Overview

Distribution

Range Description

This speciesis endemic to Madagascar where it occurs in the west and south of the island at sites lower than 120 m above sea level (Raselimanana and Rakotomalala 2003, Glaw and Vences 2007). The chameleon's estimated extent of occurrence is approximately 211,300 km.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Indian-Ocean
Distribution: Madagascar (except of the E and N )  
Type locality: Ile Bourhon (= Réunion)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

This species is abundant in degraded habitats and anthropogenic areas in dry regions of western Madagascar and is not dependent on the presence of large tracts of intact forest (Andriamandimbiarisoa 2007). Although it is frequently recorded in zoological surveys, these tend to only provide presence and absence data from multiple sites and information on the habitat and ecology of this widespread species is surprisingly scarce. Adult and subadult warty chameleons survive the harsh austral winter by aestivating in the soil. It is a perennial species (Karsten et al. 2009).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Furcifer verrucosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CATCGGCACTCTGTATTTTTTATTTGGTTTGGCTGCCGGACTAGTTGGAGCCACCTCAAGTCTTATTATACGAACAAAATTGGGCCAACCCGGGTTTTCCCTAGGAGATGACCACGCATATAACGTACTAATTACCCTACACGGCCTAACCATAATTTTTTTTATGGTCATACCAATTATAATCGGCGGATTTGGCAACTGACTTGTACCATTAATATTAGGTGCACCCGATATAGCATTTCCACGAATAAACAACATAAGCTTTTGACTACTGCCCCCCTCATTTTTACTTCTATTAGCCTCATCTAAGTCTGGAACCGGAGTTGGAACAGGGTGGACTATTTATCCCCCCCTTTCAGGAAACCTGGCCCATGCTGGCCCATCAATAGACCTAGCGATCTTCTCACTCCACTTAGCTGGGATCTCATCCATCCTTGCCTCAATTAACTTTATTACAACAAGCATCAACATAAAACCACACTACATAGTACTATACAACATCCCACTATTTGTATGGTCTGTCCTATTAACTGCAACCCTCCTTCTCCTAGCTTTGCCAGTTCTGGCTGCAGCCATCACCATGCTCCTAACAGATCGCAACCTAAATACAGCATTTTTTGACCCTGTGGGAGGCGGAGACCCCATTCTATTCCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Furcifer verrucosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Jenkins, R.K.B., Andreone, F., Andriamazava, A., Anjeriniaina, M., Brady, L., Glaw, F., Griffiths, R.A., Rabibisoa, N., Rakotomalala, D., Randrianantoandro, J.C., Randrianiriana, J., Randrianizahana , H., Ratsoavina, F. & Robsomanitrandrasana, E.

Reviewer/s
Bowles, P. & Tolley, K.

Contributor/s

Justification
Listed as Least Concern as the species is widespread across western Madagascar, and abundant even in degraded habitats and anthropogenic areas. Taxonomic changes will require reassessment of this species, and if it is found to be considerably less widespread and more ecologically specialized than is currently recognized, it may require listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

In a field assessment of three Furcifer chameleons near Toliara, the warty chameleon was the most common species and constituted 69% of the 146 individuals encountered during line transects at night. A density of 67.7 individuals per hectare was calculated (Andriamandimbiarisoa 2007). Karsten et al. (2009) also reported a high local population density of this species, at 97.7 per ha.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Because this species is widely distributed in southwestern Madagascar and can survive in degraded habitats the loss of native forest vegetation probably does not pose a major threat. Similarly, the removal of individuals from the wild for export does not pose a threat because the current export quota is rather low, there is only a low commercial demand for the species and it has a relatively wide distribution in disturbed areas, where it can reach high densities (Karsten et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

This species is listed on CITES Appendix II. It has been recorded inside Parc National d'Andohahela, Parc National Zombitse-Vohibasia (Raselimanana and Rakotomalala, 2003) and Parc National de Tsimanampetsotsa (Goodman et al. 2002). Taxonomic studies on morphology and genetics are urgently needed because there may be undescribed species within the taxon currently referred to as F. verrucosus, and these would by default have smaller geographical ranges and could be more dependent on native vegetation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Warty chameleon

Furcifer verrucosus, also known as the warty chameleon, spiny chameleon or crocodile chameleon, is a species of small reptile endemic to Madagascar. It was first described by Georges Cuvier in 1829.

Taxonomy[edit]

There are two subspecies, Furcifer v. verrucosus and Furcifer v. semicristatus, the latter being found mainly in the southernmost part of the island. This chameleon is closely related to Oustalet's chameleon Furcifer oustaleti (Malagasy giant chameleon), the pair forming a species complex, but each member of the group may be a cryptic species (two species indistinguishable in the field and currently believed to be a single species) and the exact taxonomical relationship between members of the group is unclear.[2]

Description[edit]

The warty chameleon is a large species with males growing to a total length of 56 centimetres (22 in) and females reaching 21 cm (8 in). On its head it has a casque, a helmet-like crest formed from scales. A small crest runs along a raised ridge from its eyes to its snout. There are further low crests running along the flanks, down the throat and along the belly. A distinctive crest of up to forty 4 millimetres (0.16 in) spines runs along the back in males but this is cut short in females, continuing along the spine as tubercles. Both sexes have a row of large scales forming a lateral line. The long tail is prehensile. The general colour of this chameleon is grey or brown variously blotched or indistinctly banded, with a white intermittent streak along each side. Females are usually paler in colour and males are often tinged with green on the belly, tail and limbs.[2]

Distribution and habitat[edit]

The warty chameleon is found only on the island of Madagascar including Manderano in the Tulear region. It occurs over much of the west part of the island and in drier parts of the south. It is seldom found in primary rainforest but favours arid disturbed land, including near the sea. It is a terrestrial species and also climbs around in low bushes. In hot weather it sometimes retreats into a sandy burrow to keep cool.[2][3]

Biology[edit]

The warty chameleon feeds largely on insects which it catches with its long sticky tongue. The female lays one clutch of 30 to 60 eggs a year and these are incubated for about 200 days. They hatch into juvenile chameleons which may take six months to a year to become mature.[3]

References[edit]

  1. ^ a b Uetz, Peter. "Furcifer verrucosus (Cuvier, 1829)". The Reptile Database. Retrieved 2013-01-25. 
  2. ^ a b c Bowles, Philip. "Warty chameleon". The Online Field Guide. Retrieved 2013-01-25. 
  3. ^ a b Vaucher, Pierre-Yves (2012-06-12). "Furcifer verrucosus". Bactraciens et Reptiles du Monde (in French). Retrieved 2013-01-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!