7. ^ http://www.thebigzoo.com/Animals/American_Alligator.asp
  8. ^ http://www.jacksonzoo.org/animals/documents/RAmericanAlligator.doc
  9. ^ http://animals.nationalgeographic.com/animals/reptiles/american-alligator/
  10. ^ "Salt Grass Flats—American Alligator". Saltgrassflats.com. http://www.saltgrassflats.com/wildlife/alligator.html. Retrieved 2008-12-02. 
  11. ^ Erickson, Gregory M.; Lappin, A. Kristopher; Vliet, Kent A. (2003). "The ontogeny of bite-force performance in American alligator (Alligator mississippiensis)" (PDF). Journal of Zoology 260 (3): 317–327. doi:10.1017/S0952836903003819. http://www.alligatorfarm.us/images/Research/Erickson%20et%20al.%202003.pdf. 
  12. ^ "White albino alligators". .softpedia.com. http://news.softpedia.com/news/White-albino-alligators-54575.shtml. Retrieved 2008-10-27. 
  13. ^ "American Alligator". Uga.edu. http://www.uga.edu/srelherp/alligators/allmis.htm. Retrieved 2008-12-02. 
  14. ^ a b c Guggisberg, C.A.W. (1972). Crocodiles: Their Natural History, Folklore, and Conservation. Newton Abbot: David & Charles. p. 195. ISBN 0-7153-5272-5. 
  15. ^ Lance, Valentine A. (2003). "Alligator physiology and life history: the importance of temperature". Experimental Gerontology 38 (7): 801–805. doi:10.1016/S0531-5565(03)00112-8. 
  16. ^ "American Alligator". Sciencedaily.com. http://www.sciencedaily.com/articles/a/american_alligator.htm. Retrieved 2008-10-14. 
  17. ^ Dinets, V.L. (2011). "On terrestrial hunting in crocodilians". Herpetological Bulletin 114: 15–18. 
  18. ^ BBC - The Truth about Killer Dinosaurs
  19. ^ Garrick, L.D. and Lang, J.W. (1977). "Social Displays of the American Alligator". American Zoologist 17: 225–239. 
  20. ^ Dinets, V.L. (2010). "Nocturnal behavior of the American Alligator (Alligator mississippiensis) in the wild during the mating season". Herpetological Bulletin 111: 4–11. 
  21. ^ "Animal Planet :: Australia Zoo—American Alligator". Animal.discovery.com. October 13, 2008. http://animal.discovery.com/fansites/crochunter/australiazoo/06amerigator.html. Retrieved 2008-10-14. 
  22. ^ "Alligator Mating (www.macroevolution.net)". http://www.macroevolution.net/alligator-mating.html. Retrieved 2009-10-28. 
  23. ^ [2]
  24. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  25. ^ Harding, Brett E.; Wolf, Barbara C. (2006). "Alligator Attacks in Southwest Florida". Journal of Forensic Sciences 51 (3): 674–677. doi:10.1111/j.1556-4029.2006.00135.x. 
  26. ^ Living with Alligators, Myfwc.com [3] on the Internet Archive
  27. ^ "A String of Deaths by Gators in Florida". nytimes.com. 2006-05-15. http://www.nytimes.com/2006/05/15/us/15alligator.html. Retrieved 2006-05-15. 
  28. ^ Gator-guzzling python comes to messy end. Published 2005-10-05 by Associated Press. Retrieved 2008-03-11.
  29. ^ Butler, Rhett A. (2005-10-05 Python explodes after swallowing 6-foot alligator in Florida Everglades. Mongabay.com. Retrieved 2008-03-11.
  30. ^ United States Department of the Interior, U.S. Geological Survey (2008-02-20). USGS Maps Show Potential Non-Native Python Habitat Along Three U.S. Coasts. www.usgs.gov. Retrieved 2008-03-11.
  31. ^ "Calories in Alligator, Crocodile". Annecollins.com. http://www.annecollins.com/calories/calories-alligator.htm. Retrieved 2008-12-11. 
  32. ^ "History: 1906–1927, early Gainesville". University of Florida. http://www.ufl.edu/history/1906.html. Retrieved February 13, 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Only two species in genus; the other species occurs in southeastern China (King and Burke 1989). Monotypic species. See Densmore and White (1991) for a phylogeny of the Crocodylia based on molecular data.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!