Articles on this page are available in 1 other language: Spanish (21) (learn more)

Overview

Distribution

Geographic Range

Boa constrictor is an exclusively New World species which has the largest distribution of all neotropical boas. Boa constrictors range from northern Mexico south through Central and South America. In South America the range splits along the Andes mountains. To the east of the Andes, B. constrictor is found as far south as northern Argentina. On the west side of the mountains, the range extends into Peru. Boa constrictors are also found on numerous islands off the Pacific coast and in the Caribbean. Islands included in the boa constrictor range are: the Lesser Antilles, Trinidad, Tobago, Dominica, and St. Lucia. Some islands off the coast of Belize and Honduras are also inhabited by this species.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America South-America
Distribution: Mexico (Yucatan, Tamaulipas), Belize, Guatemala, Honduras, El Salvador, Nicaragua, Costa Rica, Panama,  Colombia, Venezuela (Merida [HR 27: 88], Isla Margarita), Guyana, French French Guiana, Surinam, Peru (Pasco etc.), Bolivia, Brazil (Amapá, Pará, Rondonia, Bahia, etc.), Argentina, Paraguay, Trinidad, Tobago, Antilles, e.g. Martinique; Antigua (sub-fossil only), elevation (Honduras): 0-1370 m USA (introduced to Florida)  amarali: SE Bolivia, S Brazil (S Mato Grosso, Goias, Mato Grosso do Sul, Sao Paulo), N Paraguay;
Type locality: Sao Paulo, Brazil.  eques: Peru (Piura).
Type locality: coastal city of Paita and vicinity, Peru.  imperator: Mexico (Sinaloa, Chihuahua [HR 32: 277], Michoacan), San Andres Island (Colombia), Panama;
Type locality: “l’Amerique meridionale, principalement au Mexique”  longicauda: N Peru;
Type locality: region around Tumbes, Tumbes Province, N Peru.  melanogaster: Ecuador (Morona Santiago, Napo);
Type locality: Rio Yaupi, Morona Santiago, Ecuador.  nebulosa: Dominica;
Type locality: Woodford Hill, Dominica.  occidentalis: Paragua, Argentina |(Mendoza, San Luis, Cordoba, La Pampa), SE Bolivia;
Type locality: Mendoza and San Juan, Argentina.  orophias: St. Lucia;
Type locality: Praslin, St. Lucia.  ortonii: NW Peru (La Libertad, Cajamarca, Lambayeque, Piura;
Type locality: Chilete (Cajamarca), west of Pacasmayo, Peru.  sabogae: Gulf of Panama (Islas Perlas, Isla del Rey, Isla San José, and others);
Type locality: Saboga Island (Panama).  
Type locality: “Indiis”
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Boa constrictor has long been famous as one of the largest species of snake. In reality, boa constrictors are fairly modest-sized boids and are dwarfed by the other competitors for this title. The maximum length reported in B. constrictor was slightly over 4 meters. Individuals are generally between 2 and 3 meters in length, although island forms are commonly below 2 meters. Within populations, females are usually larger than males. However, the tails of males may be proportionally longer than those of females because of the space taken up by the hemipenes. Boa constrictor coloration and pattern are distinctive. Dorsally the background color is cream or brown that is marked with dark "saddle-shaped" bands. These saddles become more colorful and prominent towards the tail, often becoming reddish brown with either black or cream edging. Along the sides, there are rhomboid, dark marks. They may have smaller dark spots over the entire body. The head of a boa constrictor has 3 distinctive stripes. First is a line that runs dorsally from the snout to the back of the head. Second, there is a dark triangle between the snout and the eye. Third, this dark triangle is continued behind the eye, where it slants downward towards the jaw. However, there are many variations on appearance. At least 9 subspecies are currently recognized by some authorities, although many of these are poorly defined and future research will undoubtedly modify this taxonomy. Currently acknowledged subspecies include: B. c. constrictor, B. c. orophias, B. c. imperator, B. c. occidentalis, B. c. ortonii, B. c. sabogae, B. c. amarali, B. c. nebulosa (Dominican boa, recently elevated to full species), and B. c. longicauda. Most of these subspecies are distinguished largely by their range rather than appearance, but regional (subspecific) variation in form, size, and coloration does occur.

As in most members of the family Boidae, boa constrictors possesses pelvic spurs. These are hind leg remnants found on either side of the cloacal opening. They are used by males in courtship and are larger in males than in females. Males possess hemipenes, a double-penis, of which only one side is commonly used in mating. Although heat-sensing pits are common in Boidae, they are absent in B. constrictor. Thus, this species is presumed to have no specialized thermosensory abilities. The teeth of boa constrictors are aglyphous, meaning they do not possess any elongated fangs. Instead, they have rows of long, recurved teeth of about the same size. Teeth are continuously replaced; particular teeth being replaced at any one time alternate, so that a snake never loses the ability to bite in any part of its mouth. Boas are non-venomous. Boa constrictors have two functional lungs, a condition found in boas and pythons. Most snakes have a reduced left lung and an extended right lung, to better match their elongated body shape.

Range length: 1 to 4 m.

Average length: 2-3 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger

  • Pough, F., R. Andrews, J. Cadle, M. Crump, A. Savitzky, K. Wells. 2004. Herpetology, third edition. Upper Saddle River, NJ: Benjamin Cummings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Boa constrictors occupy a variety of habitats. Primary habitat is rainforest clearings or edges. However, they are also found in woodlands, grasslands, dry tropical forest, thorn scrub, and semi-desert. Boa constrictors are also common near human settlements and often found in agricultural areas. Boa constrictors are commonly seen in or along streams and rivers in appropriate habitats. Boa constrictors are semi-arboreal, although juveniles tend to be more arboreal than adults. They also move well on the ground and can be found occupying the burrows of medium-sized mammals.

Range elevation: 0 to 1,000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest

Aquatic Biomes: rivers and streams

Other Habitat Features: agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Boa constrictors are carnivorous generalists. The main bulk of their diet consists of small mammals, including bats, and birds. However, they will eat any animal they can capture and fit in their mouths. Boa constrictors capture prey through ambush hunting, although occasionally they actively hunt. They can rapidly strike at an animal that passes by a branch that they are suspended from, for example. They are non-venomous and prey is dispatched through constriction. Boa constrictors wrap their prey in the coils of their body and squeeze until the prey asphyxiates. This is especially effective against mammals and birds whose warm-blooded metabolism demands oxygen at a rapid rate. Once dead, the prey is swallowed whole. Interestingly, if captive boa constrictors are presented with dead prey, they still constrict the food item before consuming it. It takes boa constrictors 4 to 6 days to fully digest a meal.

Animal Foods: birds; mammals; amphibians; reptiles; eggs

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Boa constrictors are predators on birds and small mammals, including bats. They are important predators of rodents and opossums, especially, which can become pests in some areas and carry human diseases.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

When threatened, boa constrictors will bite to defend themselves. Though there are few references to predation on boa constrictors in nature, they are certainly killed and consumed by numerous reptilian, avian, and mammalian predators. Young boas are especially vulnerable.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most snakes, boa constrictors rely on strong vomeronasal senses. Their tongues flick continuously, bringing odor molecules into contact with the chemosensory (vomeronasal) organ in the top of their mouths. In this manner, they constantly sense chemical cues in their enviornment. Boa constrictors have good vision, even into the ultraviolet spectrum. In addition, they can detect both vibrations in the ground and sound vibrations through the air through their jaw bones. They do not have external ears. Unlike most boids, boa constrictors lack thermosensory pits.

Communication Channels: tactile ; chemical

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Fertilization is internal, with mating facilitated by the pelvic spurs of males. Boa constrictors are ovoviviparous; embryos develop within their mothers' bodies. Young are born live and are independent soon after birth. Newborn boa constrictors resemble their parents and do not undergo any metamorphosis. As in other snakes, boa constrictors shed their skins periodically as they age, allowing them to grow and preventing the scales from becoming worn. As a boa grows, and its skin is shed, its coloration may gradually change. Young snakes tend to have brighter colors and more contrast between colors, but most changes are subtle.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Boa constrictors are potentially long-lived, perhaps averaging around 20 years old. Captive boas tend to live longer than wild ones, sometimes by as much as 10 to 15 years.

Range lifespan

Status: wild:
30 (high) years.

Range lifespan

Status: captivity:
40 (high) years.

Average lifespan

Status: wild:
20 years.

Typical lifespan

Status: captivity:
25 to 35 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40.4 years (captivity) Observations: Weight varies markedly in this species (http://www.zoo.org/). One individual caught in the wild lived over 40 years in captivity (Castanet 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males are polygynous; each male can mate with multiple females. Females may also have more than one mate in a season. Females are usually widely scattered and courting males must invest energy into locating them. Most female boa constrictors do not appear to reproduce annually. Usually about half of the female population is reproductive each year. Furthermore, females likely become reproductive only when they are in good physical condition. While a higher percentage of males seems to reproduce each year, it is likely that the majority of males also do not reproduce annually.

Mating System: polygynandrous (promiscuous)

Boa constrictors generally breed during the dry season, usually from April to August, though the timing of the dry season varies across their range. Gestation lasts for 5 to 8 months depending on local temperatures. The average litter has 25 young but can be anywhere from 10 to 64 young.

Breeding interval: Females perhaps every other year, or less often, depending on condition.

Breeding season: Breeding occurs during the dry season (April-August), birth occurs 5-8 months later.

Range number of offspring: 10 to 64.

Average number of offspring: 24 (in <>).

Range gestation period: 5 to 8 months.

Average time to independence: after only a few minutes.

Average age at sexual or reproductive maturity (female): 2-3 years.

Average age at sexual or reproductive maturity (male): 2-3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous

Maternal investment in young is considerable and requires the mother to be in good physical condition. Since young boa constrictors develop within the mother's body, they are able to develop in a thermoregulated, protected environment and they are provided with nutrients. Boa constrictor young are born fully developed and are independent within minutes of birth. Male reproductive investment is largely spent in finding mates.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Waves of shortening used to move: boa constrictor
 

Bodies of boas and pythons can move in a worm-like extended fashion by passing waves of shortening down their bodies.

   
  "A few snakes, such as boas and pythons, can move forward when extended lengthwise in a wormlike fashion rather than with their bodies bent into curves. They're not fast, and the behavior seems to be used for a stealthy approach to prey. With backbones fixing their lengths, they can't work exactly like earthworms--they instead use waves of shortening that pass rearward along a powerful lengthwise band of ventral muscle. So the top of the snake moves steadily. Meanwhile, its bottom has a stop and start motion as successive segments are fixed to the ground while the ones behind the fixed ones are shortened and those in front of the fixed ones are lengthened. Moving segments are raised slightly above the fixed ones--it looks as if the snake is walking on its ribs, although it is not. Gray (1968) and Gans (1974) give good descriptions." (Vogel 2003:488-489)
  Learn more about this functional adaptation.
  • Steven Vogel. 2003. Comparative Biomechanics: Life's Physical World. Princeton: Princeton University Press. 580 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Boa constrictor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGACTATTTTCAACAAACCACAAAGACATCGGCACCTTGTATTTACTATTCGGTGCTTGATCGGGTCTGATCGGGGCCTGCCTAAGCATCCTCATACGAATGGAGCTAACACAACCCGGCTCACTATTCGGAAGT---GATCAGATCTTCAACGTCCTAGTAACAGCCCACGCCTTTATCATAATCTTCTTCATAGTAATACCAATCATAATTGGCGGATTTGGAAACTGATTAATCCCCCTTATAATCGGAGCACCAGACATAGCATTCCCACGTATAAACAATATGAGCTTTTGACTTTTACCTCCAGCTCTTCTACTCCTACTCTCATCATCATACGTCGAAGCAGGCGCAGGGACGGGTTGAACTGTATACCCACCTCTATCAAGCAATATGGTCCATTCGGGACCATCAGTGGACTTAGCAATCTTCTCTCTTCACCTGGCCGGGGCATCATCAATCCTAGGGGCAATCAACTTTATCACGACATGTATTAACATGAAACCAGCCTCAATACCAATATTCAACATCCCACTGTTCGTCTGGTCAGTAATAATCACAGCCATCATATTACTACTGGCCCTGCCAGTCCTGGCAGCAGCAATTACAATACTACTAACAGACCGTAATCTGAACACCTCATTCTTTGACCCTTGTGGAGGAGGAGACCCAATCTTATTCCAACACCTATTTTGATTTTTCGGACACCCAGAAGTGTATATCTTAATCCTGCCCGGATTCGGAATTATCTCCAGCATTATCACATTCTACACTGGAAAAAAGAACACATTTGGATACACAAGCATAATCTGAGCAATGATGTCAATTGCCTTCCTTGGGTTTGTGGTGTGAGCACATCATATATTCACAGTTGGACTTGACATTGACAGCCGAGCATATTTTACAGCAGCCACAATAATCATCGCCGTTCCAACCGGAATTAAGGTATTCGGCTGACTAGCAACCCTCACAGGGGGA---CAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Boa constrictor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Overcollection for the pet trade and needless direct persecution has had an impact on some B. constrictor populations. Some populations have been hit harder than other, and various wild populations are now endangered, particularly those on offshore islands. On the mainland, boa constrictors have been harvested for their skins, meat and body parts. Furthermore, habitat loss and road mortality has reduced populations. Most boa constrictors are on the CITES Appendix 2 list. The subspecies B. c. occidentalis is on Appendix 1 of CITES.

US Federal List: no special status

CITES: appendix i; appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Little negative impact on humans is known. Boa constrictors rarely, if ever, attack humans except in self-defense. Humans, even children, are far outside the range of prey size taken by boas. Boa constrictor bites are painful bure are unlikely to be dangerous as long as standard medical care is obtained. Boa constrictors are not venomous. Large captive snakes must always be handled with extreme care, especially when being fed, as a hungry snake strikes and constricts in a largely automatic sequence of behaviors. Very large snakes should handled and fed only with more than one person present.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Boa constrictors are popular in the pet trade. It is easy to obtain boa constrictors that have been captive bred for generations, increasing their affinity for humans. They are relatively undemanding pets, as long as their large adult size and space needs are accounted for. Proper levels of heat and humidity (boas usually need a dry climate, otherwise their scales will develop rot) need to be observed. Boa constrictors can be fed dead mice and rats and only require food and defecate about once a week. Proper care should be observed in handling them, especially the larger varieties. Boa constrictors, whole or in parts, are also seen in local markets within their range, presumably as food or medicine. They are sometimes harvested for the skin trade.  In some areas boas constrictors can play a large role in controlling populations of pest rodents and opossums (Didelphidae). Opossums in the tropics can be carriers for the human disease leishmaniasis, which is transferred by blood-feeding sand flies (Psychodidae) that parasitize the opossums. Boa constrictor predation pressure may help to regulate opossum populations and decrease potential trasmission of leishmaniasis to humans.

Positive Impacts: pet trade ; food ; body parts are source of valuable material; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Boa constrictor

The Boa constrictor is a species of large, heavy-bodied snake. It is a member of the family Boidae found in North, Central, and South America, as well as some islands in the Caribbean. A staple of private collections and public displays, its color pattern is highly variable yet distinctive. Ten subspecies are currently recognized, although some of these are controversial.[2] This article focuses on the species Boa constrictor as a whole, but also specifically on the nominate subspecies Boa constrictor constrictor.


Contents

Common names [edit]

Though all boids are constrictors, only this species is properly referred to as "Boa constrictor"; a rare instance of an animal having the same common and scientific binomial name. (The distinction is shared with Tyrannosaurus rex.)

All subspecies are referred to as "Boa constrictors", while the nominate subspecies, B. c. constrictor, is often referred to specifically as the "red-tailed boa". Within the exotic pet trade it is also known as a "BCC", an abbreviation of its scientific name, to distinguish it from other Boa constrictor subspecies such as the Boa constrictor imperator which is also regularly, and erroneously, referred to as a "red-tailed boa" or "common boa".

Other common names include "chij-chan" (Mayan),[3] "jibóia" (Latin American) and "macajuel" (Trinidadian).[4]

Physical description and anatomy [edit]

Size and weight [edit]

Boa constrictor constrictor

The Boa constrictor is a large snake, although only modestly sized in comparison to other large snakes such as the reticulated python and Burmese python, and can reach lengths of anywhere from 3–13 feet (0.91–4.0 m) depending on the locality and the availability of suitable prey.[5] There is clear sexual dimorphism seen in the species, with females generally being larger in both length and girth than males. As such, the average size of a mature female boa is between 7–10 feet (2.1–3.0 m), whilst it is 6–8 feet (1.8–2.4 m) for the males.[6] It is common for female individuals to exceed 10 feet (3.0 m), particularly in captivity, where lengths of up to 12 feet (3.7 m) or even 14 feet (4.3 m) can be seen.[7] A report of a Boa constrictor growing up to 18.5 feet (5.6 m) was later found to be a misidentified green anaconda.[8]

The Boa constrictor is a heavy-bodied snake, and large specimens can weigh up to 27 kg (60 lb). Females, the larger sex, more commonly weigh 10 to 15 kg (22 to 33 lb).[9] Some specimens of this species can reach or possibly exceed 45 kg (99 lb), although this is not usual.[10]

The size and weight of a Boa constrictor depends on subspecies, locale, and the availability of suitable prey. Several populations of Boa constrictors are known as "dwarf boas", such as the population of B. c. imperator on Hog Island. These smaller subspecies are generally insular populations. B. c. constrictor itself reaches, and occasionally tops, the averages given above, as it is one of the relatively large subspecies of Boa constrictor.[6]

Other examples of sexual dimorphism in the species include the fact that males generally have longer tails to contain the hemipenes and also longer pelvic spurs, which are used to grip and stimulate the female during copulation.[11] Pelvic spurs are the only external sign of the rudimentary hind legs and pelvis, seen in all boas and pythons.

Coloring [edit]

Head shape of Boa constrictor imperator

The coloring of Boa constrictors can vary greatly depending on the locality. However, they are generally a brown, grey or cream base color, patterned with brown or reddish brown "saddles" that become more pronounced towards the tail. It is this coloring that gives Boa constrictor constrictor the common name of "red-tailed boa", as it typically has more red saddles than other Boa constrictor subspecies. The coloring works as very effective camouflage in the jungles and forests of its natural range.

There are also individuals that exhibit pigmentary disorders such as albinism. Although these individuals are rare in the wild, they are common in captivity where they are often selectively bred to make a variety of different color "morphs". Boa constrictors have an arrow-shaped head that has very distinctive stripes on it. One runs dorsally from the snout to the back of the head. The others run from the snout to the eyes and then from the eyes to the jaw.[6]

Juvenile South American boa constrictor

Boa constrictors can sense heat via cells in their lips, though they lack the labial pits surrounding these receptors seen in many members of the boidae family.[12] Boa constrictors also have two lungs, a smaller (non-functional) left and enlarged (functional) right lung to better fit their elongated shape, unlike many colubrid snakes which have completely lost the left lung.

Distribution [edit]

Geographic range [edit]

A Boa constrictor in Belize

Dependent on subspecies Boa constrictor can be found from northern Mexico through Central America (Belize, Guatemala, Honduras, El Salvador, Nicaragua, Costa Rica and Panama) to South America north of 35°S (Colombia, Ecuador, Peru, Venezuela, Trinidad and Tobago, Guyana, Belize, Suriname, French Guiana, Brazil, Bolivia, Uruguay and Argentina). Also in the Lesser Antilles (Dominica and St. Lucia), on San Andrés, Providencia and many other islands along the coasts of Mexico and Central and South America. The type locality given is "Indiis" – a mistake, according to Peters and Orejas-Miranda (1970).[1]

Habitat [edit]

Boa constrictor flourishes in a wide variety of environmental conditions, from tropical rainforests to arid semi-desert country.[13] However, it prefers to live in rainforest due to the humidity and temperature, natural cover from predators and vast amount of potential prey. It is commonly found in or along rivers and streams, as it is a very capable swimmer. Boa constrictor will also occupy the burrows of medium-sized mammals, where it can hide from potential predators.[6]

Behavior [edit]

A juvenile female Boa constrictor that is in a shed cycle, note the blue "opaque" eyes

Boa constrictors will generally live on their own, and not interact with any other snakes unless they want to mate. They are nocturnal; however, they may bask during the day when night-time temperatures are too low. As semi-arboreal snakes, young boa constrictor individuals may climb into trees and shrubs to forage; however, they become mostly terrestrial as they become older and heavier.[14] Boa constrictors will strike when threatened, and will bite in defense. This bite can be painful, especially from large snakes, but is rarely dangerous. However, care must be taken to ensure that infection does not result from the injury. Specimens from Central America are more irascible, hissing loudly and striking repeatedly when disturbed, while those from South America tame down more readily.[13] Like all snakes, Boa constrictors that are in a shed cycle will be more unpredictable. This is because the substance that lubricates between the old skin and the new will make the eyes appear "milky", blue, or "opaque", so that the snake cannot see very well, causing it to be more defensive than it might be otherwise.

Diet [edit]

Captive boa constrictor strike-feeding on large (already dead) rat

Prey includes a wide variety of small to medium sized mammals and birds.[14] The bulk of their diet consists of rodents, but larger lizards and mammals as big as ocelots are also reported to have been consumed.[13] Young Boa constrictors will eat small mice, birds, bats, lizards and amphibians. The size of the prey item will increase as they get older and larger. Boa constrictors are ambush predators and as such will often lie in wait for an appropriate prey to come along at which point they will attack. However, they have also been known to actively hunt, particularly in regions with a low concentration of suitable prey, and this behaviour generally occurs at night. The boa will first strike at the prey, grabbing it with its teeth, it then proceeds to constrict the prey until death before consuming it whole. Their teeth also help force the animal down the throat whilst muscles then move it towards the stomach. It will take the snake approximately 4–6 days to fully digest the food, depending on the size of the prey and the local temperature. After this the snake may not eat for anywhere from a week to several months, due to its slow metabolism.[15]

Reproduction and development [edit]

Boa constrictors are ovoviviparous, giving birth to live young. They will generally breed in the dry season—between April and August—and are polygynous, thus males may mate with multiple females.[16] A half of all females will breed in a given year, and a larger percentage of males will actively attempt to locate a mate.[16] However due to the polygynous nature of Boa constrictor many of these males will be unsuccessful. The reasoning being the fact that they are ovovivparous (i.e. eggs hatching inside the body). As such female boas without a good enough physical condition will be unlikely to attempt to mate, nor produce viable young if they do mate.[16] In 2010, a boa constrictor was shown to have reproduced asexually via parthenogenesis.[17]

During breeding season the female boa will emit a scent from her cloaca to attract males, who may then wrestle for the right to breed with her.[12] During breeding the male will curl his tail around the female's and the hemipenes (or, male reproductive organs) will be inserted. Copulation can last from a few minutes to several hours, and may occur several times over a few week period.[18] After this period ovulation may not occur immediately, however the female can hold the sperm inside her for up to one year.[18] When the female ovulates, a mid-body swell can be noticed that appears similar to after the snake has eaten a large meal.[18] The female will then shed two to three weeks after ovulation, with what is known as a post ovulation shed which will last another 2–3 weeks, which is longer than a normal shed.[18] The gestation period, which is counted from the post ovulation shed, is approximately 100–120 days.[18] The female will then give birth to young that average 15–20 inches (38–51 cm) in length.[14] The litter size varies between females, but can be between 10 and 65 young with an average of 25, although some of the young may be still-borns or non-fertilised eggs known as "slugs". The young are independent at birth and will grow rapidly for the first few years, shedding regularly (once every one to two months). At between 3–4 years Boa constrictors become sexually mature and will have reached the adult size of between 6–10 ft, although they will continue to grow at a slow rate for the rest of their lives.[19] At this point they will shed less frequently, approximately every 2–4 months.[20]

Captivity [edit]

This species does well in captivity, usually becoming quite tame. It is a common sight in both zoos and private reptile collections. Though still exported from their native South America in significant numbers, it is widely bred in captivity. When kept in captivity, they are fed mice, rats, rabbits, chickens and chicks depending on the size and age of the individual. Captive life expectancy is 20 to 30 years, with rare accounts of over 40 years,[21] making them a long-term commitment as a pet. Proper animal husbandry is the most significant factor in captive lifespan, this includes providing adequate space, correct temperatures and humidity and suitable food items.[20]

A vivarium

Young Boa constrictors should be started off in a relatively small enclosure, generally a secure plastic box or terrarium. This enclosure is then increased as the boa grows, as large open spaces are stressful for young snakes. Adults are often housed in 180 cm × 90 cm × 60 cm vivariums, however large females may need even larger enclosures. The general rule is that the minimum length of the enclosure should be two thirds of the snake's length.[22] Snakes are generally kept in separate enclosures, but people have successfully kept females together. Male boas should not be kept together as they may fight. Glass, aquarium-style enclosures are seldom advised by snake keepers as they do not efficiently maintain temperature and humidity.[23]

A thermal gradient should be provided, with a cool end and a warm end where the heat source should be located. The cool end should be maintained at 75–85°F (27–29°C),[24] and the warm end at 86–92°F (30–33°C).[22][23][24] Temperatures should not be allowed to rise above 95°F (35°C) or drop below 75°F (24°C). Cages that are too cold can cause many health problems, ranging from non-digestion of food to pneumonia.[19] The necessary temperature can be provided by a heat mat, ceramic or specific light bulb or other alternative heating systems. All heat sources should be guarded, to prevent burns to the snake, and used in conjunction with a thermostat to prevent overheating. Humidity should be kept at 50%, and raised to 70% when the boa is in shed.[24] However, high humidity should not be maintained for longer than a week, as this raises the risk of infections such as scale rot.[22] Humidity levels can be maintained with a water bowl, and raised by adding more water bowls, moving the current water bowl closer to the heat source or misting the enclosure with a water sprayer. Boa constrictors do not need any special lighting, but should have approximately 12 hours of light and 12 hours of darkness every day to simulate a natural environment. Either a bulb or natural light can be used to provide such conditions.[22][25]

Inside the enclosure a substrate, generally of newspaper or aspen shavings, must be provided.[24] Untreated cedar or pine shavings are to be avoided as they contain oils that are toxic to snakes.[26] A water bowl, large enough to provide adequate humidity and that the boa can coil within, must be provided. Another basic essential is adequate hides, at least two (one in the cool end and one in the warm end).[24] Hides can be anything from empty plastic or wooden boxes to specially made hides from a reptile equipment retailer. The hides ensure that the snake feels secure, as stress can result in snakes refusing to eat. Shelves or secure branches are often provided so that boas can climb, but this is not an essential. Fake plants and other natural looking decorations are also commonly provided, but again they are not essential.[24]

A Boa constrictor in a vivarium. Note the large water bowl

Young boas can be started on small to medium mice and then on to increasing size of rats. Most boas will never need a prey item larger than a large rat, however some big females (8 ft+) may require rabbits, guinea pigs and chickens. The general rule for feeding snakes is that a suitable prey item is the girth of the snake at its widest point,[24] as with most snakes (including Boa constrictor) the left and right sides of the lower jaw are joined only by a flexible ligament at the anterior tips, allowing them to separate widely, while the posterior end of the lower jaw bones articulate with a quadrate bone, allowing further mobility, to allow the consuming of large prey. Young snakes can be fed once a week, to promote healthy growth. Adults only need to be fed once every month. Overfeeding (or powerfeeding) the snake can lead to a host of health problems later and can shorten its lifespan.[25] It is natural for snakes to lose their appetite when going into shed as this is a stressful time for them, as such food should not be offered at this time.[25] Water should be changed daily or every other day.

Boas should be handled regularly to maintain their docility. However, large boas should be handled by two people, as these snakes are incredibly powerful.[27] Snakes should never be handled within 48 hours of feeding, due to a risk of regurgitation, or when in a shed cycle.[24]

Economic significance [edit]

Boa constrictors are very popular within the exotic pet trade, and have been both captured in the wild and also bred in captivity. Today most captive Boa constrictors are captive bred, however between 1977 and 1983 113,000 live Boa constrictors were imported into the United States.[19] These huge numbers of wild caught snakes have put considerable pressure on some wild populations. Boa constrictors have also been harvested for their meat and skins, and are a common sight at markets within their geographic range. After the reticulated python Boa constrictors are the snake most commonly killed for snake skin products, such as shoes, bags and other items of clothing.[19] In some areas they have an important role in regulating the opossum populations, preventing the potential transmission of leishmaniasis to humans.[28] In other areas they are often let loose within the communities to control the rodent populations.

Conservation [edit]

All Boa constrictors fall under CITES and are listed under CITES Appendix II, except B.c.occidentalis which is listed in CITES Appendix I.[29]

In some regions Boa constrictor numbers have been severely hit by predation from humans and other animals, and over collection for the exotic and snake skin trades. However most populations are not under threat of immediate extinction, thus why they are within Appendix II rather than Appendix I.[29]

Subspecies [edit]

There are 10 current subspecies of Boa constrictor, however much of these are poorly differentiated and it is thought that further research will redefine many of these subspecies. Some appear to be based more on location than biological differences, such as B. c. orophias (the St. Lucia Boa).[19]

illustration Boa constrictor eques (Eydoux & Souleyet 1842), synonymized into B. c. imperator
Subspecies[2]Taxon author[2]Common nameGeographic range
B. c. amaraliStull, 1932Amaral's boaBrazil, Bolivia and Paraguay[30]
B. c. constrictorLinnaeus, 1758Red-tailed boaSouth America[30]
B. c. imperatorDaudin, 1803Common northern boaCentral America and northern South America[30]
B. c. longicaudaPrice & Russo, 1991Tumbes Peru boaNorthern Peru[30]
B. c. melanogasterLanghammer, 1983Ecuadorian boaEcuador[31]
B. c. nebulosa(Lazell, 1964)Dominican clouded boaDominica[30]
B. c. occidentalisPhilippi, 1873Argentine boaArgentina and Paraguay[30]
B. c. orophiasLinnaeus, 1758St. Lucia boaSt. Lucia[30]
B. c. ortoniiCope, 1878Orton's boaSouth America[30]
B. c. sabogae(Barbour, 1906)Pearl Island boa"Pearl Islands" off the coast of Panama[30]

There have also been several other subspecies described at different times, but currently these are no longer considered to be subspecies by many herpetologists and taxonomists.[31] These include:

  • Boa constrictor mexicana (Jan 1863): This was described from a single specimen which had 55 dorsal scale rows, but otherwise appeared the same as a B. c. imperator. Since then B. c. mexicana has been included within the B. c. imperator subspecies by most authors, as Smith (1963) commented that no Mexican boas have been proven to have 55 dorsal scale rows. However, there is still controversy as Andrew (1937) reported four Mexican specimens with dorsal scale rows between 56–62.[31]
  • Boa constrictor eques (Eydoux & Souleyet, 1842): Based upon a single specimen from Peru that had one large orbital scale. However, no other such specimens have been found and it is thought that the snake was an aberrant B.c.imperator.[31]
  • Boa constrictor diviniloqua (Duméril & Bibron, 1844): Now known to be synonymous with B. c. orophias.[31]
  • Boa constrictor sigma (Smith 1943): A very controversial possible subspecies from the Tres Marias Islands, Mexico. It appears like a B. c. imperator but has a higher number of ventral scales than B. c. imperator. It is possible a slightly different climate may have caused such a change, but this could then undermine the other insular subspecies such as B. c. orophias and B. c. nebulosa.[31]
  • Boa constrictor isthmica (Garman 1883): Considered synonymous with B. c. imperator. It is from Panama.[31]

See also [edit]

References [edit]

  1. ^ a b McDiarmid RW, Campbell JA, Touré T. 1999. Snake Species of the World: A Taxonomic and Geographic Reference, vol. 1. Herpetologists' League. ISBN 1-893777-00-6 (series). ISBN 1-893777-01-4 (volume).
  2. ^ a b c "Boa constrictor". Integrated Taxonomic Information System. Retrieved 11 July 2008. 
  3. ^ Helmke, Christophe (2009). Mesoamerican Lexical Calques in Ancient Maya Writing and Imagery. p. 4. Dept. of American Indian Languages & Cultures, Institute of Cross-cultural & Regional Studies, University of Copenhagen
  4. ^ Mendes J. 1986. Cote ce Cote la: Trinidad & Tobago Dictionary. Arima, Trinidad. p. 92.
  5. ^ Maurice, B. "International Wildlife Encyclopedia, Third Edition". ISBN 0-7614-7266-5
  6. ^ a b c d Mattison, C. 2007. "The New Encyclopedia of Snakes". Princeton University Press. ISBN 0-691-13295-X.
  7. ^ Wagner, D. "Boas". Barron's. ISBN 0-8120-9626-6
  8. ^ Murphy JC, Henderson RW. 1997. Tales of Giant Snakes: A Historical Natural History of Anacondas and Pythons. Krieger Pub. Co. ISBN 0-89464-995-7.
  9. ^ "ANIMAL BYTES — Boa Constrictor". Seaworld.org. Retrieved 2010-03-15. 
  10. ^ Boa Constrictor Fact Sheet – Woodland Park Zoo Seattle WA. Zoo.org. Retrieved on 2012-08-22.
  11. ^ O'shea, M. 2007. "Boas and Pythons of the World". Princeton University Press. ISBN 1-84537-544-0.
  12. ^ a b "Boa Constrictor Fact Sheet". Nationalzoo.si.edu. Retrieved 2010-03-15. 
  13. ^ a b c Stidworthy J. 1974. Snakes of the World. Grosset & Dunlap Inc. ISBN 0-448-11856-4.
  14. ^ a b c Mehrtens JM. 1987. Living Snakes of the World in Color. New York: Sterling Publishers. ISBN 0-8069-6460-X.
  15. ^ Montgomery, G., and Rand, A. 1978. "Movements, body-temperature and hunting strategy of a boa-constrictor"
  16. ^ a b c "ADW: Boa constrictor: Information". Animaldiversity.ummz.umich.edu. Retrieved 2010-03-15. 
  17. ^ "Who's Your Daddy? Boa Constrictor Has Virgin Birth". LiveScience. 2010-11-03. Retrieved 2011-08-01. 
  18. ^ a b c d e "Boa Constrictor Care". Ssscales. Retrieved 2010-03-15. 
  19. ^ a b c d e Smith, Charles R. (1999). Boa constrictor (Boa constrictor). Siar Anthranir Reptiles
  20. ^ a b Stafford, P. 1986. "Pythons and Boas". T.F.H. Publications. ISBN 0-86622-084-4.
  21. ^ Reports of an individual living to 40 years in Philadelphia Zoo.
  22. ^ a b c d Hitch, Rachel; Brooks, Richard. "Common Boa Constrictor (Boa constrictor imperator) Caresheet" (website). Herp Center Network. Retrieved 9 February 2011. 
  23. ^ a b "(BCI) Boa Constrictor Imperator Care Sheet Information. boaconstrictors /u(BCI) Boa Constrictor Imperator Help and Care (BCI) Boa Constrictor Imperator,boaconstrictors,care sheets,information on (BCI) Boa Constrictor Imperator Snakes info, (BCI) Boa Constrictor Imperator help". Repticzone.com. 2006-04-29. Retrieved 2010-03-15. 
  24. ^ a b c d e f g h care sheet. boa-constrictors.co.uk. Retrieved on 2012-08-22.
  25. ^ a b c Fluid Creativity, January 2006, www.fluidcreativity.co.uk. "Boa Constrictor". Reptiles.swelluk.com. Retrieved 2010-03-15. 
  26. ^ "Cedar and Pine Wood Shavings – Problems and Toxicity". Exoticpets.about.com. 2010-06-14. Retrieved 2011-08-01. 
  27. ^ "Boa Constrictors As Pets — Red Tailed Boas". Exoticpets.about.com. 2009-12-14. Retrieved 2010-03-15. 
  28. ^ Pough, F. Harvey (2004). "Herpetology, third edition". ISBN 0-13-100849-8.
  29. ^ a b "Appendices I, II and III". Cites.org. 2009-05-22. Retrieved 2010-03-15. 
  30. ^ a b c d e f g h i "Boa constrictor Page". Boa-constrictors.com. Retrieved 2010-03-15. 
  31. ^ a b c d e f g "The Boa Constrictor Subspecies — Melanogaster". Boa-subspecies.com. Retrieved 2010-03-15. 

Further reading [edit]

  • Stull OG. 1932. Five new subspecies of the family Boidae. Occasional Papers of the Boston Society of Natural History Vol. 8. p. 25–30. pl. 1-2. HTML version available at boa-subspecies.com. Accessed 20 February 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Boa constrictor

For other uses, see Boa constrictor (disambiguation)

The Boa constrictor (Boa constrictor) is a large, heavy-bodied species of snake. It is a member of the Boidae family found in Central America, South America and some islands in the Caribbean. A staple of private collections and public displays, its color pattern is highly variable yet distinctive. Ten subspecies are currently recognized, although some of these are controversial.[2] This article focuses on the species Boa constrictor as a whole, but also specifically on the nominate subspecies Boa constrictor constrictor.

Contents

Common names

Though all boids are constrictors, only this species is properly referred to as "Boa constrictor"; an almost unique instance of an animal having the same common and scientific binomial name. (The distinction is shared with Tyrannosaurus rex.)

All subspecies are referred to as "Boa constrictors", while the nominate subspecies, B. c. constrictor, is often referred to specifically as the "red-tailed boa". Within the exotic pet trade it is also known as a "BCC", an abbreviation of its scientific name, to distinguish it from other Boa constrictor subspecies such as the Boa constrictor imperator which is also regularly, and erroneously, referred to as a "red-tailed boa".

Other common names include "jibóia" (Latin American) and "macajuel" (Trinidadian, pronounced mah-cah-well).[3]

Physical description and anatomy

Size and weight

The Boa constrictor is a large snake, although only modestly sized in comparison to many other larger snakes such as the reticulated and Burmese python, and can reach lengths of anywhere from 1-4 meters (3-13 feet) depending on the locality and the availability of suitable prey.[4] There is clear sexual dimorphism seen in the species with females generally being significantly larger, in both length and girth, than males. As such the average size of a mature female boa is between 7-10 ft, whilst it is only 6-8 ft for the males.[5] It is common for female individuals to exceed 10 ft, particularly in captivity, where lengths of up to 12 ft or even 14 ft can be seen.[6] A report of a Boa constrictor growing up to 18½ ft (5.5m) was later found to be a misidentified green anaconda.[7]

The Boa constrictor is a heavy bodied snake, and large specimens can weight up to 27 kg (60Ibs). [8]

The size, and weight, of a Boa constrictor is dependent on subspecies, locale and the availability of suitable prey. As such there are several populations of Boa constrictors that are known as "dwarf boas", such as the B.c. imperators seen on Hog Island. These smaller subspecies are generally insular populations. Boa constrictor constrictor itself reaches, and occasionally tops, the averages given above, as it is one of the relatively large subspecies of Boa constrictor.[5]

Other examples of sexual dimorphism in the species include the fact that males generally have longer tails to contain the hemipenes and also longer cloacal spurs, pelvic remnants, which are used to grip and stimulate the female during copulation.[9]

Coloring

The coloring of Boa constrictors can vary greatly depending on the locality, however they are generally a brown, grey or cream base color that is patterned with brown or reddish brown "saddles" that become more pronounced towards the tail. It is this coloring that gives Boa constrictor constrictor the common name of "red-tailed boa" as it typically has more red saddles than other boa constrictor subspecies. The coloring works as very effective camouflage in the jungles and forests of its natural range. There are also individuals that exhibit pigmentary disorders such as albinism. Although these individuals are rare in the wild, they are common in captivity where they are often selectively bred to make a variety of different color "morphs". Boa constrictors have an arrow-shaped head that has very distinctive stripes on it. One runs dorsally from the snout to the back of the head. The others run from the snout to the eyes and then from the eyes to the jaw.[5]

BoaConstrictor.JPG

Boa constrictors can sense heat via cells in their lips, though they lack the labial pits surrounding these receptors seen in many members of the boidae family.[10] Boa constrictors also have two lungs, a smaller (non-functional) left and enlarged (functional) right lung to better fit their elongated shape, unlike many colubrid snakes which have completely lost the left lung.

Distribution

Geographic range

A Boa constrictor in Belize

Dependent on subspecies Boa constrictor can be found from northern Mexico through Central America (Belize, Guatemala, Honduras, El Salvador, Nicaragua, Costa Rica and Panama) to South America north of 35°S (Colombia, Ecuador, Peru, Venezuela, Trinidad and Tobago, Guyana, Suriname, French Guiana, Brazil, Bolivia, Uruguay and Argentina). Also in the Lesser Antilles (Dominica and St. Lucia), on San Andrés, Providencia and many other islands along the coasts of Mexico and Central and South America. The type locality given is "Indiis" -- a mistake, according to Peters and Orejas-Miranda (1970).[1]

Habitat

Boa constrictor flourishes in a wide variety of environmental conditions, from tropical rainforests to arid semi-desert country.[11] However, it prefers to live in rainforest due to the humidity and temperature, natural cover from predators and vast amount of potential prey. It is commonly found in or along rivers and streams, as it is a very capable swimmer. Boa constrictor will also occupy the burrows of medium-sized mammals, where it can hide from potential predators.[5]

Behavior

A juvenile female Boa constrictor that is in a shed cycle, note the blue "opaque" eyes

Boa constrictors are solitary animals, and will only associate with conspecifics to mate. They are nocturnal, however they may bask during the day when night-time temperatures are too low. As semi-arboreal snakes, young boa constrictor individuals may climb into trees and shrubs to forage, however they become mostly terrestrial as they become older and heavier.[12] Boa constrictors will strike when threatened, and will bite in defense. This bite can be painful, especially from large snakes, but is rarely dangerous. However, care must be taken to ensure that infection doesn't result from the injury. Specimens from Central America are more irascible, hissing loudly and striking repeatedly when disturbed, while those from South America tame down more readily.[11] Like all snakes, Boa constrictors that are in a shed cycle will be more unpredictable. This is because the substance that lubricates between the old skin and the new will make the eyes appear "milky" or "opaque", and as such the snake cannot see very well. This will cause it to be more defensive than it may be otherwise.

Diet

Prey includes a wide variety of mammals and birds.[12] The bulk of their diet consists of rodents, but larger lizards and mammals as big as ocelots are also reported to have been consumed.[11] Young Boa constrictors will eat small mice, birds, bats, lizards and amphibians. The size of the prey item will increase as they get older and larger.

Boa constrictors are ambush predators and as such will often lie in wait for an appropriate prey to come along at which point they will attack. However, they have also been known to actively hunt, particularly in regions with a low concentration of suitable prey, and this behaviour generally occurs at night. The boa will first strike at the prey, grabbing it with its teeth, it then proceeds to constrict the prey until death before consuming it whole. Their teeth also help force the animal down the throat whilst muscles then move it towards the stomach. It will take the snake approximately 4-6 days to fully digest the food, depending on the size of the prey and the local temperature. After this the snake may not eat for anywhere from a week to several months, due to its slow metabolism.[13]

Reproduction and development

Boa constrictors are ovoviviparous, giving birth to live young. They will generally breed in the dry season—between April and August—and are polygynous, thus males may mate with multiple females.[14] A half of all females will breed in a given year, and a larger percentage of males will actively attempt to locate a mate.[14] However due to the polygynous nature of Boa constrictor many of these males will be unsuccessful. The reasoning being the fact that they are ovovivparous. As such female boas without a good enough physical condition will be unlikely to attempt to mate, nor produce viable young if they do mate.[14] In 2010, a boa constrictor was shown to have reproduced asexually via parthenogenesis.[15]

During breeding season the female boa will emit a scent from her cloaca to attract males, who may then wrestle for the right to breed with her.[10] During breeding the male will curl his tail around the females and the hemipenes will be inserted. Copulation can last from a few minutes to several hours, and may occur several times over a few week period.[16] After this period ovulation may not occur immediately, however the female can hold the sperm inside her for up to one year.[16] When the female ovulates, a mid-body swell can be noticed that appears similar to after the snake has eaten a large meal.[16] The female will then shed 2 to 3 weeks after ovulation, with what is known as a post ovulation shed which will last another 2-3 weeks, which is longer than a normal shed.[16] The gestation period, which is counted from the post ovulation shed, is approximately 100-120 days.[16] The female will then give birth to young that average 15-20 inches (38-51 cm) in length.[12] The litter size varies between females, but can be between 10 and 65 young with an average of 25, although some of the young may be still borns or non fertilised eggs known as "slugs". The young are independent at birth and will grow rapidly for the first few years, shedding regularly (once every one to two months). At between 3-4 years Boa constrictors become sexually mature and will have reached the adult size of between 6-10 ft, although they will continue to grow at a slow rate for the rest of their lives.[17] At this point they will shed less frequently, approximately every 2-4 months.[18]

Captivity

This species does well in captivity, usually becoming quite tame. It is a common sight in both zoos and private reptile collections. Though still exported from their native South America in significant numbers, it is widely bred in captivity. When kept in captivity, they are fed mice, rats, rabbits, chickens and chicks depending on the size and age of the individual. Captive life expectancy is 20 to 30 years, with rare accounts of over 40 years,[19] making them a long-term commitment as a pet. Proper animal husbandry is the most significant factor in captive lifespan, this includes providing adequate space, correct temperatures and humidity and suitable food items.[18]

A vivarium

Young Boa constrictors should be started off in a relatively small enclosure, generally a secure plastic box or terrarium. This enclosure is then increased as the boa grows, as large open spaces are stressful for young snakes. Adults are often housed in 180 cm × 90 cm × 60 cm vivariums, however large females may need even larger enclosures. The general rule is that the minimum length of the enclosure should be two thirds of the snake's length.[20] Snakes are generally kept in separate enclosures, but people have successfully kept females together. Male boas should not be kept together as they may fight. Glass, aquarium-style enclosures are seldom advised by snake keepers as they do not efficiently maintain temperature and humidity.[21]

A thermal gradient should be provided, with a cool end and a warm end where the heat source should be located. The cool end should be maintained at 75–85°F (27–29°C),[22] and the warm end at 86–92°F (30–33°C).[21][22][20] Temperatures should not be allowed to rise above 95°F (35°C) or drop below 75°F (24°C). Cages that are too cold can cause many health problems, ranging from non-digestion of food to pneumonia.[17] The necessary temperature can be provided by a heat mat, ceramic or specific light bulb or other alternative heating systems. All heat sources should be guarded, to prevent burns to the snake, and used in conjunction with a thermostat to prevent overheating. Humidity should be kept at 50%, and raised to 70% when the boa is in shed.[22] However, high humidity should not be maintained for longer than a week, as this raises the risk of infections such as scale rot.[20] Humidity levels can be maintained with a water bowl, and raised by adding more water bowls, moving the current water bowl closer to the heat source or misting the enclosure with a water sprayer. Boa constrictors do not need any special lighting, but should have approximately 12 hours of light and 12 hours of darkness every day to simulate a natural environment. Either a bulb or natural light can be used to provide such conditions.[23][20]

Inside the enclosure a substrate, generally of newspaper or aspen shavings, must be provided.[22] Untreated pine shavings are to be avoided as they contain oils that are toxic to snakes[24]. A water bowl, large enough to provide adequate humidity and that the boa can coil within, must be provided. Another basic essential is adequate hides, at least two (one in the cool end and one in the warm end).[22] Hides can be anything from empty plastic or wooden boxes to specially made hides from a reptile equipment retailer. The hides ensure that the snake feels secure, as stress can result in snakes refusing to eat. Shelves or secure branches are often provided so that boas can climb, but this is not an essential. Fake plants and other natural looking decorations are also commonly provided, but again they are not essential.[22]

A Boa constrictor in a vivarium, note large water bowl

Young boas can be started on small to medium mice and then on to increasing size of rats. Most boas will never need a prey item larger than a large rat, however some big females (8ft+) may require rabbits, guinea pigs and chickens. The general rule for feeding snakes is that a suitable prey item is the girth of the snake at its widest point,[22] as with most snakes (including Boa constrictor) the left and right sides of the lower jaw are joined only by a flexible ligament at the anterior tips, allowing them to separate widely, while the posterior end of the lower jaw bones articulate with a quadrate bone, allowing further mobility, to allow the consuming of large prey. Young snakes can be fed once a week, to promote healthy growth. Adults only need to be fed once every month. Overfeeding (or powerfeeding) the snake can lead to a host of health problems later and can shorten its lifespan. [23] It is natural for snakes to lose their appetite when going into shed as this is a stressful time for them, as such food should not be offered at this time. [23] Water should be changed daily or every other day.

Boas should be handled regularly to maintain their docility. However, large boas should be handled by two people, as these snakes are incredibly powerful.[25] Snakes should never be handled within 48 hours of feeding, due to a risk of regurgitation, or when in a shed cycle.[22]

Economic significance

The Boa constrictor is one of the most exploited snake species. They are very popular within the exotic pet trade, and have been both captured in the wild and also bred in captivity. Today most captive Boa constrictors are captive bred, however between 1977 and 1983 113,000 live Boa constrictors were imported into the United States.[17] These huge numbers of wild caught snakes have put considerable pressure on some wild populations. Boa constrictors have also been harvested for their meat and skins, and are a common sight at markets within their geographic range. After the reticulated python Boa constrictors are the snake most commonly killed for snake skin products, such as shoes, bags and other items of clothing.[17] In some areas they have an important role in regulating the opossum populations, preventing the potential transmission of leishmaniasis to humans.[26] In other areas they are often let loose within the communities to control the rodent populations.

Conservation

All Boa constrictors fall under CITES and are listed under CITES Appendix II, except B.c.occidentalis which is listed in CITES Appendix I.[27]

In some regions Boa constrictor numbers have been severely hit by predation from humans and other animals, and overcollection for the exotic and snake skin trades. However most populations are not under threat of immediate extinction, thus why they are within Appendix I rather than Appendix II.[27]

Subspecies

There are 10 current subspecies of Boa constrictor, however much of these are poorly differentiated and it is thought that further research will redefine many of these subspecies. Some appear to be based more on location than biological differences, such as B.C.Orophias (the St. Lucia Boa).[17]

illustration Boa constrictor eques (Eydoux & Souleyet 1842), synonymized into B. c. imperator
Subspecies[2]Taxon author[2]Common nameGeographic range
B. c. amaraliStull, 1932Amaral's boaBrazil, Bolivia and Paraguay[28]
B. c. constrictorLinnaeus, 1758Red-tailed boaSouth America[28]
B. c. imperatorDaudin, 1803Common northern boaCentral America and northern South America[28]
B. c. longicaudaPrice & Russo, 1991Tumbes Peru boaNorthern Peru[28]
B. c. melanogasterLanghammer, 1983Ecuadorian boaEcuador[29]
B. c. nebulosa(Lazell, 1964)Dominican clouded boaDominica[28]
B. c. occidentalisPhilippi, 1873Argentine boaArgentina and Paraguay[28]
B. c. orophiasLinnaeus, 1758St. Lucia boaSt. Lucia[28]
B. c. ortoniiCope, 1878Orton's boaSouth America[28]
B. c. sabogae(Barbour, 1906)Pearl Island boa"Pearl Islands" off the coast of Panama[28]

There have also been several other subspecies described at different times, but currently these are no longer considered to be subspecies by many herpetologists and taxonomists.[29] These include:

  • Boa constrictor mexicana (Jan 1863): This was described from a single specimen which had 55 dorsal scale rows, but otherwise appeared the same as a B.c.imperator. Since then B.c.mexicana has been included within the B.c.imperator subspecies by most authors, as Smith (1963) commented that no Mexican boas have been proven to have 55 dorsal scale rows. However, there is still controversy as Andrew (1937) reported four Mexican specimens with dorsal scale rows between 56-62.[29]
  • Boa constrictor eques (Eydoux & Souleyet, 1842): Based upon a single specimen from Peru that had one large orbital scale. However, no other such specimens have been found and it is thought that the snake was an aberrant B.c.imperator.[29]
  • Boa constrictor diviniloqua (Duméril & Bibron, 1844): Now known to be synonymous with B.c.orophias.[29]
  • Boa constrictor sigma (Smith 1943): A very controversial possible subspecies from the Tres Marias Islands, Mexico. It appears like a B.c.imperator but has a higher number of ventral scales than B.c.imperator. It is possible a slightly different climate may have caused such a change, but this could then undermine the other insular subspecies such as B.c.orophias and B.c.nebulosa.[29]
  • Boa constrictor isthmica (Garman 1883): Considered synonymous with B.c.imperator. It is from Panama. [29]

See also

References

  1. ^ a b McDiarmid RW, Campbell JA, Touré T. 1999. Snake Species of the World: A Taxonomic and Geographic Reference, vol. 1. Herpetologists' League. 511 pp. ISBN 1-893777-00-6 (series). ISBN 1-893777-01-4 (volume).
  2. ^ a b c "Boa constrictor". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=209569. Retrieved 11 July 2008. 
  3. ^ Mendes J. 1986. Cote ce Cote la: Trinidad & Tobago Dictionary. Arima, Trinidad. p. 92.
  4. ^ Maurice, B. "International Wildlife Encyclopedia, Third Edition". ISBN 0-761472-66-5
  5. ^ a b c d Mattison, C. 2007. "The New Encyclopedia of Snakes". Princeton University Press. ISBN 0-691132-95-X.
  6. ^ Wagner, D. "Boas". Barron's. ISBN 0-812096-26-6
  7. ^ Murphy JC, Henderson RW. 1997. Tales of Giant Snakes: A Historical Natural History of Anacondas and Pythons. Krieger Pub. Co. 221 pp. ISBN 0894649957.
  8. ^ "ANIMAL BYTES — Boa Constrictor". Seaworld.org. http://www.seaworld.org/Animal-info/animal-bytes/animalia/eumetazoa/coelomates/deuterostomes/chordata/craniata/reptilia/squamata/boa-constrictor.htm. Retrieved 2010-03-15. 
  9. ^ O'shea, M. 2007. "Boas and Pythons of the World". Princeton University Press. ISBN 1-845375-44-0.
  10. ^ a b "Boa Constrictor Fact Sheet". Nationalzoo.si.edu. http://nationalzoo.si.edu/Animals/ReptilesAmphibians/Facts/FactSheets/Boaconstrictor.cfm. Retrieved 2010-03-15. 
  11. ^ a b c Stidworthy J. 1974. Snakes of the World. Grosset & Dunlap Inc. 160 pp. ISBN 0-448-11856-4.
  12. ^ a b c Mehrtens JM. 1987. Living Snakes of the World in Color. New York: Sterling Publishers. 480 pp. ISBN 0-8069-6460-X.
  13. ^ Montgomery, G., and Rand, A. 1978. "Movements, body-temperature and hunting strategy of a boa-constrictor"
  14. ^ a b c "ADW: Boa constrictor: Information". Animaldiversity.ummz.umich.edu. http://animaldiversity.ummz.umich.edu/site/accounts/information/Boa_constrictor.html. Retrieved 2010-03-15. 
  15. ^ http://www.livescience.com/animals/first-virgin-birth-boa-constrictors-101103.html
  16. ^ a b c d e "Boa Constrictor Care". Ssscales. http://www.ssscales.com/boa_care.html. Retrieved 2010-03-15. 
  17. ^ a b c d e http://home.att.net/~crinaustin/BoaInfo.pdf
  18. ^ a b Stafford, P. 1986. "Pythons and Boas". T.F.H. Publications. ISBN 0-866220-84-4.
  19. ^ Reports of a individual living to 40 years in Philadelphia Zoo. www.ci.manhattan.ks.us/DocumentView.aspx?DID=1299
  20. ^ a b c d [1][dead link]
  21. ^ a b "(BCI) Boa Constrictor Imperator Care Sheet Information. boaconstrictors /u(BCI) Boa Constrictor Imperator Help and Care (BCI) Boa Constrictor Imperator,boaconstrictors,care sheets,information on (BCI) Boa Constrictor Imperator Snakes info, (BCI) Boa Constrictor Imperator help". Repticzone.com. 2006-04-29. http://www.repticzone.com/caresheets/823.html. Retrieved 2010-03-15. 
  22. ^ a b c d e f g h http://www.boa-constrictors.co.uk/care
  23. ^ a b c Fluid Creativity, January 2006, www.fluidcreativity.co.uk. "Boa Constrictor". Reptiles.swelluk.com. http://www.reptiles.swelluk.com/reptile-care/boa-constrictor.html. Retrieved 2010-03-15. 
  24. ^ http://exoticpets.about.com/cs/guineapigs/a/woodshavings.htm
  25. ^ "Boa Constrictors As Pets — Red Tailed Boas". Exoticpets.about.com. 2009-12-14. http://exoticpets.about.com/cs/snakes/a/boaconstrictors.htm. Retrieved 2010-03-15. 
  26. ^ Plough et al. 2004. "Herpetology, third edition". ISBN 0-131008-49-8.
  27. ^ a b "Appendices I, II and III". Cites.org. 2009-05-22. http://www.cites.org/eng/app/appendices.shtml. Retrieved 2010-03-15. 
  28. ^ a b c d e f g h i "Boa constrictor Page". Boa-constrictors.com. http://www.boa-constrictors.com/com/com.html. Retrieved 2010-03-15. 
  29. ^ a b c d e f g "The Boa Constrictor Subspecies — Melanogaster". Boa-subspecies.com. http://www.boa-subspecies.com/subspecies/melanogaster.htm. Retrieved 2010-03-15. 

Further reading

  • Stull OG. 1932. Five new subspecies of the family Boidae. Occasional Papers of the Boston Society of Natural History Vol. 8. p. 25-30. pl. 1-2. HTML version available at boa-subspecies.com. Accessed 20 February 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!