Overview

Distribution

Range Description

Apalone ferox occurs from southern South Carolina (vicinity of Charleston) through eastern and southern Georgia, southeastern Alabama and essentially all of Florida (Iverson 1992, Meylan and Moler 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Apalone ferox is found only in the southeastern United States, from southern South Carolina west to Mobile Bay, Alabama, and south through the Florida peninsula. It is apparently not found in the Florida Keys, with the exception of a colony on Big Pine Key, where it was possibly introduced. Apalone ferox can be common over much of its range and sometimes thrives in urbanized areas.

Biogeographic Regions: nearctic (Native )

  • Pritchard, P. 1979. Encyclopedia of Turtles. New Jersey: T. F. H. Publications, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern South Carolina to southern Florida, west to southern Alabama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: North-America
Distribution: USA (SW South Carolina, S Georgia, Florida, S Alabama)  
Type locality: Savannah River (at Savannah), Georgia
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Florida softshell turtles have bumpy, leathery, oblong carapaces with dark brown to olive green colors and a gray to white plastron. Both the carapace and plastron lack scutes. The carapace has longitudinal rows of indentations and raised areas on the dorsal surface. On the thickened edge of the anterior portion of the carapace there is a series of wide, short tubercles in a crescent shape. Short tubercles also cover the sides of the forelimbs. Carapace tubercles on Florida softshell turtles are flattened hemispheres instead of the cone-shaped projections seen in the sympatric Gulf Coast Softshell, Apalone spinifera aspera. Bones underlying the plastron can sometimes be seen through the leathery skin covering. The carapace occasionally has faint irregular blotches left over from the juvenile pattern. A yellow to red stripe sometimes is present from each eye to the base of the lower jaw. The tubular, pig-like nose is truncated with each nostril having a lateral ridge projecting from the nasal septum. All four feet are webbed; webbing extends up the shank of the hind legs. This species is bulky and the largest of all New World trionychids. Sexual dimorphism is marked, with females much larger than males. Adult females are usually between 28 and 63 centimeters in carapace length (record 73.6 cm), with short tails that barely extend beyond the carapace rim. Males are usually between 15 and 33 centimeters in carapace length, with long, thick tails with the anal vent well beyond the carapace rim.

Juveniles have more contrasting color patterns than adults. The carapace is olive, tan, or light brown with darker brown or black spots and a yellow marginal rim. The plastron is dark purplish gray to black. The snout and neck are marked with yellow or orange stripes. The snout is marked with a Y shaped figure on the anterior edge, reaching from each eye down the middle of the nose.

Range mass: 43.6 (high) kg.

Range length: 15 to 73.6 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 50 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Apalone ferox inhabits a wide variety of permanent freshwater bodies, as well as some occurrence in ephemeral waterbodies and brackish situations. Shallow vegetated lake and marsh areas with deeper canals and at least localized sandy banks represent optimal habitat (Meylan and Moler 2006).

Apalone ferox are primarily carnivorous, feeding on snails, insects, fish, crayfish, and occasionally clams and tetrapod vertebrates; part of this may represent scavenging.

Significant nest predators include foxes, raccoons, skunks and fish crows, while hatchlings and juveniles may be consumed by raptors and various other predators. Adults are very occasionally taken by alligators (Meylan and Moler 2006).

Female A. ferox can reach over 70 cm carapace length (CL) and well over 20 kg (record 43.5 kg - Pritchard 2001).

Females reach sexual maturity between 25 and 40 cm CL, at an unknown age. Average size of nesting females in a Pinellas Co. population was 50 cm CL and 10.3 kg (Heinrich and Boykin, in Meylan and Moler 2006)

Males reach sexual maturity between 15 and 21 cm CL, at about 0.7 kg, at an unknown age (Meylan and Moler 2006).

Most but not all females reproduce annually, while some females may produce up to seven clutches per year (Iverson and Moler 1997). Clutch size is correlated to female size, averaging 18 to 39 eggs per clutch, with the very largest females producing over 225 eggs per year. Hatchlings measure on average 41 mm CL (range 36-44 mm) at a weight of 9.7 (range 8-11) g (Meylan and Moler 2006).


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Florida softshell turtles are highly aquatic and are found in freshwater ponds, lakes, swamps, marshes, and sometimes drainage ditches. They are generally found in water bodies with muddy or sandy bottoms. Occasionally they are found in brackish waters near the mouths of streams. They can also be found in the quieter portions of rivers and streams and may sometimes occur sympatrically with spiny softshell turtles, Apalone spinifera. However Apalone spinifera prefers aquatic habitats with moving water, so is more common where A. ferox is scarce.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Rivers, ponds, lakes, canals, large springs with overhanging foliage, marshes; all types of freshwater habitats in Florida. Sometimes in brackish water at stream mouths. Basks on sand bars and fallen logs. Often burrows into sand-mud bottom, leaving only head out. Eggs are laid in sandy, sunny areas near water. In Florida, a nest was in the sand apron of a recently abandoned gopher tortoise burrow, 103 m from the nearest body of water (Heinrich and Richardson, 1993, Herpetol. Rev. 24:31).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Florida softshell turtles are mostly carnivorous, and both predaceous and scavenging. Typical foods include snails, insects, crustaceans, fish, amphibians, small turtles (Pseudemys, Sternotherus), snakes (Nerodia, Regina), and occasional aquatic birds. Vegetation and seeds sometimes occur in stomach contents. Small Florida softshell turtles eat many insects, but increase the number of snails and fish in the diet as they grow. Males may consume more snails, clams, and palm seeds than females, which may prefer fish or larger items. Florida softshell turtles conceal themselves in the sand at the bottom of lakes and ambush passing schools of fish. Perhaps because they eat carrion, Florida softshell turtles may be be more effected by pesticides than other aquatic turtles.

Animal Foods: birds; amphibians; reptiles; fish; carrion ; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: leaves; seeds, grains, and nuts; algae

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods, Molluscivore , Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on aquatic animals, including carrion (Ernst and Barbour 1972).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Florida softshell turtles play a role in the aquatic ecosystem both as predators and as scavengers, and in turn provide food (as eggs and post-hatching turtles) for other predators. Young Apalone ferox are prone to bacterial and fungal skin problems; these problems occur in both wild and captive animals and populations. Little is known about parasites in Apalone ferox; they can harbor leeches, and Foster et al. (1998) found eight helminth species in Florida softshell turtle obtained from a commercial processor. The most prevalent helminths were Spiroxys amydae (80%), Cephalogonimus vesicaudus (80%), Vasotrema robustum (76%) and Proteocephalus (63%).

Commensal/Parasitic Species:

  • Bartlett, P., M. Earle-Bridges. 1996. Turtles and Tortoises: Everything about Selection, Care, Nutrition, Breeding, and Behavior. Hong Kong: Barron's Educational Series, Inc.
  • Foster, G., J. Kinsella, P. Moler, L. Johnson, D. Forrester. 1998. Parasites of Florida Softshell Turtles (Apalone ferox) from Southeastern Florida. Journal of the Helminthological Society of Washington, 65 (1): 62-64.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Crows, spotted skunks, American black bears, raccoons, and red foxes all rob Florida softshell turtle nests. Large fish, turtles (Chelydra, Macroclemys), snakes (Agkistrodon, Nerodia), raptorial birds (Everglades kites, eagles) wading birds (herons and egrets) and mammals (armadillos, striped skunks, and otters) eat young turtles, and alligators feed on Florida softshell turtles of all sizes. Humans are the greatest predator of all - people exploit these turtles for food and pets, destroy and pollute habitat, and cause highway mortality.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little has been reported about communication and perception in Florida softshell turtles. Another American softshell turtle, Apalone spinifera, was reported to have some orientation ability for migratory movement; orientation seemed to be dependent on solar (sun) cues coupled with an internal time sense. Hatchlings oriented towards light and (unseen) water. Color vision seems likely in softshell turtles.

Communication Channels: visual

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Often basks during day.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Sex determination is genetic, with no influence from nest temperature. Hatchlings and juveniles are shaped much like adults, although their color darkens with age. Growth slows with maturity.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average and maximum lifespan of Apalone ferox in the wild appears to be unknown. Captives often live over 20 years and a specimen at the National Zoological Park (Washington D.C.) reportedly lived 36 years and 8 months.

Range lifespan

Status: captivity:
36.75 (high) years.

Typical lifespan

Status: captivity:
20 (high) years.

  • Slavens, F. 1999. Reptiles and Amphibians in Captivity-Breeding-Longevity and Inventory. Seattle, WA: Slavewear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 26.2 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Most (more than 90%) of mature females appear to breed every year. In Florida females carried eggs in the oviduct from March through July; males were found to produce sperm in fall (September to October) and mating probably occurs in spring (March to May). Although Florida softshell turtles are fairly common, courtship and mating have not been described in the literature.

Mating System: polygynandrous (promiscuous)

Nesting takes place between mid March and July in central and southern Florida, and in June and July further north. There is a possibility for females to nest 2 to 7 times in one season. Florida softshell turtles may produce more eggs per year (up to 225) than any reptile species other than South American river turtles (Podocnemis expansa), some of the marine turtles, or some Asian softshell species. Females emerge from the water in daytime to nest in sand or well drained soil, but sometimes use newly constructed alligator nests. This habit may take advantage of the female alligator's defense of her nest against predators. The nest is dug with the hind feet and may be up to 14 cm deep and 10 cm in diameter. The female may expel cloacal water on the nest site, perhaps to facilitate excavation. After nesting, females often scratch and churn the ground as they move away from the nest. This behavior may draw predators away from the actual nest. From 9 to 24 brittle, white, spherical eggs are laid per clutch; eggs have an average mass of about 14 grams and range from 24 to 33 mm in diameter. The incubation period is between 56 and 80 days, with the hatchlings averaging 9.7 g and ranging from about 29 to 44 mm in carapace length. Florida softshell turtles are sexually dimorphic with females exceeding the largest male's size by three to five times.

The minimum size for sexual maturity in males is about 0.7 kg and 15.1 cm in plastron length (PL) Some may mature at as small a size as 12 cm PL. For females, the minimum size for sexual maturity is about 20 cm in plastron length. However most females may mature at about 24 cm PL, and some may need to reach 30 cm PL before reproducing.

Breeding interval: Females can lay up to 7 clutches per year between February and August.

Breeding season: Breeding occurs from February to August, although most breeding occurs from March to July.

Range number of offspring: 9 to 40.

Average number of offspring: 26.

Range gestation period: 56 to 80 days.

Range birth mass: 8.4 to 11 g.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous ; sperm-storing

Energy is concentrated by the female in the yolk of her eggs, and the production of several egg clutches, along with the nesting process itself, is energetically demanding.  Once the female leaves the nest site, there is no further parental investment in the eggs or young.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female)

  • Pritchard, P. 1979. Encyclopedia of Turtles. New Jersey: T. F. H. Publications, Inc.
  • Iverson, J., P. Moler. 1997. The female reproductive cycle of the Florida softshell turtle (Apalone ferox). Journal of Herpetology, Vol. 31: 399-409.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lays up to 5-6 clutches of up to about 38 eggs (mean 21), late March to early August in southern Florida (Iverson and Moler 1997), June-July in north (Ernst and Barbour 1972). Eggs hatch in about 9 weeks. Females mature at 24-30 cm plastron length (Iverson and Moler 1997). Some females may not reproduce every year (Iverson and Moler 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apalone ferox

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC10315-10|NC_014054|Apalone ferox| ACCCGATGACTATTCTCAACCAACCATAAAGACATTGGCACCCTTTACTTGATCTTTGGTGCCTGAGCAGGTATAGTTGGTACAGCCCTT---AGCCTACTCATCCGAGCAGAACTGAGCCAACCTGGTACCCTCCTGGGAGAT---GACCAAATCTACAATGTCATTGTCACAGCACATGCTTTCGTTATAATTTTCTTCATAGTAATGCCTGTAATAATCGGCGGATTTGGAAACTGATTAGTACCCCTAATA---ATTGGCGCTCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTACCCCCATCTCTACTCCTACTTCTAGCATCATCAGGAATTGAAACAGGTGCAGGAACAGGTTGAACCGTTTACCCTCCACTAGCTAGCAATTTAGCCCACGCTGGGGCATCAGTAGACCTA---ACCATTTTCTCCTTACATCTAGCCGGAGTATCATCAATCCTAGGAGCTATCAACTTCATCACCACAGCAATCAACATAAAATCCCCTGCAATATCACAATACCAAACCCCATTATTTGTATGGTCAGTAGTAATCACAGCCGTATTATTACTTCTATCATTACCAGTACTAGCTGCA---GGCATCACAATACTACTGACAGACCGAAACTTAAATACAACTTTCTTTGACCCTTCAGGAGGCGGAGACCCTATCTTATATCAACACTTATTCTGATTCTTTGGTCACCCAGAAGTCTACATTCTCATCCTACCTGGATTTGGCATGATCTCCCATGTTGTAACATACTACGCCAATAAAAAA---GAACCATTTGGCTACATGGGCATAGTCTGAGCAATGATATCAATCGGATTTTTAGGGTTCATTGTATGAGCCCACCACATATTTACCGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apalone ferox

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
van Dijk, P.P.

Reviewer/s
Horne, B.D., Mittermeier, R.A., Philippen, H.-D., Quinn, H.R., Rhodin, A.G.J., Shaffer, H.B. & Vogt, R.C

Contributor/s

Justification
Apalone ferox is listed as Least Concern because it ranges across a substantial area, it is common to very common in much of its range, substantial populations are safeguarded in effective protected areas, and while exploitation of the species is widespread and has at times and places been intensive, adequate regulations are in place and the species is resilient to recover within two decades.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Florida softshell turtles remain common in many parts of their range, but populations are locally threatened due to habitat destruction and heavy harvesting. Despite large numbers removed from the wild in some places, Florida softshell turtles remain common in refuge areas and other areas less subject to harvest; their dispersal abilities may allow them to repopulate over-harvested or isolated habitats. Softshell turtles (Apalone) are sensitive to rotenone, a poison often used to collect and survey fish for population studies. Florida softshell turtles are subject to harvest regulations in states where they occur, but are not yet considered to be endangered or threatened on any Federal or State list. They are a Species of Concern in South Carolina. Unusual among turtles in general, Florida softshell turtles may be able to sustain a regulated harvest, and thus take pressure off more sensitive species (Meylan 2006).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Apalone ferox is considered common to very common throughout most of Florida (Meylan and Moler 2006). Localized population declines have been attributed to intensive collection, but only partial quantitative population estimates or trend data are available. Indications are that a depleted population requires about 20 years to recover (Meylan and Moler 2006).

Population structure data are limited to some casual observations (Meylan and Moler 2006).


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

Commercial take of adult softshells, either as a targeted fishery or as bycatch in seine and trotline fisheries, has been substantial and has been implied as the cause of localized declines (review by Meylan and Moler 2006).

Some females are killed when crossing roads to or from nesting sites, and natural predation levels may have increased as predator populations are subsidized by human activities, but the overall impact or significance of these trends have not been evaluated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

In Alabama, commercial and personal take is limited to a daily bag limit of 10 turtles, and softshells can only be taken if over 12” CL. Florida closed its commercial fishery for the species in 2009. Take of the species in Georgia remains unregulated. In South Carolina Apalone ferox is considered a Species of Concern.

Substantial populations are protected in the Everglades and other protected areas; habitat characteristics also make some areas unsuitable to commercial fisheries, providing effective refugia. Habitat modification, particularly the construction of drainage canals, may favour individuals and populations locally.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Florida softshell turtles are generally harmless to human interests; they do eat fish and occasionally young water birds, but no significant effects on prey populations have been reported.Florida softshell turtles are aggressive and will bite if handled or restrained, but are probably harmless to humans if left alone.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Florida softshell turtles are harvested in large numbers for the food trade, both for domestic consumption and, increasingly, to supply Asian markets. Between July 1990 and July 1991, 3600 softshell turtles were purchased for meat in south Florida. Today there are breeding centers in southern Florida to raise turtles for Chinese markets (Bonin et al., 2006), but wild turtles are often taken to resupply breeding farms. Apalone ferox is the most heavily harvested turtle species in Florida.

Positive Impacts: pet trade ; food

  • Moll, D., E. Moll. 2004. The Ecology, Exploitation, and Conservation of River Turtles. New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Florida softshell turtle

The Florida softshell turtle (Apalone ferox) is a species of softshell turtle native to the southeastern United States, and is one of the fastest turtles to move on land.

Contents

Geographic range

It is found primarily in the state of Florida, but it also ranges to southern sections of South Carolina, Georgia, Alabama, .[2]

Introduced outside of range

They are widely distributed by the pet industry. Individual specimens have been found released to the wild well outside of their range, but they are not known to have established outside of their native habitat.[3]

Taxonomy

This species was formerly in the genus Trionyx.[4]

Description

The Florida softshell turtle typically has a dark brown to olive green, leathery carapace with a white or cream colored underside,[5] which provides the turtle with effective protection from some predators.[6] They have a long neck, an elongated head, with a long snorkel-like nose. Juveniles have dark blotching, which fades as they age. On some occasions,Florida softshell turtles can sprint quickly back into a pond or lake to get away from danger. They grow to a large size, ranging from 15–76 cm (5.9–30 in) in length. They are the largest of all the species in the genus Apalone and the largest soft-shell turtles in North America. Females are larger with males only reaching about 35 cm (14 in). A male of this species weighed 4.77 kg (10.5 lb), whereas females can typically range up to 20 kg (44 lb).[7][8] Exceptionally, females can tip the scales at as much as 43.6 kg (96 lb).[8] The juveniles are olive-yellow with grey spots and a yellow lined carapace. Juveniles also have yellow and orange markings on the head and a gray plastron. These marking disappear as it ages, although adults sometimes show traces of the markings.[5]

Behavior

Close-up of head

Florida softshell turtles are almost entirely aquatic, generally only emerging from the water to bask or to lay their eggs.[5] They prefer still waters and can be found in ponds, streams, rivers, lakes and swamps. These turtles are usually shy around humans, but when they feel threatened they will bite with their strong jaws.[3] Like all soft-shells they are very fast in water and on land.[5] In captivity they have been known to live up to 30 years old, although in the wild their lifespans are shorter.

Diet

The Florida softshell is highly carnivorous, consuming fish, frogs and other amphibians, insects, duck hatchlings and crustaceans.

Notes

  1. ^ The Reptile Database. www.reptile-database.org.
  2. ^ Apalone ferox (Schneider, 1783) (includes a map)
  3. ^ a b www.erdingtonaquatics.com turtle
  4. ^ Chelonia.org
  5. ^ a b c d www.tortoise.org apalone
  6. ^ Heron tries to swallow turtle for dinner: A heron tried to swallow a turtle for its dinner but was left frustrated as it could not pierce its shell to kill it. Daily Telegraph, 18 Dec 2009
  7. ^ [1]
  8. ^ a b [2]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Removed from genus Trionyx and placed in genus Apalone by Meylan (1987). North American softshell turtles were retained in Trionyx by Webb (1990) and Ernst et al. (1994). This species exhibits relatively low levels of genetic variability across its range (Weisrock and Janzen 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!