Overview

Distribution

Range Description

This species is endemic to the Iberian Peninsula. It is found throughout Portugal and through most of central and southern Spain. It occurs from sea level up to 1,800m asl (in the Sierra Nevada).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa Europe
Distribution: Morocco, Portugal (incl. Pessegueiro), Spain  
Type locality: ‘‘Lusitanica’’ = Portugal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a subterranean species found in a wide variety of Mediterranean habitats. It is often found in moist, sandy soils that are easy to burrow in and have a high level of humus. It occurs in low intensity agricultural land. The females lay a single egg.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Blanus cinereus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6892-09|EU443257|Blanus cinereus| ACCCGTTGATTTTTCTCCACCAACCATAAAGACATCGGCACCTTGTATTTGCTGTTCGGCGCCTGAGCCGGCATAGCAGGCACAGCCCTT---AGCCTATTAATCCGCGCCGAACTGGGCCAACCAGGCGCAATGCTCGGCGAC---GATCAAATCTATAACGTAGTCGTTACCGCACACGCATTTGTCATAATTTTTTTCATGGTAATACCCATTATAATCGGCGGCTTTGGCAACTGATTAATCCCACTCATA---ATCGGCGCACCAGACATGGCCTTCCCACGAATAAACAACATAAGCTTCTGACTATTACCCCCATCACTTCTACTCCTGCTGGCCTCCGCAGGAGTAGAAGCGGGCGCAGGCACTGGCTGAACAGTCTACCCCCCACTCGCTGGCAACATGGCCCATGCCGGCGCATCAGTCGACCTG---ACCATCTTCTCACTGCATTTAGCAGGTGTATCATCAATTCTAGGCGCAATTAACTTTATTACCACCTGCATTAATATAAAACCACCGCAAATGACCCAATACCAAACGCCACTATTTGTGTGATCAGTACTAATTACAGCAGTACTTCTACTACTATCACTACCAGTCTTGGCTGCC---GGCATTACAATACTATTAACAGACCGAAACATTAACACCTCCTTCTTTGACCCGGCCGGCGGTGGCGACCCTGTCCTCTACCAACACCTATTTTGATTCTTCGGCCACCCAGAAGTATATATCCTTATCCTCCCAGGATTTGGCATGATCTCACATATCGTCACATATTACGCCGGAAAAAAA---GAACCCTTCGGCTATATGGGAATAGTCTGAGCTATATTATCAATCGGCTTCCTGGGCTTTATCGTCTGAGCCCACCACATATTCACAGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Blanus cinereus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Juan M. Pleguezuelos, Paulo Sá-Sousa, Valentin Pérez-Mellado, Rafael Marquez, Iñigo Martínez-Solano

Reviewer/s
Cox, N. and Temple, H.J. (Global Reptile Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
    (IUCN 2006)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is difficult to determine the abundance of this species, but it appears to be most common in areas of sandy and moist soil.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The threats to this species are not well known; it might be locally threatened by urbanization. It is known to be eaten by wild boar Sus scrofa, which are expanding their distribution in Spain and Portugal, but the extent to which this constitutes a threat is unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected by national legislation. It occurs in many protected areas. Further studies are needed into the threats, distribution and abundance for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Iberian Worm Lizard

The Iberian Worm Lizard or European Worm Lizard (Blanus cinereus) is a species of reptile in the family Amphisbaenidae (worm lizards). It is locally known as "Cobra-cega" (Portuguese), "culebrilla ciega" (Spanish) and "colobreta cega" (Catalan)[1] meaning 'blind snake'.

Contents

Distribution and habitat

It is found in the southern section of the Iberian Peninsula, southwards of rivers Ebro and Douro.

Its natural habitats are temperate forests, temperate shrubland, Mediterranean-type shrubby vegetation, temperate grassland, arable land, and pastureland.

Morphology and habits

The B. cinereus is a small legless reptile and a burrowing species. Adults may reach a total length of 10–20 cm (4–8 in).

It can often be found under logs and rocks, especially after storms. Like other amphisbaenids the B. cinereus is a timid animal that feeds on worms and other small invertebrates. Sometimes they have been found inhabiting ant colonies.[2] The breeding is oviparous. It is threatened by habitat loss.[3]

References

  1. ^ el País Valencià - Espais naturals protegits
  2. ^ Blanus cinereus o culebrilla ciega
  3. ^ Pleguezuelos, J., Sá-Sousa, P., Pérez-Mellado, V. & Marquez, R. 2005
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!