Overview

Distribution

Broad-snouted caimans (Caiman latirostris) are found in northeastern South America. Their geographic range extends from northeast Argentina to southeastern Bolivia and Paraguay to the northern portion of Uruguay. This species thrives in swampy slow-moving freshwater and warmer climates.

Biogeographic Regions: neotropical (Native )

  • Britton, A. 2010. "Crocodilian Species - Broad-snouted Caiman (Caiman latirostris)" (On-line). Crocodilians: Natural History & Conservation: Crocodilian.com. Accessed October 10, 2010 at http://www.flmnh.ufl.edu/cnhc/csp_clat.htm.
  • Verdade, L. 2008. "Species List-Caiman Latirostris" (On-line). Crocodile Specialist Group. Accessed October 02, 2010 at http://iucncsg.org/ph1/modules/Home/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:

Brazil, Argentina, Paraguay, Uruguay

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: South-America
Distribution: N Argentina, SE Brazil (Rio Grande do Sul), Bolivia, Paraguay, Uruguay  
Type locality: Joinvilla, Santa Catarina, Brasil (designated by FREIBERG & CARVALHO 1965)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Broad-snouted caimans are medium-sized crocodilians with a reported maximum length of 3.5 m. Average length is 2 m in captivity. Compared to related species like black caimans (Melanosuchus niger), which can exceed 5m in length, broad-snouted caimans are considered small. Their coloration ranges from black and brown to an olive-greenish hue. They have a tubercle, a small projection of the scales, between the eyes. Broad-snouted caimans have soft hides that are one of the most highly coveted of all crocodile skins. It is a subject of debate wether or not true subspecies exists. Some say Argentinian populations of C. latirostris that are small (less than 2m) should be classified as C. latirostris chacoensis.

Range length: 3.5 (high) m.

Average length: 2 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Broad-snouted caiman habitat overlaps with that of Yacare caimans (Caiman yacare). In places where overlap occurs, C. latirostris has adapted to life in mangroves with heavy vegetation, swamps and they have been increasingly found in cattle stock ponds. They are also often found in drainage ditches from the Atlantic ocean. Both species are found at elevations of approximately 600 m. This seems to be due to their darker coloration, which allows each species to absorb more sunlight and to regulate their body temperatures at higher, cooler elevations.

Range elevation: 600 (high) m.

Habitat Regions: tropical ; terrestrial ; freshwater

Aquatic Biomes: lakes and ponds; brackish water

Wetlands: swamp

Other Habitat Features: agricultural ; estuarine

  • Pina, C. 2002. Thermoregulation. Herpetological Review, 33/2: 133.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Broad-snouted caimans have a diverse diet consisting of aquatic snails, small fish, and amphibians. As they mature, they are able to eat larger prey, such as larger fish, reptiles, and amphibians. The broad snout of these caimans are well-suited for crushing mollusc shells.

Animal Foods: amphibians; reptiles; fish; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Little is known about the roles these crocodilians play in their ecosystem. They are likely to be important predators of small animals in their aquatic habitats.

Ecosystem Impact: creates habitat

  • Simoncini, M., C. Pina, P. Siroski. 2009. Clutch size of Caiman latirostris (Crocodylia: Alligatoridae) varies on a latitudinal gradient. North-Western Journal of Zoology, 5/1: 191-196.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The only predator of mature broad-snouted caimans appears to be humans. Broad-snouted caimans are in high demand because of their skin, which is one of the softest available. They were poached nearly to extinction in the early's 1990's but have made a significant recovery due to ranching programs, like Proyecto Yacare in Argentina. Ranching programs harvest eggs and raise hatchlings to be reintroduced into the wild. Eggs and young broad-snouted caimans may be eaten by a wide variety of medium to large sized predators. Broad-snouted caimans are cryptically colored to prevent predators and prey from seeing them.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Specific information on broad-snouted caimans is not available. Crocodilian communication has received relatively little study. However, among several species, different calls have been identified. It is known that crocodilians communicate acoustically and that most noises are short, monosyllabic, and very repetitive. They become less vocal as they mature.

There are two variations of calls, those of juveniles and those of adults. Juveniles emit hatching calls, which include the noises that can be heard pre-hatching. These calls function to maintain synchrony among hatchlings. One hatched they emit contact calls which aid in location and keeping them close together. Hatchlings also displays distress calls that may induce parental protection.

Among the adult population, communication dwindles with maturity, though audible communication is a large part of courtship rituals. Mates will bellow during courship, usually when the crocodile is in the water. Maternal growls are the way in which mothers communicate with their hatchlings while still in the egg and is thought to facilitate offspring recognition. Hisses may be used when the mother in defending her nest against predators, and may actually deter predators.

Communication Channels: acoustic

Other Communication Modes: vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

  • Kelly, L. 2006. Evolution's Greatest Survivor Crocodile. Crows Nest, Australia: Allen and Unwin.
  • Larriera, A., C. Pina, P. Siroski, L. Verdade. 2004. Allometry of Reproduction in Wild Broad-Snouted Caimans (Caiman latirostris). Society for the Study of Amphibians and Reptiles, 38/2: 301-304.
  • Pina, C., A. Larriera, M. Medina, G. Webb. 2007. Effects of Incubation Temperature on the Size of Caiman latirostris (Crocodylia: Alligatoridae) at Hatching and after One Year. Journal of Herpetology, 41/2: 205-210.
  • Pina, C., P. Siroski, A. Larriera, V. Lance, L. Verdade. 2007. The temperature-sensitive period (TSP) during incubation of broad-snouted caiman (Caiman latirostris) eggs. Amphibia-Reptilia, 28: 123-128.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Embryos of C. latirostris hatch after 70 days. Embryos have a notochord by day 2, blood vessels are present by day 5, and limbs are starting to form around day 18. From day 60 on, not much new development occurs, the yolk sac becomes nourishhment for the embryo and the yolk scar begins to form.  Sex is determined by temperature. There is a specific period during incubation where the egg can become either sex with the application or reduction of heat. After this temperature sensitive period the sex can no longer be changed. All C. latirostris eggs incubated at temperatures of 29 to 31 degrees become females, while hatchlings incubated at 33 degrees are all males.

Development - Life Cycle: temperature sex determination

  • Iungman, J., C. Pina, P. Siroski. 2008. Embryological Development of Caiman latirostris. Genesis, 46: 401-417.
  • Pina, C., A. Larriera. 2003. Crocodylia. Herpetological Review, 34/1: 72.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Broad-snouted caimans have been reported to live 22 years (maximum lifespan) in captivity.

Range lifespan

Status: captivity:
22 (high) years.

  • Snider, A., J. Bowler. 1992. Longevity of reptiles and amphibians in North American collections, 2nd edition. Oxford, OH: Society for the Study of Amphibians and Reptiles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating behavior in broad-snouted caimans is not well described in the literature.

Mating System: polygynandrous (promiscuous)

Each clutch contains between 20 and 50 eggs. Nest predation decreases clutch size and sometimes larger broad-snouted caimans will eat hatchlings and eggs. The gestation period is about 70 days. The gestational period has been broken down in 28 phases or steps of development that monitor size and the specialization of tissues. It is thought that the first rains may stimulate ovulation in female broad-snouted caimans. Other crocodilians of similar size to C. latirostris have hatchlings that measure an average of 30 g at birth.

The age of sexual reproduction is not yet known, though females as young a 4 years, 10 months have laid eggs. The hatchlings emerge as small versions of mature broad-snouted caimans.

Breeding interval: Broad snouted caimans breed during the rainy season each year. It is thought that the first rains stimualte ovulation in females.

Breeding season: Breeding and nesting vary by region. In Brazil, breeding occurs from August to January. In Uruguay they breed in January and, in Argentina, these caimans breed from January to March.

Range number of offspring: 20 to 50.

Average number of offspring: 30.

Average gestation period: 70 days.

Range age at sexual or reproductive maturity (female): 4 to 10 years.

Average age at sexual or reproductive maturity (female): 5 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; induced ovulation ; oviparous

Though broad-snouted caiman mothers invest in their young through supplying eggs with nutrition and building and protecting nests, it is unknown how long that investment lasts or when independence is achieved. A female C. latirostris is very protective of her nest and will guard it with some help from the father (only seen in captive populations). Hatchlings communicate with their mother through hatching calls a few days prior to hatching. Similar to other reptiles, they have an egg tooth on the top of the snout, with which they chip at the egg. Mothers may gently take the egg in her jaws and apply slight pressure in order to help crack the egg. There may be some protection of young after hatching, as in other crocodilians.

Parental Investment: male parental care ; female parental care ; pre-fertilization (Protecting: Male); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Female)

  • Amavet, P., J. Villardi, E. Rosso, B. Saidman. 2009. Genetic and Morphometric Variability in Caiman latirostris (broad-snouted caiman). Journal of Experimental Zoology, 311A/4: 258-269.
  • Larriera, A., P. Siroski, C. Pina, A. Imhof. 2006. Sexual Maturity of Farm-Released Caiman latirostris (Crocodylia: Alligatoridae) in the Wild. Hepretological Review, 37/1: 26-28.
  • Pina, C., A. Larriera. 2003. Crocodylia. Herpetological Review, 34/1: 72.
  • Verdade, L. 2008. "Species List-Caiman Latirostris" (On-line). Crocodile Specialist Group. Accessed October 02, 2010 at http://iucncsg.org/ph1/modules/Home/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caiman latirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACTTTATCTTCGGAACTTGAGCCGGAATAGTAGGAACAGCCCTTAGCCTCCTCATCCGAACAGAACTAAGCCAGCCCGGACCCCTCCTAGGGGACGACCAAATCTACAACGTAATTGTCACCGCCCATGCTTTTATTATAATCTTCTTTATAGTAATACCCATCATGATCGGAGGATTTGGAAACTGACTCCTTCCCTTAATAATTGGGGCCCCAGACATGGCATTCCCCCGAATAAATAACATAAGCTTCTGATTACTGCCCCCATCCTTCACACTACTGCTTGCCTCCTCTTGTATTGAAGCAGGAGCTGGAACAGGATGAACCGTCTACCCCCCTCTAGCCGGAAACCTAGCTCACGCCGGACCATCCGTAGACTTAACAATCTTCTCACTTCACCTTGCCGGAGTATCCTCCATCCTGGGGGCAATTAATTTCATCACAACAGCTATTAACATAAAACCCCCAGCCATGTCCCAATACCAAACACCACTGTTTGTTTGGTCTGTCTTGATCACAGCCGTACTTCTCCTACTATCACTACCAGTGCTAGCTGCCGGAATTACCATACTACTTACAGACCGAAACTTAAACACAACCTTCTTCGACCCCGCAGGAGGAGGAGACCCCATCCTATA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Caiman latirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Commercial hunting has threatened wild populations of C. latirostris. Most hunting occurs for its skin, especially well-suited to tanning. Their skin is considered more valuable that that of other species of caiman. Caiman latirostris was placed on the Endangered Species List in 1994, as populations declined with over-hunting. This species continues to be listed in CITES Appendix I (threatened with extinction) throughout its natural range, except in Argentina, where populations have begun to rebound in response to ranching programs like Proyecto Yacare. As a result of ranching programs, Argentinian populations have been elevated to Appendix II status (no longer threatened with extinction, but a species for which trade needs to be controlled). Some illegal hunting of C. latirostris still occurs, but is considered less of a threat than in the past, because other species are more readily available for hunting. The size of wild C. latirostris populations is estimated at approximately 250,000 to 500,000 individuals. Currently, habitat destruction and water pollution are the greatest threat to C. latirostris populations, most notably deforestation for agriculture (land clearing and draining) and hydroelectric power throughout its range in Brazil and Uruguay.

US Federal List: endangered

CITES: appendix i; appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: lower risk - least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

History
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Entire

Status: Threatened
Date Listed: 06/25/2013
Lead Region: Foreign (Region 10) 
Where Listed: Argentina DPS


Population detail:

Population location: Argentina DPS
Listing status: T

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Caiman latirostris , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I (except the population of Argentina, which is included in Appendix II).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

In areas where their habitat overlaps with C. yacare, C. latirostris has colonized cattle stock ponds. Here they are considered a potential nuisance for farmers and their livestock.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Broad-snouted caimans are prized for their ultra-soft hides. Hunting in the 1990's led to severe population declines. This species was placed on the Endangered Species List in 1994. They are now making a recovery due to ranching programs.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Broad-snouted caiman

The broad-snouted caiman (Caiman latirostris) is a crocodilian reptile(an alligator) found in eastern and central South America, including southeastern Brazil, northern Argentina, Uruguay, Paraguay and Bolivia.[1] It is found mostly in freshwater marshes, swamps, and mangroves. Usually, in still or very slow moving waters.[2] It will often utilize human made cow ponds.[3]

Contents

Appearance

In the wild it will normally grow to 2 meters, however few males have been recorded to reach up to 3.5 meters.[4] Most tend to be of a light olive-green color. A few individuals will have spots on their face.[5] The most notable physical characteristic is its broad snout from which its name is derived.[6] The snout is well adapted to rip through the dense vegetation of the marshes. Due to this they will swallow some of the dense vegetation, while foraging for food.[7]

Diet

Its diet consists mainly of small invertebrates, and it can crush shells to feed on turtles and snails.[8] As the size of the Caiman laitrostris increases the size of its prey tends to increase. All broad-snouted caiman will have a diet consisting of mostly insects however, as the caiman grows it will increase its intake of birds, fish, and reptiles.[9]

Temperature Control

As all other reptiles, the Broad-snouted caiman is ectothermic, it depends on its external environment to regulate its body temperature. A recent study has been done on the heart rate's contribution to the regulation of the Caimans' body temperature. The results showed an increase in heart rate as the temperature increased, and that it would lower once the temperature lowered.[10] The heat of the sun is absorbed through the skin into the blood, keeping its body temperature up. An increased heart rate helps the newly absorbed heat transfer throughout the body more quickly. When the air becomes cooler there would be no need for the temperature becomes cooler there would be no need for the heart rate to remain at an increased speed.[11]

Reproduction

The Broad-snouted Caiman female will lay 18 to 50 eggs at a time. While rare, up to 129 eggs have been found within a single nest. This is presumably from several leyings.[12] They will lay their eggs in two layers. There is a slight temperature difference between the two layers. This will result in a more even ratio of males and females.[13] This occurs because the Caiman does not have a pair of sex chromosomes, but instead depends on temperature to determine the ratio of male and female offspring. The warmer it is the eggs will develop females and the cooler temperatures will develop males. The temperature difference needed for this varies by only one degree, 32 degrees Celsius and above the eggs will become female, 31 degrees Celsius and below they will become male.[14]

Conservation

Hunting of the species began in the 1940s. It's skin is greatly valued for its smooth texture. Until recently this was the largest threat to the Broad-snouted caiman. However, most countries have made hunting them illegal, which had helped them to regain their population.[15] The new threat is habitat destruction.[16] Deforestation and pollution run-off are the two leading causes to the destruction of their habitat.[17]

Curiosity

It is a very well known specime in the urban area of Barra da Tijuca, specially in Recreio dos Bandeirantes.

References

  1. ^ Crocodile Specialist Group (1996). Caiman latirostris. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006.
  2. ^ Verdade,L.M. Alejandro,L. and Pina, C.I. "Broad-snouted Caiman latirostris . Animal Ecology Laboratory, Department of Biological Sciences. http://www.iucncsg.org/ph1/modules/Publications/ActionPlan3/04_Caiman_latirostris.pdfIts. 2010. pp. 18-22.
  3. ^ Britton, Caiman latirostris (Daudin, 1801). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_clat.htm. 2009.
  4. ^ Verdade,L.M. Alejandro,L. and Pina, C.I. "Broad-snouted Caiman latirostris . Animal Ecology Laboratory, Department of Biological Sciences. http://www.iucncsg.org/ph1/modules/Publications/ActionPlan3/04_Caiman_latirostris.pdfIts. 2010. pp. 18-22.
  5. ^ Britton, Caiman latirostris (Daudin, 1801). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_clat.htm. 2009
  6. ^ Britton, Caiman latirostris (Daudin, 1801). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_clat.htm. 2009.
  7. ^ Borteiro, C. Gutierrez, F. Tedros, M. and Kolenc, F. Food habits of the Broad-snouted Caiman (Caiman Latirostris:Crocodylia, Alligatoridae) in northwestern Uruguay. Studies on Neotropical Fauna and Enviornment. Vol. 44, No. 1, April 2009, 31-36.
  8. ^ Britton, Caiman latirostris (Daudin, 1801). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_clat.htm. 2009.
  9. ^ Borteiro, C. Gutierrez, F. Tedros, M. and Kolenc, F. Food habits of the Broad-snouted Caiman (Caiman Latirostris:Crocodylia, Alligatoridae) in northwestern Uruguay. Studies on Neotropical Fauna and Environment. Vol. 44, No. 1, April 2009, 33-35.
  10. ^ Micheli, M.A. Campbell, H. A. Autonomic control of heart rate exhibits diurnal shifts in a crocodilian.Amphibia-Reptilia, Vol. 29 Issue 4, 2008. 567-571.
  11. ^ Micheli, M.A. Campbell, H. A. Autonomic control of heart rate exhibits diurnal shifts in a crocodilian.Amphibia-Reptilia, Vol. 29 Issue 4, 2008. 567-571.
  12. ^ Verdade,L.M. Alejandro,L. and Pina, C.I. "Broad-snouted Caiman latirostris . Animal Ecology Laboratory, Department of Biological Sciences. http://www.iucncsg.org/ph1/modules/Publications/ActionPlan3/04_Caiman_latirostris.pdfIts. 2010. pp. 18-22.
  13. ^ Britton, Caiman latirostris (Daudin, 1801). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_clat.htm. 2009.
  14. ^ Lang, J.W. "Sex Determination."Crocodiles and Alligators. Ross, C.A. Garnett, S. Dr. Facts on File, New York. 1989. 120.
  15. ^ Verdade,L.M. Alejandro,L. and Pina, C.I. "Broad-snouted Caiman latirostris . Animal Ecology Laboratory, Department of Biological Sciences. http://www.iucncsg.org/ph1/modules/Publications/ActionPlan3/04_Caiman_latirostris.pdfIts. 2010. pp. 18-22.
  16. ^ Verdade,L.M. Alejandro,L. and Pina, C.I. "Broad-snouted Caiman latirostris . Animal Ecology Laboratory, Department of Biological Sciences. http://www.iucncsg.org/ph1/modules/Publications/ActionPlan3/04_Caiman_latirostris.pdfIts. 2010. pp. 18-22.
  17. ^ Britton, Caiman latirostris (Daudin, 1801). Crocodilian Species List.http://www.flmnh.ufl.edu/cnhc/csp_clat.htm. 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!