Overview

Brief Summary

Overview

The green anole or Carolina anole (Anolis carolinensis) is common in pet stores where it is sometimes identified as the American chameleon because of its ability to change color from green to brown. It is important to note, though, that these lizards are not actually a type of chameleon. Green anoles are the only anole lizard native to North America, and are found primarily in the southeastern United States, with recent introductions to Hawaii, Guam, and elsewhere. They are very common throughout their distribution, typically found on the sides of buildings, on shrubs or vines, and high in trees. They periodically are also found on the ground. As their name suggests, these lizards are emerald green in color, but can change to brown. Both males and females have a pink throat fan (a.k.a. dewlap), which is used as a means for inter- and intraspecific communication. Their toes are expanded at the tips to accommodate adhesive toe pads, which aid them in climbing smooth surfaces where claws cannot be used. The reproductive season takes place during the months of April through July, when the typically territorial males become even more intensely territorial, attempting to secure exclusive access to groups of females. Female anole lizards can lay one egg each week throughout the four-month breeding cycle. The green anole has been a particularly important organism for study in the scientific community, and has been successfully used as a model system for studying neurological disorders and for studying drug delivery systems and biochemical pathways relevant to human illnesses. They have also been essential for scientific progress in understanding other aspects of physiology and behavior in animals. The Genus Anolis, which includes over 350 recognized species, also serves as a group of major interest for exploring the evolutionary diversification; of particular interest is the repeated convergent pattern of adaptive radiation on islands of the Greater Antilles, producing on each island essentially the same set of habitat specialists adapted to use different parts of the environment.  As a result, in 2005, the scientific community overwhelmingly chose the green anole lizard as its first target species for reptilian genome sequencing. In recent years, populations of A. carolinensis have apparently become less common, although no data are available.  This decline is correlated with massive habitat alteration and the introduction of the brown anole (Anolis sagrei) from Cuba.  Anolis carolinensis is derived from A. porcatus on Cuba, which coexists with A. sagreiOne possibility is that the presence of A. sagrei in Florida has caused A. carolinensis to return to the more arboreal ecological niche occupied by A. porcatus.

Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Interesting Facts

Recent evidence points towards the likelihood that the Anolis carolinensis subgroup is actually derived from a Cuba source population of Anolis porcatus. Most of the diversification of these anoles was likely by overwater dispersal in the late Miocene-Pliocene. Recent accidental introductions of A. porcatus into Florida -- where there are endemic populations of A. carolinensis -- have resulted in a high frequency of hybridization between these two species, suggesting a need to re-examine their classifications.


Reference

  • Glor, RE, Losos, JB, and Larson, A. 2005. Out of Cuba: overwater dispersal and speciation among lizards in the Anolis carolinensis subgroup. Molecular Ecology. 14: 2419-2432.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Succinct Description

A small green lizard commonly found in the southeastern United States on bushes and tree trunks, and frequently sold in the pet trade.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Specimen Information

Specimens can be found at the following locations:

  • University of Texas, Arlington
  • Museum of Natural Science (Louisiana State University)
  • University of Texas, El Paso
  • Chicago Field Museum
  • University of Texas, Austin
  • Museum of Vertebrate Zoology (University of California, Berkeley)
  • Bernice P. Bishop Museum
  • Cornell University Museum of Vertebrates
  • University of Nebraska State Museum
  • James R. Slater Museum (University of Puget Sound)
  • Michigan State University Museum
  • Royal Ontario Museum
  • Illinois Natural History Survey
  • University of Minnesota James F. Bell Museum of Natural History
  • Harvard Museum of Comparative Zoology

References

Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Original Description

Voigt 1832. In Cuvier`s Thierreich,Vol.2: 71
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Range encompasses the southeastern United States: southern and eastern Texas, southeastern Oklahoma, central Arkansas, Tennessee, and North Carolina south to the Rio Grande, Gulf Coast, and Florida Keys, with an isolated record from Tamaulipas, Mexico (Conant and Collins 1991). It has been introduced and is established in the Hawaiian Islands (McKeown 1996), Mariana Islands (disturbed snake-free situations (McCoid 1993, 1994; Wiles and Guerrero 1996; Vogt et al. 2001), and on Anguilla, West Indies (Eaton et al. 2001). Introduced and possibly established on Grand Cayman Islands, West Indies (Powell 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range encompasses the southeastern United States: southern and eastern Texas, southeastern Oklahoma, central Arkansas, Tennessee, and North Carolina south to the Rio Grande, Gulf Coast, and Florida Keys, with an isolated record from Tamaulipas, Mexico (presumably introduced) (Conant and Collins 1991). It has been introduced and is established in the Hawaiian Islands and Midway Atoll (McKeown 1996, Lever, 2003); Guam and the Northern Mariana Islands (McCoid 1993, 1994; Wiles and Guerrero 1996; Vogt et al. 2001; Lever 2003); Palau (Crombie and Pregill 1999, Lever 2003); the Bahamas (Grand Bahama Island) (Lever 2003); Anguilla in the Lesser Antilles (Eaton et al. 2001; Lever 2003); introduced and possibly established on Grand Cayman Islands (Powell 2002); introduced to Japan (southern part of Okinawa-jima Island and the Ogasawara [Bonin] Archipelago) (Lever 2003, Goris and Maeda 2004); and Spain (isolated introductions at Cabo Huertas, Santa Pola, Almuñécar and on Tenerife) (Pleguezuelos et al. 2002, Lever, 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Anolis carolinensis (green anoles) is native to neotropical and nearctic regions. Anolis carolinensis occurs throughout much of the southeastern United States, extending north through parts of North Carolina, west to Texas, and south through Florida. While Florida was once the central portion of its United States distribution, today most Florida populations have been replaced by introduced anole species, such as Anolis sagrei.

In other parts of its geographic range, A. carolinensis is considered an introduced species. It has become abundant in Hawaii since it was discovered in 1950. It also has been introduced and has flourished in the Ogasawara Islands of Japan, and in Cuba, the Bahamas, and Guam. In Guam, however, densities have been impacted drastically by predators, such as introduced brown tree snakes (Boiga irregularis).

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); neotropical (Introduced , Native ); oceanic islands (Introduced )

  • Bishop, D., A. Echternacht. 2004. Emergence behavior and movements of winter-aggregated green anoles Anolis carolinensis and the thermal characteristics of their crevices in Tennessee. Herptologica, 60/2: 168-177.
  • Losos, J. 2009. Lizards in an Evolutionary Tree Ecology and Adaptive Radiation of Anoles. Berkely and Los Angeles, California: University of California Press.
  • Macedonia, J., A. Echternacht, J. Walguarnery. 2003. Color variation, habitat light, and background contrast in Anoils carolinensis along a geographical transect in Florida. Journal of Herpetology, 37/3: 467-478.
  • Mattison, C. 1989. Lizards of the World. New York, New York: Fact on File, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Middle-America Caribbean North-America Asia
Distribution: USA (E Texas, SE Oklahoma, S Arkansas, Louisiana, Mississippi, Alabama, Georgia, Florida, South Carolina, North Carolina, SE Tennessee),  Bahamas, Grand Cayman Islands (HR 33: 321), Anguilla (HR 32: 118), Cuba, Mexico. Introduced to Belize and Hawaii (fide MCKEOWN 1996) Introduced to Japan (Chichizima Is. and Hahazima Is. of Ogasawara Islands.And Okinawazima Is.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Widely-distributed throughout the southeastern United States: North Carolina to Key West, Florida, and west to southest Oklahoma and central Texas. Recent introductions to Hawaii, Guam, and elsewhere.


Reference

  • Conant, Roger & Joseph T. Collins. 1998. A Field Guide to Reptiles and Amphibians, Eastern/Central North America, 3rd edition, Houghton Mifflin Co, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Anolis carolinensis varies in length from 4 to 8 cm. Females typically are smaller in all body size measures, at birth ranging from about 23 to 25 mm long. Both males and females have long tails that account for more than half of their total body lengths. Adult anoles weigh between 2 and 6 g.

Scale colors in green anoles vary. In most cases, these lizards range from shades of brown to green or gray. At times their coloring represents combinations of these colors. Color variation results from layers of pigmented cells called chromatophores. Three types of pigment cells are present: xanthophores, cyanophores, and melanophores, each responsible for different color variations. Green anoles are capable of changing scale color in response to their external environment. Many factors affect color change and variation; most often it is dependent upon temperature and excitation, such as increased activity or competition. Darker brown and black colors, produced by melanophores, typically signal cold or stressed conditions.

Within a population, two different size classes or morphs of adult males may be present: heavyweights and lightweights. These morphs differ in many ways, including bite force, body mass and length, competition, and vertical jump. The heavyweight morph is larger and more dominant. Some authors consider these morphs to be different developmental stages or different age classes among sexually mature males.

Physical differences also are common between males and females. Females often have a line that runs along their dorsal surface, from their neck down to their back, ending before their tail begins. Most males have dewlaps that extend from the ventral side (underneath) of their neck. Dewlaps are rarely seen in females. The dewlap is commonly pinkish in color and thought to be used by males to increase visibility as they court females. Displaying the dewlap may also represent a competitive status between males; in these cases, dewlap displays are usually related to territory boundary disputes. Subspecies Anolis carolinensis seminolus, abundant in southwest Florida, is physically very similar to A. carolinensis carolinensis, but its dewlap is often white or gray.

Range mass: 2 to 6 g.

Range length: 10.16 to 20.32 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; ornamentation

  • Bartlett, R., P. Bartlett. 2009. Guide and Reference to the Crocodilians, Turtles, and Lizards of Eastern and Central North America (North of Mexico). Gainsville, FL: University Press of Florida.
  • Crews, D., N. Greenberg. 1981. Function and causation of social signals in lizards. American Zoologist, 21/1: 273-294.
  • Lailvaux, S., A. Herrel, B. VanHooydonck, J. Meyers, D. Irschick. 2012. Performance capacity, fighting tactics and the evolution of life-stage male morphs in the green anole lizard Anolis carolinensis. Proceedings: Biological Sciences, 271/1556: 2501-2508.
  • Smith, H. 1946. Handbook of Lizards. Ithaca, New York: Comstock Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Male body length, as measured from the tip of the nose to the end of the trunk (i.e., snout–vent length, SVL), is about 15 % greater for males than for females. Adult males range about 50–70 mm SVL, while adult females range about 40–60 mm SVL. Both males and females are typically of a green hue, but can change to brown, with slight indications of patterning in the form of dark streaks or spots. Both the male and female green anoles have a pink throat fan (i.e. dewlap), which can be used during displays. The male dewlap, however is three times that of the female dewlap. Green anoles also have toe pads that are used when climbing up smooth surfaces.


References

  • Conant, R and Collins, J T. 1998. Reptiles and Amphibians, Eastern/Central North America. Houghton Mifflin Co., Boston, 616 pp.
  • The Green Anole (Anolis carolinensis): Account by Thomas A. Jenssen, Department of Biological Sciences, Virginia Tech
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: This mostly arboreal lizard occupies a wide variety of habitats, including upland forests, pine-palmetto scrublands, rocky escarpments, swamps, wooded parks, cleared fields, maritime scrub, and residential lots of coastal towns (Palmer and Braswell 1995, Bartlett and Bartlett 1999, Trauth et al. 2004); commonly it is in edge situations. It climbs on tree trunks, shrubs, vines, and various other plants, and also on fence posts and walls of buildings. It sleeps in vegetation at night. In cold weather, green anoles seek cover but do not go deep underground (Mount 1975). Eggs are buried in moist soil, sphagnum, leaf litter, rotting wood, or under rocks and debris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This mostly arboreal lizard occupies a wide variety of habitats, including upland forests, pine-palmetto scrublands, rocky escarpments, swamps, wooded parks, cleared fields, maritime scrub, and residential lots of coastal towns (Palmer and Braswell 1995, Bartlett and Bartlett 1999, Trauth et al. 2004); commonly it is in edge situations. It climbs on tree trunks, shrubs, vines, and various other plants, and also on fence posts and walls of buildings. It sleeps in vegetation at night. In cold weather, green anoles seek cover but do not go deep underground (Mount 1975). Eggs are buried in moist soil, sphagnum, leaf litter, rotting wood, or under rocks and debris.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anolis carolinensis is a primarily arboreal lizard. Within natural habitats, A. carolinensis is found most often on shaded tree branches. Its positioning within a tree is known as its perch height and is dependent on the proximity of both predators and prey. Limited research has been done on their preferred types or species of trees. Anolis carolinensis appears mostly to inhabit trees and shrubs within their territory and where prey is readily available. They also are frequently observed in tall grasses.

Anolis carolinensis also is one of the most common lizards in urban and suburban areas. It is frequently found near dwellings, particularly on fence posts and the sides of buildings.

Range elevation: 45.73 to 609.76 m.

Average elevation: 327.75 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: coastal

Other Habitat Features: urban ; suburban

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These lizards are very common, and have adapted well to the urbanization of their environment. They are most frequently found high in trees, on fences, around old buildings, on shrubs and vines, and less frequently, on the ground.


References

  • Conant, R and Collins, J T. 1998. Reptiles and Amphibians, Eastern/Central North America. Houghton Mifflin Co., Boston, 616 pp.
  • The Green Anole (Anolis carolinensis): Account by Thomas A. Jenssen, Department of Biological Sciences, Virginia Tech
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats insects, spiders, and other small invertebrates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Green anoles feed on a broad range of prey items. They often will attempt to eat anything smaller than their own head. They are classified as insectivores, eating a wide variety of insects, including beetles and flies, as well as spiders, some arthropods. At times, they also will eat mollusks, grain, and seeds. The importance of a particular prey or food item largely reflects its availability. If an item is abundant within the territory, green anoles are likely to feed on it more frequently.

Green anoles have several methods of capturing prey. Over 58% of the prey is captured by perching and watching or anticipating prey until they are within striking distance. This is considered to be the most effective means of capturing prey. This behavior is predominant during breeding, to conserve energy for mating. Another method of prey capture is used while the anole is protecting and patrolling their territory. In this case, they leap forward to ensure a capture, but use a slower motion. Another common method of prey capture is the ambush, usually used in capturing larger prey items.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: seeds, grains, and nuts

Primary Diet: carnivore (Insectivore )

  • Aborn, D., D. Froehlich. 1995. An observation of a summer tanager attempting to eat an anolis lizard. Journal of Field Ornithology, 66/4: 501-502.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Anolis carolinensis does not have a large ecosystem impact in most geographical ranges. However, their introduction in the Ogasawara Islands of Japan, however, has led to the decline of or extinction of many species, such as the Ogasawara tumbling flower beetle (Glipa ogasawarensis). In other regions, its greatest impact is as a prey species. For example, in Guam, green anoles are so heavily preyed upon by brown tree snakes (Boiga irregularis) that they have been nearly extirpated from the area.

Because A. carolinensis is highly territorial, especially the males, they may prevent certain other species from entering their territory. This potentially prevents certain reproductive variation. A beneficial quality of green anoles is that they consume seeds and grains, potentially aiding in seed dispersal.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Green anoles are preyed upon by a relatively large assortment of predators. Their main predators are snakes and birds, but they also are preyed on by larger reptiles. Brown tree snakes (Boiga irregularis) are particularly common snake predators. This species has eliminated green anoles from portions of Guam. Examples of birds that regularly prey on green anoles are American kestrels (Falco sparverius), pearly-eyed thrashers (Margarops fuscaturs), and lizard cuckoos (Saurothera vieilloti). A larger reptile that preys on green anoles is the curly tailed lizard (Leiocephalus carinatus). Other common predators, particularly in suburban areas, are cats, dogs, and frogs.

To avoid predators, green anoles hide in trees, tall grasses, and other vegetation. They also have developed a structure similar to a patagium that enables them to glide down from tall trees. In addition, green anoles have the ability to walk vertically on surfaces such as trees, walls, and fences using adhesive pads on the bottom of their feet. These provide a means of escape that the majority of their predators do not have.

Green anoles also utilize caudal autotomy and use their dropped tails to distract predators while they escape.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences or subpopulations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: Total adult population size is unknown but surely exceeds 100,000 and may exceed 1,000,000. The species is locally common in many areas (Palmer and Braswell 1995, Bartlett and Bartlett 1999, Trauth et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Population density was estimated at 3906/ha and 280/ha in two areas in Florida without and with syntopic A. DISTICHUS (King 1966).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecological Determinants/Niche

Anole lizards in the Caribbean are highly-speciose and known for repeated instances of ecological and morphological patterning ('ecomorphs'). In other words, lizards frequently found in characteristic habitats all exhibit similar morphological characteristics, which in turn differ from morphological characteristics of lizards commonly found in another habitat. The six primary groupings include: ground, trunk-ground, trunk-crown, twig, grass-bush, and crown giants. Anolis carolinensis is grouped as a trunk-crown anole ecomorph.

Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Anolis carolinensis is equipped with certain communication signals from birth. Most communication involves color variations, actions such as head bobbing or neck biting, or use of the dewlap. The dewlap is used for inter-gender communication, especially during the breeding season. Displaying the dewlap also may be used to determine competitive status between males; in these cases, dewlap displays are usually related to territorial boundary disputes. Head bobbing or courtship bobbing is performed by both males and females to communicate breeding status, but is also done while in a threatened state.

Green anoles that have not yet reached adulthood do display adult signals and behaviors (e.g. head bobbing). However, since they are not sexually mature, these do not function as courtship mechanisms. Interactions between juveniles are similar to those of adult females. They generally are not as serious as those between adult males and usually do not result in injuries. As juveniles mature, their interactions often become more intense. This is mainly due to the development of structural hierarchies for adulthood.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile

  • Miller, W., M. Wolbarsht. 1962. Neural activity in the parietal eye of a lizard. Science, 135/3500: 316-317.
  • Milstead, W. 1965. Lizard Ecology: A Symposium. Columbia, Missouri: University of Missouri Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Less active in cold weather but does not hibernate and can be active on sunny cold days in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

After a female lays her eggs, a five to seven week gestation period is necessary. Green anoles have genotypic sex determination. Once the young hatch from their eggs they resemble adults in coloration and pattern, but are only 23 to 25 mm long. Green anoles have determinate growth; they grow at a relatively constant rate from hatching to adulthood. Hatchlings develop into juvenile males and females without any parental investment. Juvenile males and females have the same resource and survival needs while developing, but competition among juveniles is generally low because resources tend to be plentiful. Since juveniles are not sexually mature, their main activities are associated with foraging, protection against predators, and maintaining adequate body temperatures. Initially, juvenile male and females do not show any sexual differences or display behaviors; however, during later stages of development, testosterone levels become higher in males and are likely to exhibit more aggressive behaviors.

Unlike other Anolis species, such as Anolis aeneus, green anoles do not leave their hatch sites after breeding.

  • Lovern, M., T. Jenssen. 2001. The effects of context, sex, and body size on staged social interactions in juvenile male and female green anoles (Anolis carolinensis). Behaviour, 138/9: 1117-1135.
  • Oliver, J. 1951. "Gliding" in amphibians and reptiles, with a remark on an arboreal adaptation in the lizard, Anolis carolinensis carolinensis Voigt. The American Naturalist, 85/822: 171-176.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

The mating system of Anolis carolinensis fits that of female-defense polygyny (i.e. one male with many females), requiring individual males to defend large territories housing multiple females. To effectively guard multiple females from male intruders, territorial males must consistently advertise their presence with conspicuous displays (100 display/hour) and patrol their large territories with frequent and extensive moves (28 perch shifts/hour and 27 m/hour). In contrast, females are not competing with other females for mates; instead they are lightly guarding small home ranges in habitat that is abundant in food and shelter. Therefore, females seldom display (12 times/hour) and do not move often (6 perch shifts/hour) or far (4 m/hour). During the breeding season, these lizards become particularly noticeable as the territorial males actively claim their domains with head bobs and extension of their bright pink throat fan or dewlap. The intense inter-male competition, often between large adult males and smaller, younger males, is not only expressed in frequent aggressive signaling, but can occasionally lead to fights over clumps of habitat that contain females.

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Green anoles have a lifespan ranging from 2 to 8 years, determined largely by predation. Lifespan in captivity is similar to that in the wild, approximately 4 to 6 years, and dependent on proper care and conditions. Longevity also is greatly dependent upon proper nutrition. Smaller, slower, green anoles potentially have greater difficulty obtaining necessary nutrients than larger individuals, especially if engaged in competition. Larger green anoles under ideal natural conditions have been known to live up to 10 years.

Range lifespan

Status: wild:
<1 to 10 years.

Average lifespan

Status: wild:
5.5 years.

Range lifespan

Status: captivity:
1.5 to 7 years.

Typical lifespan

Status: wild:
2 to 8 years.

Typical lifespan

Status: captivity:
2 to 7 years.

  • Dirickson, W. 1976. Ecology and physiological aspects of reproductive strategies in two lizards. Ecology, 57/3: 445-458.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 7.2 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Courtship has been observed late March-early August in Louisiana (Ruby 1984). Lays single egg at intervals of about 3 weeks (small females) or 5-14 days (large females) (Andrews 1985); April-September. Eggs hatch in 5-7 weeks. Sexually mature in first year (Fitch 1970). See Michaud and Echternacht (1995, J. Herpetol. 29:86-97) for information on geographic variation in some reproductive characteristics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The majority of green anoles are polygynous. Especially in larger populations, they usually will mate only within their own territories. Females are not characteristically known to search for different mates. In cases when a female mates with a different male, it is usually due to intrusion into her territory.

Green anoles breed roughly four to five months out of the year, usually from April through August. Warmer months have the highest reproduction rate, because higher temperatures increase the size of male and female sexual structures (testes and ovaries). Ovulation cycle for female green anoles lasts approximately two weeks, which creates the intervals in which they mate.

The sexual display behavior of green anoles is very specific. Members of almost every mating pair live within each others territory. To attract the attention of females, males bob their heads up and down and extend their dewlaps. Not all females are receptive to male courtship; some deny them and others exhibit the same behavior as males but then arch their neck to inform the males they are receptive to mating. The male then approaches the female and bites the back of her neck, a distinctive behavior of green anoles. The male stabilizes himself by positioning his tail beneath the female’s body and then mounts her back. The male’s himepenes are at the base of his tail. Once in position, he will insert these into the female’s cloaca. Mating typically lasts only a few minutes.

Males protect their mating partners from other intruding males by defending their territory. At times, males have been found to deny receptive females due to their focus on territorial protection. Females also show protective behavior by mating primarily in sheltered areas and closed terrain, reducing vulnerability to predators. Unlike other Anolis species, such as Anolis aeneus, green anoles do not leave their hatch sites after breeding.

Mating System: polygynous

Breeding period for A. carolinensis occurs during warmer months, generally April through August. The breeding intervals are based on the female reproductive cycle, as they are only receptive to mating during their ovulatory cycle. The male is the main initiator of reproductive interactions and presents a strong display of attraction. This typically promotes a reproductive state in the female, similar to that of Anolis aeneus. Depending on how many ovulatory cycles a female has within a breeding season, she will lay six to nine eggs in a year. On average, she will lay a one to two egg clutch every two weeks. The male’s opportunities for mating correlates with the number of ovulation cycles a female has and the total number of potential mates within his territory range.

Two types of sexual selection occur during the mating season: intersexual and intrasexual selection. The larger a territory range a male has, the more females he is likely to mate with. A territory size usually relates to a male green anoles body size; the larger he is the more dominant he will be towards intruders and predators as he protects his territory.

Female green anoles have the ability to store sperm; this may be a trait of intersexual selection. Sperm has been found within a female seven months after mating, which may make delayed fertilization possible. Prior to releasing her clutch, the female will examine an appropriate area and then dig into the soil. Females prefer to release their eggs into moist soil. Eggs are oval and on average 6 by 4.5 mm. The gestation period varies, but is approximately five to seven weeks long. Hatchling anoles weigh 0.27 g each. Juvenile anoles are sexually mature at 8 to 9 months old.

Breeding interval: Green anoles breed in two week intervals throughout the spring to summer months.

Breeding season: Green anoles breed 4 to 5 months out of the year, usually April through August.

Range number of offspring: 6 to 9.

Range gestation period: 5 to 7 weeks.

Average birth mass: 0.27 g.

Range age at sexual or reproductive maturity (female): 8 to 9 months.

Range age at sexual or reproductive maturity (male): 8 to 9 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous ; sperm-storing ; delayed fertilization

After ovulation, fertilization, and egg laying, no parental investment is known to occur.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Losos, J. 2009. Lizards in an Evolutionary Tree Ecology and Adaptive Radiation of Anoles. Berkely and Los Angeles, California: University of California Press.
  • Lovern, M. 2000. Behavioral ontogeny in free-ranging juvenile male and female green anoles, Anolis carolinensis, in relation to sexual selection. Journal of Herpetology, 34/2: 274-281.
  • Orrell, K., J. Congdon, T. Jenssen, R. Michener, T. Kunz. 2004. Intersexual differences in energy expenditure of Anolis carolinensis lizards during breeding and postbreeding seasons. Physiological and Biochemical Zoology, 77/1: 50-64.
  • Ruby, D. 1984. Male breeding success and differential access to females in Anolis carolinensis. Herpetologica, 40/3: 272-280.
  • Smith, H. 1946. Handbook of Lizards. Ithaca, New York: Comstock Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction and Life History

Green anoles breed anywhere from early April through July, when gonads are fully recrudesced and levels of sex steroids and behavior are maximal. Males defend large territories that overlap with several smaller female territories, and which they defend vigorously to maintain exclusive access. The social structure of these lizards is therefore polygynous. The number of females in a given male's territory is tightly correlated with male body size: the larger the male, the more female territories his territory will likely encompass. Unlike males, which establish territories to gain access to the most females, females appear to establish their territories with respect to resource availability. Females will also mate with more than one male if they are available and manage to enter the resident male's territory undetected. Unlike most kinds of lizards that lay one large clutch of eggs per year, anoline lizards lay a series of single-egg clutches. An A. carolinensis female will lay an egg about every week (4–7 days) during the 4-month breeding season. This means that a female may lay a total of 15–18 eggs for the summer. For each weekly clutch, a female first becomes sexually receptive, and will move to where the resident male can see her. The resident female signals that she is receptive by bending her neck when a male approaches, so that he might take a neck hold. During these encounters, which are fairly brief (1–2 minutes), the male will decide whether he wants to copulate. About 70% of the time he does not take a neck hold, and will move off. When copulation does occur, the male and female will be occupied for 30–60 minutes. Females can store sperm and, should the territorial male disappear and no new male replace him, a female can continue to lay fertile eggs for the rest of the breeding season. Eggs are deposited in a shallow hollow in the soil or mulch, which is then covered until hatching 6-8 weeks later. No parental care is provided to the young. Young feed voraciously on small insects and other invertebrates, and will typically survive one to two additional breeding seasons, although they are known to survive longer in captivity.


References

  • The Green Anole (Anolis carolinensis): Account by Thomas A. Jenssen, Department of Biological Sciences, Virginia Tech
  • Lovern, MB, Holmes, MM, and Wade, J. 2004. The green anole (Anolis carolinensis): A reptilian model for laboratory studies of reproductive morphology and behavior. ILAR Journal. 45(1): 54-64.
Creative Commons Attribution 3.0 (CC BY 3.0)

Thomas A. Jennsen

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Fossil History

Paleontology

The first occurrence of Anolis lizards in the fossil record in North America is during the Miocene (about 23-5 million years before present [ybp]). Fossils of Anolis carolinensis, the only native North American species, are predominantly from the Pleistocene epoch (about 1.8 million to 11,550 ybp), and are found primarily in the Appalachian region and southeastern United States. Fossils of A. carolinensis are found in most sites in Florida, although they also have been uncovered in a couple sites in Georgia. Specific localities include: (1) Kingston Saltpeter Cave in northwestern Georgia. It is believed that most of the herpetofaunal bones accumulated from the activity of raptors. Most material have been dated to approximately 10,300 ybp, from the very late Wisconsinan. (2) Ladds Quarry Site, also in northwestern Georgia, dates to approximately 10,290-10,940 ybp. (3) Reddick I Site in north-central Florida, likely Rancholabrean representing the Sangamonian Age. Most of the material here are likely the remains of pellets cast by barn owls. (4) Williston IIIA Site in north-central Florida is from the same age range as the Reddick I Site. (5) Arredondo Site in north-central Florida is a sinkhole and fissue fill complex. It is a little younger in age, ranging from Sangamonian to Wisconsinan. (6) Haile (Rancholabrean) Site in north-central Florida. Most fossils are found in sinkholes and fissues of the same approximate age as the Arredondo Site. (7) Devil's Den Chamber 3 in north-central Florida represents a sinkhole trap or cenote where vertebrates accumulated in large numbers in the late Wisconsinan (about 10,000 ybp) to present. (8) Sabertooth Cave in northwestern, peninsular Florida contains material which is thought to represent a very narrow window of time (likely very late Wisconsinan), since all deposits are found in a concentrated stratigraphic zone. (9) Ichetucknee River Site is in the far north, central part of the Florida peninsula.


References

  • Holman, J A. 1995. Pleistocene Amphibians and Reptiles in North America. Oxford University Press, New York 243 pp.
  • Auffenberg, W. 1956. Additional records of Pleistocene lizards from Florida. Journal of the Florida Academy of Sciences. 19:157-167.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Systematics or Phylogenetics

Concepts and Synonymy

Creative Commons Attribution 3.0 (CC BY 3.0)

The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Classification

Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

Physiology and Biochemistry

(Excerpt from the proposal submitted for sequencing the green anole genome.)

The green anole has been used successfully as a model for the tic-like repetitive behaviors seen in human obsessive-compulsive disorder (OCD) and Tourette’s syndrome. A homologous cortico/limbic-basal ganglia-thalamic system is involved in Anolis displays (Baxter et al. 2001). Moreover, 5-HT functions in anoles in a manner similar to that seen in humans with OCD both in terms of the circuits activated by 5-HT drugs that affect OCD and in symptomatic responses seen to such administrations (Clark & Baxter 2000; Baxter et al. 2001). Further, compared to rodents, Anolis possesses 5-HT and dopamine (DA) receptors that demonstrate a pharmacological binding profile much more like that found in primates; for this reason, anoles may be a model of choice for drug studies relevant to these human illnesses (Clark & Baxter 2000; Clark et al. 2000; Baxter et al. 2001). With regard to the similarity in dopamine receptors, clearly the potential exists to use Anolis in drug models of Parkinson’s and related diseases. For example, a type of drug-induced Parkinson's disorder usually studied in primates, can also be studied by systemic drug administration in anoles (Greenberg et al. 1989); this could be better exploited by lesioning one hemisphere via local injection and leaving the other as the control. Such experiments have been done with monkeys, but the lack of a split brain has led to problems in the interpretation of results.


References

  • Baxter, L.R. 2001. Brain mediation of Anolis social dominance displays: III. Differential forebrain 3H-Sumatriptan binding in dominant vs. submissive males. Brain, Behavior and Evolution, 57:202-213.
  • Baxter, L.R., E.C. Clark, R.F. Ackermann, G. Lacan and W.P. Melega. 2001. Brain mediation of Anolis social dominance displays: II. Differential forebrain serotonin turnover, and effects of specific 5-HT Receptor Agonists. Brain, Behavior and Evolution 57:185-201.
  • Clark, E.C. and L.R. Baxter. 2000. Mammal- like striatal functions in Anolis. I. Distribution of serotonin receptor subtypes, and absence of striosome and matrix organization. Brain, Behavior and Evolution 56:235-248.
  • Clark, E.C., L.R. Baxter, L.S. Dure, R.F. Ackermann, G.F. Kemp and S.E. Bachus. 2000. Mammal-like striatal functions in Anolis. II. Distribution of dopamine D-1 & D-2 receptors, and a laminar pattern of basal ganglia sub-systems. Brain, Behavior and Evolution 56:249-258.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anolis carolinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTTTCTTAATCGTTGACTTTTTTCAACTAACCATAAAGATATCGGCACCCTCTACCTAATTTTTGGTGCCTGGGCCGGCATAGTCGGCACCGCCCTTAGCCTCCTTATTCGGGCGGAACTAAGCCAGCCGGGGGCTTTGCTTGGGGACGACCAAATTTATAACGTCATTGTTACAGCCCACGCTTTTGTGATAATCTTTTTTATGGTTATGCCTGTTATAATTGGGGGCTTTGGTAACTGACTAGTACCATTAATGATTGGGGCCCCGGACATAGCATTTCCACGAATAAATAACATGAGCTTTTGACTACTACCGCCATCATTTCTTCTTCTTCTTGCATCTTCCGGAGTTGAAGCCGGAGCCGGTACCGGATGAACAGTGTACCCACCACTAGCAAGCAACCTCGCACATGCCGGAGCCTCAGTAGACCTAACTATTTTTTCTTTACACCTAGCAGGCGTTTCATCTATTTTAGGCGCTATTAATTTTATTACCACATGTATTAACATAAAACCTTCCACCATAACCCAGTACCAAACACCATTATTCGTTTGATCAGTTTTAATTACAGCCGTACTTCTTCTTCTTTCTCTGCCTGTCCTGGCTGCCGGAATTACTATACTTTTGACAGATCGTAATCTAAACACATCATTTTTTGACCCTGCCGGAGGAGGAGACCCAGTGCTTTATCAGCACCTTTTTTGATTTTTTGGGCATCCCGAGGTTTATATTTTAATCTTACCAGGCTTTGGAATAATTTCCCACATTGTGACATATTATGCCGGTAAAAAAGAGCCGTTTGGCTATATGGGCATGGTGTGGGCAATAATATCAATTGGTTTTCTAGGCTTTATCGTTTGAGCCCACCACATGTTTACAGTTGGAATAGACGTAGATACTCGAGCATATTTTACATCCGCCACAATAATTATCGCAATTCCAACAGGGGTTAAAGTATTCAGCTGATTAGCAACGCTTCATGGAGGAATAATTAAATGAGACGCAGCAATATTATGGGCGCTTGGCTTTATTTTTTTATTCACAGTGGGCGGACTTACCGGCATTGTTCTAGCTAATTCATCCCTAGACATTGTTTTACATGATACTTATTATGTTGTAGCCCATTTCCACTATGTCTTATCAATAGGGGCCGTGTTTGCCATTATGGGCGGATTTGTTCACTGATTTCCACTATTTTCAGGGTTTTCTCTTCACCAAGCATGAACAAAGGCCCAGTTTGGAGTAATATTTGCAGGAGTAAACTTAACATTCTTTCCACAACACTTCCTAGGGCTAGCCGGAATACCACGACGCTATTCTGATTACCCAGATGCCTACACCCTATGAAATGCAATCTCCTCAATTGGGTCCTTAATCTCCCTGGTAGCTGTAATTATGATAATATTTATTATTTGAGAAGCTTTTGCATCTAAACGTGAAATCTGCTCATTAGAACTAGCAAGTACAAACTTAGAGTGATTACACGGATGCCCTCCCCCCTACCACACATATGAAGAACCAACCTTTGTTCAACCTTCAAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anolis carolinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

In July 2005, the scientific community overwhelmingly chose the green anole lizard, Anolis carolinensis, as its first target species for reptilian genome sequencing, with the American alligator, garter snake and/or painted turtle to follow (http://www.reptilegenome.org).
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

These lizards are native to the US, but have been introduced to many other places, including Hawaii, Guam, islands near Japan, and some Caribbean islands.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Frost, D.R. & Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of the large and apparently relatively stable extent of occurrence, area of occupancy, number of subpopulations, and population size. No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anolis carolinensis is currently considered to be at lower risk or of least concern and is not vulnerable to any major threats at this time. Some researchers believe that they may be at risk due to the significant numbers in the pet trade. However, in recent years, sales of green anoles have declined due to lesser demand. Also, green anoles appear abundant in the portions of their range from which they are collected and many populations occur in protected areas, such as parks and natural areas, which helps to protect the population.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupnacy, number of subpopulations, and population size are large and apparently relatively stable, though declines have occurred in Florida.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences or subpopulations. The total adult population size is unknown but surely exceeds 100,000 and may exceed 1,000,000. The species is locally common in many areas (Palmer and Braswell 1995, Bartlett and Bartlett 1999, Trauth et al. 2004). The extent of occurrence, area of occupancy, number of subpopulations, and population size are large and apparently relatively stable, though declines have occurred in Florida.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: In Florida, appears to be disappearing where the introduced brown anole has become established (Ashton and Ashton 1991). This factor, competition with and predation by other non-native anoles, and human-caused habitat degradation have caused declines in central and southern Florida (Bartlett and Bartlett 1999). An introduced population in Guam is restricted by predation by the introduced brown tree snake (McCoid 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
In Florida, appears to be disappearing where the introduced brown anole has become established (Ashton and Ashton 1991). This factor, competition with and predation by other non-native anoles, and human-caused habitat degradation have caused declines in central and southern Florida (Bartlett and Bartlett 1999). An introduced population in Guam is restricted by predation by the introduced brown tree snake (McCoid 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Domestication

Often sold in petstores as a misnamed "chameleon" because of its ability to change between green and brown colours.


Reference

  • Conant, Roger & Joseph T. Collins. 1998. A Field Guide to Reptiles and Amphibians, Eastern/Central North America, 3rd edition, Houghton Mifflin Co, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: This lizard occurs in many protected areas (parks, natural areas, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
This lizard occurs in many protected areas (parks, natural areas, etc.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Anolis carolinensis on humans. Anolis carolinensis is a relatively harmless reptile. It is not aggressive toward humans, and its bite force is most likely insufficient to damage human skin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

One of the best known positive economic factors involving green anoles are their presence in the pet trade. Green anole are sold in many pet stores in the United States. They also are exported for profit. In addition, lizards collected within the United States are sold to zoos and for educational programs. Green anoles also have been studied to better understand animal behavior.

Green anoles also are sometimes considered beneficial pest controllers, because they feed on pest species such as spiders, moths, and crickets.

Positive Impacts: pet trade ; research and education; controls pest population

  • Rohrilich, S., R. Rubin. 1975. Biochemical characterization of crystals from the derman iridophores of a chamelean Anolis carolinensis. The Journal of Cell Biology, 66/3: 635-645.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Carolina anole

Male anole (Green form)
Detail of head, green
Female anole (Brown form)
Detail of head, brown
Female anole (brown) displaying dewlap

The Carolina anole (Anolis carolinensis) is an arboreal lizard found primarily in the southeastern United States and some Caribbean islands. Other common names include the green anole, American anole and red-throated anole. It is also sometimes referred to as the American chameleon due to its ability to change color from several brown hues to bright green.

Description[edit]

The Carolina anole is a small to medium sized lizard, with a slender body. The head is long and pointed with ridges between the eyes and nostrils, and smaller ones on the top of the head. The toes have adhesive pads to facilitate climbing. They exhibit sexual dimorphism, the males being fifteen percent larger. The male dewlap (throat fan) is three times the size of the female's and red, whereas that of the female is white.[3]

Adult males are usually 12.5–20.3 cm (4.9–8.0 in) long, with about 60-70% of which is made up of its tail, with a body length up to 7.5 cm (3.0 in) and can weigh from 3–7 g (0.11–0.25 oz).[3][4][5][6]

Coloration and color morphs[edit]

Contrasting colours

Colour varies from brown to green and can be changed like many other kinds of lizards, but anoles are closely related to iguanas[7] and are not true chameleons. Although A. carolinensis is sometimes called an 'American chameleon', true chameleons do not occur in the Americas, and A. carolinensis is the only lizard in its area of distribution capable of changing colour. In contrast, many species of true chameleons display a greater range of colour adaptation, though some can hardly change colour at all.[3][8]

The typical coloration for a green anole ranges from the richest and brightest of greens to the darkest of browns, with little variation in between. The color spectrum is a result of three layers of pigment cells or chromatophores: the xanthophores, responsible for the yellow pigmentation; cyanophores, responsible for the blue pigmentation, and melanophores, responsible for the brown and black pigmentation when the background is other than green and the anole changes color to camouflage itself. In bright light, against foliage, it appears emerald in colour, but in shadier, cool or moist conditions grey to olive brown. However the colour change is not simply a matter of matching background, but rather body temperature, stress and activity. Green reflects activity and bright light, whereas brown reflects reeduced activity in moist, dark cool conditions.[3][8]

A lack in one of the pigment genes causes color exceptions. These color mutations are also called phases. The rare blue-phased green anole lacks xanthophores, which results in a blue, rather than red, often pastel blue, anole. These specimens have become popular recently in the pet trade market. When the anole is completely lacking xanthophores, it is said to be axanthic and the animal will have a completely pastel- or baby-blue hue. They are extremely rare—usually produced in one of every 20,000 individual anoles in the wild. Another phase is the yellow-phased green anole, which lacks cyanophores. Colonies of these rare color-phased anoles have been reported, but anoles with these color mutations rarely live for long, since the green color provides camouflage for hunting down prey, as well as hiding from predators.

Taxonomy[edit]

Anolis carolinensis is a species of the large Anolis genus of lizards within the Dactyloidae family (anole lizards). Within the genus, thirteen species have been identified as a distinct clade, referred to as the Anolis carolinensis series of anoles. This group are mid-sized trunk crown anoles large, conspicuously elongated heads and extreme levels of sexual dimorphism. The species was named by Friedrich Siegmund Voigt (1781 - 1850) in 1832.[2]

Two subspecies are accepted, Anolis carolinensis carolinensis and Anolis carolinensis seminolus, found in the northern and southern reaches of the species distribution respectively, and hence are also known as the Northern and Southern Green Anoles.

Distribution and habitat[edit]

This species is native to North America, where it is found mainly in the southeastern parts of the continent. Anoles are most abundant on the Atlantic Coastal Plains in North Carolina, South Carolina, Georgia and Florida, and on the Gulf Coast in Alabama, Mississippi, Louisiana, and Texas and have been found as far north as southern Tennessee and southeastern Virginia. In the Carolinas they are found in the coastal plains and southern piedmont of North Carolina, but throughout South Carolina,[8] while in Georgia they are widespread except in the Blue Ridge region.[3]

The species has been introduced into Hawaii and the Ogasawara Islands. In 2012, they were sighted in the San Diego region of southern California.[9]

A. carolinensis is arboreal in nature but may be seen on the ground and frequently seen on shrubs in the low country of the Carolinas, but is also a common sight in urban areas on steps and railings, adjacent to foliage. It is common on roadsides, the edges of forests where there are shrubs and vines, but also building sites having abundant foliage and sunlight. Their preferred habitat is moist forests, and brushy clearings.[3][8]

Conservation[edit]

Carolina-anole males that encounter rival males frequently find it is an introduced and invasive brown anole (Anolis sagrei). When browns first appeared in the United States in the early 1900s,[10] the Carolinas ceded their ground-level territories and were relegated to a very different ecosystem high in the treetops. On occasion, a more aggressive Carolina anole may be seen closer to the ground and in competition with the brown anoles.

Currently A. carolinensis is abundant in its area of distribution, and is able to thrive in disturbed areas, so is not considered threatened, but the brown anole represents a theoretical threat in the future.[3]

Behavior[edit]

Carolina anoles fighting
Anole displaying at its reflection
Carolina anole licking

Male anoles are strongly territorial creatures. Some have even been witnessed fighting their own reflections in mirrored glass. The male will fight other males to defend his territory.[11] On sighting another male, the anole will compress his body, extend the dewlap, bob his head and attempt to chase the rival away. If the rival male continues to approach, anoles will fight. Their territory, which is about 1 m3 (35 cu ft), usually includes two to three females.[3][8]

Anoles display curiosity. A healthy lizard usually has a good awareness of its surroundings.Stress in an anole can be identified by several symptoms, which include chronic lethargy and persistent black semicircles behind its eyes.

The Carolinian anole is diurnal and active throughout the year, peaking in spring and fall. Winter activity is dependent on sun and temperature.[3]

Diet[edit]

Carolina anole eating a moth

The anole's diet consists of small insects such as crickets, grasshoppers, spiders, and other arthropods.[3][8] it also eats grasses. Many people who keep these lizards as pets feed them mealworms, grubs, and maggots.

Predators[edit]

Major predators include the broadhead skink, snakes and birds. Like many lizards, anoles display autotomic tails, which when broken off, continue to move. This hopefully distracts the predator and helps the anole to escape. A new tail then starts to develop[3]

Reproduction[edit]

Male anole with extended dewlap
Carolina anoles mating

The typical breeding season for green anoles starts as early as April and ends in late September, gonadal activity being largely regulated by photoperiod, enlarging in spring as the weather warms up and days lengthen, and then regressing in late summer.[3][8]

During this time, the males patrol their territory and most brilliant displays of these creatures can be seen, as the males defernd their territory and females, while courting the females with their elaborate displays of extending their brightly colored dewlaps while bobbing up and down, almost doing a dance. The dewlap is also used to ward off other males. The male courts and pursues a female until the two successfully mate. Usually, when the female is ready to mate, she may let the male simply "catch" her and he will thus grasp a fold of her skin above her neck area, or she will bow her head before him and simply "let" him take his grasp. At this point, the male will position his tail underneath the female's near her vent and mating will take place.[3]

The female matures one ovarian follicle at a time, the ovaries alternating in production. The sight of a courting male induces ovarian development, sexual receptiveness and then ovulation. About two to four weeks following mating, the female lays her first clutch of eggs, usually one or two in the first clutch. She can produce an egg every two weeks during trhe breeding season, until about 10 eggs have been produced. Hoever she can store sperm for up to eight months following mating. She then buries the soft shelled eggs in a shallow depression in soft soil, leaf litter, compost, rotting wood or even a hole in a nearby tree. Eggs average 12.5 mm (0.49 in) by 9.3 mm (0.37 in) in size.[3]

The eggs are left to incubate by the heat of the sun, and if successful, will hatch in about five to seven weeks (30–45 days) from late May to early October. On hatching, the hatchlings are 52–67 mm (2.0–2.6 in) in length.[3][8]

The hatchlings must fend for themselves; anoles are by nature solitary animals since birth, and are not cared for by either parent. The young hatchlings must be wary of other adult anoles in the area, as well as larger reptiles and mammals, which could eat them. Younger anoles differ from adults in having less obvious head ridges, a wider head and shorter tail. They mature in about eight months.[3]

Juvenile male

Genomics[edit]

This species has been chosen as a model reptile for genomics by the National Human Genome Research Institute genome sequencing program.[12] It was selected because of the ease and low cost of laboratory breeding and evolutionary value of the diversity of the genus.[13] In 2011, the complete genome of this lizard was sequenced and published in Nature.[14] Before its genome was published, only mammals and three bird species had been sequenced among amniotes.[15] The draft genome sequence is 1.78 Gb (compared with 2.0–3.6 Gb mammalian and 0.9–1.3 Gb avian genome assemblies), of which 27% are mobile elements such as LINEs. A total of 17,472 protein-coding genes and 2,924 RNA genes were predicted from the A. carolinensis genome assembly.[16]

References[edit]

  1. ^ Chelydra serpentina, IUCN
  2. ^ a b Voigt F.S. 1832: In Cuvier`s Das Thierreich, geordnet nach seiner Organisation: als Grundlage der Naturgeschichte der Thiere und Einleitung in die vergleichende Anatomie, Vol. 2: 71.
  3. ^ a b c d e f g h i j k l m n o p John B. Jensen. Amphibians and Reptiles of Georgia.University of Georgia Press, 2008. Green Anole p. 296. ISBN 0820331112
  4. ^ Savannah River Ecology Laboratory
  5. ^ Animal Diversity Web, p. 1
  6. ^ Animal Diversity Web, p. 2
  7. ^ NCBI Taxonomy Browser
  8. ^ a b c d e f g h Amphibians and Reptiles of the Carolinas and Virginia. Bernard S. Martof, Julian R. Harrison, III, William M. Palmer, Joseph R. Bailey. University of North Carolina Press, 1989. ISBN 0807842524
  9. ^ Gary Nafis (2013). "Non-Native Reptiles and Amphibians Established In California". CaliforniaHerps.com. Retrieved 2013-02-01. 
  10. ^ Daniel F. Culbert, County Extension Agent (2002). "LEAPIN’ LIZARDS". University of Florida IFAS extention. Retrieved 2014-05-09. 
  11. ^ Sezen, Uzay. "Territorial aggression between two green anole males". Retrieved 16 July 2011. 
  12. ^ "NHGRI's Large-Scale Sequencing Research Network Sets Its Sights on Disease Targets" (Press release). NIH News. 2005-10-17. 
  13. ^ Ad hoc Reptilian Genomics Working Group (2005-07-11). "Proposal to Sequence the First Reptilian Genome: the Green Anole Lizard, Anolis carolinensis" (PDF). National Human Genome Research Institute. Retrieved 2010-05-05. 
  14. ^ Sezen, Uzay. "Carolina anole changing color". Retrieved 16 May 2011. 
  15. ^ Sweetlove L (31 Aug 2011). "Lizard genome unveiled". Nature. doi:10.1038/news.2011.512. 
  16. ^ Alföldi J, Di Palma F, Grabherr M, Williams C, Kong L et al. (2011). The genome of the green anole lizard and a comparative analysis with birds and mammals 477 (7366). doi:10.1038/nature10390. PMC 3184186. PMID 21881562. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

References and More Information

People

Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Editor's Links

Creative Commons Attribution 3.0 (CC BY 3.0)

S. Tonia Hsieh

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Guyer and Savage (1986) divided the long-standing genus Anolis into multiple genera based on a reanalysis of some published data sets. Schwartz and Henderson (1988) adopted this classification, but Williams (1989) found serious errors and confusions in the reanalysis and vigorously rejected the multi-genus classification, as did Cannatella and de Queiroz (1989). Guyer and Savage (1992) presented further justification for their multi-genus classification. Jackman et al. (1999) examined mtDNA variation and concluded that Phenacosaurus, Chamaelinorops, and Chamaeleolis are all nested within Anolis therefore all should be synonymized with Anolis .

See Burnell and Hedges (1990) for an electrophoretic analysis of relationships of West Indian Anolis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!