Overview

Brief Summary

The yacare caiman is a crocodilian that is that inhabits a small area of South America including southern Brazil and Bolivia, Paraguay and northern Argentina. The species has a population of over 10 million individuals in the Pantanal tropical wetland. As a smaller than average crocodilian, the yacare caiman feeds mostly on smaller animals like fish, snails, crabs and birds. The species generally builds a mound nest and protects their eggs when the risk of human interaction is high. The largest risk to the yacare caiman population is illegal hunting for the animal's hide.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Continent: South-America
Distribution: N Argentina, S Brazil, S Bolivia, Paraguay  medemi: Bolivia, Beni  
Type locality: Paraguay.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Bolivia, Argentina, Peru, Brazil

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

General Description

The dentition of the yacare is different from similar species in that the larger teeth on the lower jaw can protrude on the surface of the snout by passing through the upper jaw. The species also has a set of rings near the eyes called spectacles. These spectacles form by the extension of ridges around the eye.

The yacare can have a reddish hue.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Size

Body size

The yacare caiman is a smaller than average crocodilian, but there have been isolated, unconfirmed accounts of the species growing up to 13 feet (4 meters) long. In general, males tend to be a bit larger, with a maximum size of approximately 10 feet (3 meters). The average adult size is closer to 2-2.5 meters.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The yacare caiman is most noted in the Paraguay and Paraná River systems throughout southern Brazil and Bolivia, Northern Argentina and all of Paraguay. The animal is associated with floating mats of vegetation.

The yacare caimans in the Brazilian Pantanal, a tropical wetland, are one of the largest populations of crocodilians in the world.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Diet

The yacare caiman feeds on a variety of animals including aquatic snails, crabs, small snakes, fish, birds and large rodents.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Food web

The yacare caiman is at its lowest level a secondary consumer. It feeds on several primary consumers, as well as other consumers. This crocodilian is not at the top of food chain, as it is prey to jungle cats such as the jaguar, and prone to attack by large snakes. The young yacare caimans are especially susceptible to becoming a meal for a predator.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Egg success and development

While eggs are mostly laid in forest nests, they also occur on floating grass mats. Flooding often occurs on these mats, but significantly reduces the risk of predation. While forest nests also flood at times, the main risk for this type is predation.

Sex determination in the yacare caiman is based on temperature. Higher temperatures generally produce males, while lower temperatures generally produce females. A study by Zilca Campos showed that in Pantanal, Brazil, all temperatures above 31.5 degrees Celsius produced males, and under 30.5 always yielded females.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Nesting and eggs

Like other oviparous animals, egg clutch size and egg size increase as the size of the female increases. In general, the clutch size is between 25-35 eggs, and the peak level of egg laying is during the middle of wet season. The caimans build mounds for nests, which are located in forest within a few meters of the water. The nests are generally found at the base of trees, and built up using twigs, dirt, leaves and any other small things the mother found. Mothers guard their nests occasionally, the defense varies based on surrounding activity. In general, the eggs hatch in late March to early April after approximately 70 days of incubation.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Caiman yacare

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Caiman crocodilus yacare

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACTTTATCTTCGGAACCTGGGCCGGAATAGTAGGAACAGCACTTAGCCTCCTCATCCGAACAGAACTAAGCCAGCCCGGACCCCTCCTAGGAGACGACCAAATCTACAACGTAATTGTTACCGCCCACGCCTTCATTATAATCTTTTTTATAGTAATACCCGTCATGATCGGCGGATTTGGAAACTGACTCCTCCCCTTAATAATTGGAGCCCCAGACATGGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTACCCCCATCTTTCACACTACTGCTTGCCTCCTCTTGCATTGAAGCAGGAGCTGGAACAGGATGAACCGTCTACCCCCCTCTAGCCGGAAACCTAGCTCACGCCGGACCATCCGTAGATTTAACAATCTTCTCACTACATCTTGCCGGAGTATCCTCTATCCTAGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCCCCAGCCATATCCCAATACCAAACACCACTATTTGTTTGATCTGTCTTAATCACAGCCGTACTCCTCTTGCTAGCCCTACCGGTACTAGCCGCTGGAATTACTATACTACTTACAGACCGAAACTTAAACACAACTTTCTTTGACCCTGCGGGAGGAGGAGACCCCATCCTATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caiman crocodilus yacare

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

Justification
Widespread and numerous populations, although locally depleted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: T

For most current information and documents related to the conservation status and management of Caiman yacare , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Human Effects

While generally human intervention and poaching in a population is a negative thing, in some areas the yacare has benefited from human impact. The populations of this animal have declined due to hunting in countries such as Bolivia and Paraguay, but the trend seems to be reversed in areas such as the Pantanal in Brazil. Poachers generally are able to find the largest caimans during the dry season, where they are often captured and killed for their hides. The smaller individuals are left alone, and as humans decreased the number of large individuals, more small caimans were able to fill in their space. So effectively, humans have decreased the average body size, but increased the population size in some areas.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The major threat that haunts the Yacare caiman is the widespread illegal hunting. While the problem has decreased since its peak in the 1980's and 1990's, larger caimans are still killed for their hide. The yacare caiman is particularly susceptible due to its wider than average flanks, the area which is most commonly used for manufacturing products. Caiman skins, including the yacare, compose a majority of the alligator skins that are sold in the world. While illegal in Brazil, the Paraguayan and Bolivian poachers often still catch and sell yacare caimans in their own countries and through illegal hunting in other countries.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joshua Fries

Supplier: Joshua Fries

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yacare caiman

The Yacare caiman (Caiman yacare, jacaré in Portuguese) is a species of caiman found in central South America, including northeastern Argentina, Uruguay, southeastern Peru, eastern Bolivia, central/southwest Brazil, and the rivers of Paraguay. About 10 million individual Yacare caimans exist within the Brazilian pantanal, representing what is quite possibly the largest single crocodilian population on Earth. As a medium to small-sized crocodilian, most adult male individuals grow to roughly 2 or 2.5 m (6.6 or 8.2 ft) in length, with the occasional 3 m (9.8 ft) individual (reports of occasional 4 m (13 ft) individuals within the pantanal are yet to be verified). Females are rather smaller at an average of 1.4 m (4.6 ft). Body mass in this species can range up to 58 kg (128 lb) in males and from 14 to 23 kg (31 to 51 lb) in females.[2] Their relatively smaller size makes them a potential prey of the jaguar and anaconda.[citation needed] This species' diet consists primarily of fish (especially piranha) and birds, with the occasional capybara being taken by larger adults. In general, due to their small size, this species is not considered as fatally dangerous to humans.

Gallery[edit]

References[edit]

  1. ^ Crocodile Specialist Group (2008). Caiman yacare. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 17 August 2009. Database entry includes a brief justification of why this species is of Lower Risk/least concern.
  2. ^ [1]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!