Overview

Brief Summary

Biology

Whilst known as a 'tree boa', this snake is less arboreal than other tree boas, using trees only when hunting. It is a nocturnal snake, feeding on small mammals and birds, seeking them out using the heat-sensitive pits around its mouth that enable it to hunt for warm-blooded prey in complete darkness. The victims, once captured, are constricted by the powerful coils of the boa which tighten as the prey struggles, restricting the blood flow to the heart and ultimately causing circulatory failure. Boas are not venomous. Boas all give birth to live young - the Madagascar tree boa usually gives birth to fewer than 12 offspring at a time. Pregnancy lasts for six months and the young emerge at just 25 cm long and are red in colour. They attain their adult colours gradually throughout their first year of life (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This medium-sized constrictor occurs in two colour variations. Prevalent mainly in the eastern half of the range is the green to greyish-green form which tends to be about two thirds of the size of the mandarin form which is yellow, orange and brown and occurs in some parts of the western side of the range (2) (4). As with many boa species, there are heat-sensitive pits around the mouth, used for hunting at night (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Continent: Indian-Ocean
Distribution: Madagascar, Nossi Be = Nosy Bé  madagascariensis: E Madagascar volontany: W Madagascar  
Type locality: Madagascar
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The Madagascar tree boa occurs throughout the island of Madagascar except for the most south-westerly corner (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Syntype for Sanzinia madagascariensis
Catalog Number: USNM 10982
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Madagascar, Africa
  • Syntype: Duméril, A. & Bibron, G. . Erpétologie Générale ou Histoire Naturelle complète des Reptiles. 6: 549.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Madagascar tree boa occurs in intact and degraded humid forest as well as plantations and near human settlements (Glaw and Vences 2007). Adults are mostly arboreal in the day and terrestrial at night. The natural diet consist of mammals but it may also feed on frogs and birds. This live-bearing snake gives birth to clutches of 1-19 neonates.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This boa lives in Madagascan forests, from lowland tropical forests and dry forests to humid upland forests (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21.8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sanzinia madagascariensis volontany

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TATCGGCACCCTATATCTACTATTTGGCGCATGATCAGGCCTAATCGGCGCCTGCCTAAGCATTCTAATACGAATAGAGCTAACGCAGCCAGGGTCATTATTTGGAAGCGACCAGATCTTCAACGTTCTAGTAACAGCCCATGCTTTCATCATAATTTTCTTCATAGTAATACCCATTATAATCGGAGGTTTTGGAAACTGATTAATCCCTTTAATAATCGGGGCCCCGGATATAGCTTTCCCACGAATGAATAACATGAGCTTCTGACTTCTTCCACCAGCACTACTTCTTCTTCTATCATCTTCATATGTTGAAGCTGGCGCCGGCACCGGCTGAACCGTGTATCCACCCCTTTCCAGTAATATAGTCCACTCAGGACCATCTGTAGATCTGGCAATTTTCTCACTTCACCTAGCAGGGGCCTCATCAATCTTAGGAGCAATCAACTTCATTACCACATGTATCAACATAAAACCGGCCTCAATACCAATGTTCAATATCCCATTATTTGTATGATCAGTAATAATCACAGCAATTATACTTTTACTAGCATTACCAGTACTAGCAGCAGCAATCACTATATTATTAACAGATCGAAACCTCAACACATCATTCTTCGACCCTTGCGGAGGGGGGGACCCAGTACTATTTCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sanzinia madagascariensis volontany

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Vences, M., Raxworthy, C.J., Rakotondravony, H. & Rafanomezantsoa, J.

Reviewer/s
Cox, N.A. & Bowles, P.

Contributor/s

Justification
This species is listed as Least Concern, as it is widespread, present in heavily degraded habitats and it is not subject to any known or suspected threats.

History
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Madagascar tree boa is classified as Vulnerable (VU A1cd) on the IUCN Red List 2003 (1) and is listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is frequently encountered (Glaw and Vences 2007).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This is a widespread species that can survive in non-forested habitats and no major threats have been identified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat loss through deforestation for human settlement and agricultural practices has meant that the Madagascar tree boa is restricted to the remaining protected areas of Madagascar (2). This amounts to just 10 – 20 % of the original primary forest on the Island (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

This species is on Appendix I of CITES and all international trade in live animals, or body parts, is prohibited. Due to its wide distribution, this species occurs in many protected areas in Madagascar. The taxonomic status of S. m. volontany needs to be clarified, as this may represent a full species, and it may be necessary to identify whether this snake is subject to any presently unknown threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The Madagascar tree boa is part of a captive breeding programme, but the only sure way to ensure its survival is to protect the remaining habitat in Madagascar by implementing sustainable forestry. In September 2003, the president of Madagascar agreed to triple the amount of land under protection from 15,000 km² to 50,000 km² within five years (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sanzinia madagascariensis

Sanzinia madagascariensis (also known as the Malagasy tree boa,[4] or Madagascar tree boa) is a non-venomous boa species endemic to the island of Madagascar. Two subspecies are currently recognized: S. m. madagascariensis and S. m. volontany.[3]

Description[edit]

Sanzinia madagascariensis

Adults average 4–5 feet (122–152 cm) in length, although 6–7 foot (183–213 cm) specimens are not uncommon. Thermoreceptive pits are located between the labial scales.[4] Females are larger than males.

Subspecies[edit]

There are two known subspecies:

Sanzinia madagascariensis madagascariensis is greenish in colour and is found on the east side of Madagascar, while S. madagascariensis volontany is brownish in colour and is found on the western side of the island. The separation of these subspecies has been supported on the basis of genetic data, and they may represent distinct species.[5]

Geographic range[edit]

Endemic to Madagascar. The type locality given is "Madagascar".[2]

Habitat[edit]

Favors trees and shrubs near streams, rivers, ponds and swamps.[4]

Conservation status[edit]

This species was classified as Vulnerable (VU) on the IUCN Red List of Threatened Species in 2006[1] with the following criteria: A1cd (v2.3, 1994). This means that a population reduction of at least 20% has been observed, estimated, inferred or suspected over the last 10 years or three generations, whichever is the longer, based on a decline in area of occupancy, extent of occurrence and/or quality of habitat, and based on actual or potential levels of exploitation.[6] It is now listed as Least Concern (LC) as it is widespread, present in heavily degraded habitats and it is not subject to any known or suspected threats.[1]

Also listed as CITES Appendix I, which means that it is threatened with extinction and CITES prohibits international trade except when the purpose of the import is not commercial, for example for scientific research.[7]

Feeding[edit]

Arboreal and generally nocturnal, S. madagascariensis feeds on mammals and birds. Its thermoreceptive pits help it to locate its prey. It will also leave the trees to actively hunt for small mammals on the ground.[4]

Reproduction[edit]

Ovoviviparous, females give birth to up to 12 young at a time, each about 15 inches (38 cm) in length.[4]

When females become gravid, their skin color darkens. This adaptation provides increased heat absorption for the developing young. After giving birth, the color returns normal as soon as it next sheds its skin. Neonates are a bright red that may warn predators to "stay away", while simultaneously providing camouflage among brightly colored treetop flowers.

Taxonomy[edit]

When Kluge (1991) moved Sanzinia madagascariensis (A.M.C. Duméril & Bibron, 1844) to Boa together with Acrantophis madagascariensis (A.M.C. Duméril & Bibron, 1844), it resulted in homonymy. To fix this nomenclatural problem, he proposed the specific name manditra as a replacement for S. madagascariensis.[2]

It has since been shown that the Malagasy boids and the genus Boa do not form a monophyletic group,[8][9][10] so that the lumping of Sanzinia, Acrantophis and Boa was incorrect, and the name Sanzinia madagascariensis is therefore the correct name for this species.

References[edit]

  1. ^ a b c Vences, M., Raxworthy, C.J., Rakotondravony, H. & Rafanomezantsoa, J. (2011). "Sanzinia madagascariensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 4 March 2014. 
  2. ^ a b c McDiarmid RW, Campbell JA, Touré T. 1999. Snake Species of the World: A Taxonomic and Geographic Reference, Volume 1. Washington, District of Columbia: Herpetologists' League. 511 pp. ISBN 1-893777-00-6 (series). ISBN 1-893777-01-4 (volume).
  3. ^ a b Sanzinia at the Reptarium.cz Reptile Database
  4. ^ a b c d e Mehrtens JM. 1987. Living Snakes of the World in Color. New York: Sterling Publishers. 480 pp. ISBN 0-8069-6460-X.
  5. ^ Glaw, Frank; Vences, Miguel (2007). A Field Guide to Amphibians and Reptiles of Madagascar 3rd edition. Köln: M. Vences & F. Glaw Verlags GbR. ISBN 978-3-929449-03-7. 
  6. ^ 1994 Categories & Criteria (version 2.3) at the IUCN Red List. Accessed 10 July 2008.
  7. ^ Sanzinia madagascariensis at CITES and United Nations Environment Programme / World Conservation Monitoring Centre. Accessed 10 July 2008.
  8. ^ Vences, Miguel; Glaw, F.; Kosuch, J.; Boehme, W.; Veith, M. (2001). "Phylogeny of South American and Malagasy boine snakes: Molecular evidence for the validity of Sanzinia and Acrantophis and biogeographic implications". Copeia 2001 (4): 1151–1154. doi:10.1643/0045-8511(2001)001[1151:posaam]2.0.co;2. 
  9. ^ Noonan, Brice; Chippindale, P. (2006). "Dispersal and vicariance: The complex evolutionary history of boid snakes". Molecular Phylogenetics and Evolution 40: 347–358. doi:10.1016/j.ympev.2006.03.010. 
  10. ^ Reynolds, R.G.; Niemiller, M.L.; Revell, L.J. (2014). "Toward a Tree-of-Life for the boas and pythons: Multilocus species-level phylogeny with unprecedented taxon sampling". Molecular Phylogenetics and Evolution 71: 201–213. doi:10.1016/j.ympev.2013.11.011. 

Further reading[edit]

  • Boulenger GA. 1893. Catalogue of the Snakes in the British Museum (Natural History). Volume I., Containing the Families ... , Boidæ, ... London: Trustees of the British Museum (Natural History). (Taylor and Francis, printers). xiii + 448 pp. + Plates I-XXVIII. (Corallus madagascariensis, 103-104).
  • Duméril A-M-C, Bibron G. 1844. Erpétologie générale ou Histoire naturelle complète des Reptiles, Tome sixième. Paris: Roret. xii + 609 pp. (Xiphosoma madagascariense, pp. 549-552).
  • Gray JE. 1849. Catalogue of the Specimens of Snakes in the British Museum. London: Trustees of the British Museum. (Edward Newman, printer). xv + 125 pp. (Sanzinia madagascariensis, p. 99).
  • Kluge AG. 1991. Boine Snake Phylogeny and Research Cycles. Misc. Pub. Museum of Zoology, Univ. of Michigan No. 178. 58 pp. PDF at University of Michigan Library. Accessed 11 July 2008.
  • Vences M, Glaw F, Kosuch J, Böhme W, Veith M. 2001. Phylogeny of South American and Malagasy Boine Snakes: Molecular Evidence for the Validity of Sanzinia and Acrantophis and Biogeographic Implications. Copeia No 4. p. 1151-1154. PDF at Miguel Vences. Accessed 29 August 2008.
  • Vences M, Glaw F. 2003. Phylogeography, systematics and conservation status of boid snakes from Madagascar (Sanzinia and Acrantophis). Salamandra, Reinbach, 39(3/4): p. 181-206. PDF at Miguel Vences. Accessed 29 August 2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!