Overview

Brief Summary

Summary

Chelus fimbriata, the matamata turtle (Family Chelidae), is the largest member of its pleurodiran family, and is surely the most bizarre turtle in the world. It has an exceedingly rough, tuberculate carapace, a greatly elongated and thickened neck, and a wide, triangular, extremely flattened head, with a tubular nasal extension, reduced anteriorly displaced eyes, and an extremely wide mouth. It is specialized for feeding upon live fish that it sweeps into its mouth by a rapid lateral strike of the neck and jaws, and a vigorous simultaneous expansion of the hyoid apparatus in the neck. It is distributed widely in South America, and currently does not appear to be threatened significantly anywhere in its range.
  • Pritchard, P.C.H. 2008. Chelus fimbriata (Schneider 1783) – matamata turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 020.1-020.10, doi:10.3854/crm.5.020.fimbriata.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Peru, Suriname?, Trinidad and Tobago, Venezuela. Distributed widely in lowland tropical rivers of northern South America, including the Amazon, Orinoco, Essequibo, and Oyapoque systems.
  • Pritchard, P.C.H. 2008. Chelus fimbriata (Schneider 1783) – matamata turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 020.1-020.10, doi:10.3854/crm.5.020.fimbriata.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Chelus fimbriatus ranges from the Amazon and Orinoco river systems in Venezuela and Colombia, south to the Tocatina, Araguala, and Xingu rivers of Brazil and Bolivia. Its range also extends west to Equador and Peru, and east into the eastern Amazon river basin. It also occurs on the island of Trinidad.

Chelus fimbriatus has been reportedly introduced into the drainage canals of southeast Florida, though a self-sustaining breeding population has not been confirmed. This introduction may be due to carelesness associated with the pet trade. Possible detrimental effects on Florida's native habitat have not yet been noted or investigated (Ernst and Barbour 1989, Espenshade 1990, USGS Biological Research Division 1999).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: South-America
Distribution: USA (introduced to Florida)  N Bolivia, E Peru, Ecuador, E Colombia, Venezuela,  Guyana, French Guiana, Surinam, N/C Brazil, Trinidad  
Type locality: Uprouague and Remire Island, French Guiana.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Chelus fimbriatus is almost surreal in appearance, and at first glance may resemble a pile of debris. Younger animals are salmon pink to reddish-brown in coloration with black to green mottling. As C. fimbriatus matures, the pinkish hues are replaced by faded yellow, washed out browns, oranges, and greys. The carapace has three lengthwise knobby keels. Algae may cover much of the carapace causing the animal to virtually disappear into its surroundings. A fairly large turtle, C. fimbriatus may reach a carapace length of nearly 45 cm. The head is broadly triangular with large lateral flaps of skin. Several hypotheses have been proposed on the possible functions of these flaps. It is known that the flaps have nerves that respond to various stimuli, including motion in the surrounding water. Tubercles on the head near the corners of the mouth and neck, and barbels on the chin, also are reported to have sensory nerves, possibly used in detecting water vibrations and other external stimuli. The snout has evolved into a long protuberance used as a snorkel, minimizing the turtle's movement as only the tip of the snout emerges form the water during respiration. The back of the eyes are lined with a tapetum lucidum, a visual adaptation which reflects light. This is seen also in other nocturnal reptiles. Despite this, C. fimbriatus has extremely poor eyesight. This turtle can sense auditory stimuli obtained through a well developed tympanum on both sides of the head. Chelus fimbriatus is a poor swimmer with legs adapted for walking on the bottom of their muddy habitats. Hatchlings and juveniles can swim awkwardly. Adults rarely leave the bottom of shallow pools and streams. Chelus fimbriatus is only sexually dimorphic after reaching maturity. Males have a concave plastron and rather long, thick tails; females have a flatter plastron and smaller tails. With tail extended, the male's vent (anal opening) is beyond the posterior edge of the carapace; the female's vent is under the edge of the carapace (Alderton 1988, Ernst and Barbour 1989, Kirkpatrick 1992).

Range length: 45 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Chelus fimbriatus prefers shallow, slow moving, turbid bodies of water such as rivers, blackwater streams, swamps, and marshes. The brackish waters of the lower Amazon basin are also inhabited. Soft muddy bottoms are prefered. Chelus fimbriatus is totally aquatic and rarely moves over land (Ernst and Barbour 1989, Espenshade 1990).

Habitat Regions: tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Chelus fimbriatus is primarily carnivorous. Its diet consists mainly of fish, and aquatic invertebrates. The mandibles are not attached medially, and the relatively weak jaws are unsuited for seizing and chewing prey. Chelus fimbriatus must rely on well developed neck musculature and the hyoid apparatus in the throat. When a potential prey item comes within range of the turtle, the turtle will strike out and open its mouth. Large amounts of water, and the prey item, are sucked in by the low pressure that is created. The mouth is then closed and excess water is expelled. The prey item is swallowed whole. While foraging, C. fimbriatus may trawl the water making lateral movements with its neck and head; at other times the turtles remain still and simply wait for fish or invertebrates to approach. Chelus fimbriatus has also been observed to herd fish into a restricted area and confine them before feeding. The cryptic appearance of C. fimbriatus contributes to its efficiency as a predator; the various neck fringes and algae growth may entice unwary fish to approach in search of food-- and before the prey are even aware of the turtle's presence, it is already too late to escape (Alderton 1988, Ernst and Barbour 1989, Espenshade 1990, Kirkpatrick 1992).

Animal Foods: fish; aquatic or marine worms

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Mata matas are important predators of small fish and aquatic invertebrates in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mata matas avoid predation by being cryptic and through their large size and thick carapace.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Chelus fimbriatus preys on:
non-insect arthropods
Actinopterygii
aquatic or marine worms

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mata matas have poor vision, but seem to have excellent tactile and auditory senses. The complex folds of skin on their bodies may hold sensory nerves that help to detect motion (see Physical description).

Male mating displays involve touch and physical displays.

Communication Channels: visual ; tactile

Perception Channels: tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information on the longevity of these animals in the wild. In captivity they may live up to 15 years.

Typical lifespan

Status: captivity:
15 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 35.8 years (captivity) Observations: The mata mata turtle is one the most bizarre-looking and, some would argue, ugly animals on the planet. Little is known about its lifespan in the wild. In captivity, specimens have been known to live over 30 years (http://www.pondturtle.com/). There are anecdotal reports of animals kept as pets living over 35 years, which is plausible. Also spelled "matamata".
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Prior to mating, male Chelus fimbriatus will repetitively extend the head toward the female while opening and closing the mouth.

Movement of the lateral flaps on the head has been observed during this courtship ritual, as well as a hyperextension of the legs from the shell.

Mating System: polygynous

Eggs are laid from October through December in the upper Amazon regions. Unlike most Amazonian turtles, which nest in open sandy places, mata matas may excavate their nests in decaying vegetation at the forest edge The eggs are about 3.5 centimeters in diameter and are almost spherical. One clutch may contain 12 to 28 eggs which have a relatively long incubation period. Incubation periods of around 200 days incubated at 28 to 29 degrees Celsius have been noted for captive individuals. (Ernst and Barbour 1989, Espenshade 1990).

Breeding interval: Breeding occurs once yearly.

Breeding season: Breeding and egg-laying occur from October through December.

Range number of offspring: 12 to 28.

Average gestation period: 200 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Young mata matas hatch from their eggs and emerge from the nest on their own, there is no parental care.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chelus fimbriatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Chelus fimbriata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGAACTTAAACCGCTGACTATTCTCTACTAACCATAAAGACATTGGCACCCTTTACCTAATCTTTGGGGCCTGAGCAGGAATAATTGGAACAGCCTTAAGCCTACTAATTCGAACAGAGCTAAGCCAACCCGGACCACTCATAGGAGATGATCAAGTATATAACGTTATTGTTACAGCCCATGCCTTCATTATAATCTTCTTCATGGTCATACCCGTAATGATCGGAGGGTTTGGAAACTGACTAGTCCCAATAATAATTGGAGCACCTGACATGGCATTTCCACGAATAAATAATATAAGTTTTTGACTCCTCCCCCCATCCCTATTACTCCTACTAGCCTCATCAGGAATTGAAGCAGGAGCTGGAACAGGATGAACTGTGTACCCCCCTCTCGCTGGAAATATAGCACATGCCGGAGCCTCCGTAGACCTAACCATCTTTTCCCTACACCTAGCCGGAGCATCATCCATCCTAGGGGCCATCAATTTTATCACCACAGCAGTTAACATAAAACCACCATCCATATCACAATATCAAACCCCACTCTTCGTATGATCCGTACTAATCACTGCTGTACTGTTACTACTATCCCTACCAGTACTCGCAGCAGGAATTACAATACTACTAACAGATCGAAACCTAAACACCACTTTCTTCGACCCATCCGGTGGAGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGCCACCCTGAAGTATACATCTTAATCTTACCAGGATTCGGATTAATTTCACATATTGTAGCCTACTACACTGGAAAAAAAGAACCATTTGGCTATATAGGAATAGTCTGAGCAATAATATCAATTGGATTCCTAGGATTTATCGTCTGAGCGCACCATATATTCACCGTAGGAATAGACGTAGACACCCGAGCATACTTCACATCCGCAACCATAATCATTGCTATCCCAACAGGAGTTAAAGTATTCAGCTGACTAGCCACACTTCACGGAGGAATAATTAAATGAGATGCTCCAATACTATGAGCCCTAGGATTCATCTTCCTATTTACAATCGGAGGCCTAACTGGAATCGTCCTAGCTAATTCATCACTAGACATCGTACTACACGACACCTATTACGTTGTAGCACACTTTCACTACGTATTATCTATAGGGGCTGTATTTGCCATCATAGCCGGATTTACTCACTGATTCCCATTATTTACAGGATACTCATTAAACCAATCATGAGCAAAATTACAATTTACAGTAATATTCCTTGGTGTTAATATTACATTCTTCCCCCAACACTTCCTAGGCCTAGCTGGAATACCTCGACGCTACTCGGACTACCCAGACGCTTACACCCTATGAAATTCAATCTCATCAATTGGATCTATAATCTCATTAGCAGCAGTCATCATAATACTTGTAATTATCTGAGAAGCCTTCTCATCAAAACGAAAAATCACATCAATTGAACCACCACTCATCAATGTAGAGTGACTAAACGGCTGCCCCCCACCAAACCACACCTATGAAGAAGCCGCACATATGTTATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chelus fimbriata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

IUCN 2007 Red List: Not Listed (= Least Concern, LR/lc) (assessed 1996, needs updating); CITES: Not Listed. Colombia Red List: Near Threatened.
  • Pritchard, P.C.H. 2008. Chelus fimbriata (Schneider 1783) – matamata turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 020.1-020.10, doi:10.3854/crm.5.020.fimbriata.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chelus fimbriatus has no special status. However with rapid destruction of its native habitat, this may not hold true in the future.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

If Chelus fimbriatus became established in southeast Florida, research would be needed to determine the impact, if any, it might have on native fauna.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Chelus fimbriatus is sometimes collected and sold in the pet trade, and is also captured and eaten by people, though its odd and unappetizing appearance may sometimes save it from the soup pot. As with all organisms, mata matas play a role in the functioning of their local ecosystem.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Mata mata

For the New Zealand city, see Matamata.

The mata mata, mata-mata, or matamata (Chelus fimbriata)[1][7] is a freshwater turtle found in South America, primarily in the Amazon and Orinoco basins. It is the only extant species in the genus Chelus.

Taxonomy[edit]

The mata mata was described for the first time by French naturalist Pierre Barrère in 1741 as a "large land turtle with spiky and ridged scales" (translation).[8] It was first classified as Testudo fimbriata by German naturalist Johann Gottlob Schneider in 1783. It was renamed 14 different times in two centuries, finally being renamed Chelus fimbriata in 1992.[1][8][9][10]

Anatomy and morphology[edit]

Top view of the mata mata turtle

The mata mata is a large, sedentary turtle with a large, triangular, flattened head characterized with many tubercles and flaps of skin, and a "horn" on its long and tubular snout.[8] Three barbels occur on the chin and four additional filamentous barbels at the upper jaw, which is neither hooked nor notched.[11]

The mata mata's brown or black, oblong carapace can measure up to 45 cm (18 in) at adult age.[12] The full adult weight is 15 kg (33 lb).[12] The mata mata's plastron is reduced, narrowed, hingeless, shortened towards the front, and deeply notched at the rear with narrow bridges.[11] These may be meant to allow the turtle to resemble a piece of bark, camouflaging it from possible predators.[13]The plastron and bridges are cream to yellow or brown.[11]

The head, neck, tail, and limbs are grayish brown on adults.[11] The neck is longer than the vertebra under its carapace and is fringed with small skin flaps along both sides.[11] Hatchlings show a pink to reddish tinge in the underside edge of their carapaces and plastrons that gradually disappear as they grow.

Each fore foot has five webbed claws. Males have concave plastrons and longer, thicker tails than females.[11]

Habitat[edit]

The mata mata inhabits slow moving, blackwater streams, stagnant pools, marshes, and swamps ranging into northern Bolivia, eastern Peru, Ecuador, eastern Colombia, Venezuela, the Guianas, and northern and central Brazil. The mata mata is strictly an aquatic species but it prefers standing in shallow water where its snout can reach the surface to breathe.[14]

Behavior[edit]

Head, in profile
Chelus fimbriatus.jpg

The appearance of the mata mata's shell resembles a piece of bark, and its head resembles fallen leaves.[15] As it remains motionless in the water, its skin flaps enable it to blend into the surrounding vegetation until a fish comes close.[15] The mata mata thrusts out its head and opens its large mouth as wide as possible, creating a low-pressure vacuum that sucks the prey into its mouth, known as suction feeding.[15] The mata mata snaps its mouth shut, the water is slowly expelled, and the fish is swallowed whole; the mata mata cannot chew due to the way its mouth is constructed.[15]

Reproduction[edit]

Males display for females by extending their limbs, lunging their heads toward the females with mouths agape, and moving the lateral flaps on their heads. Nesting occurs from October through December in the Upper Amazon. The 12 to 28 brittle, spherical, 35 mm-diameter eggs are deposited in a clutch.

Diet[edit]

The mata mata is carnivorous, feeding exclusively upon aquatic invertebrates and fish.[8][15]

In captivity[edit]

Mata mata turtles are readily available in the exotic pet trade and are quite expensive to obtain. Due to their unique appearance, they make interesting display animals. They also grow quite large. However, mata matas are not active hunters, so, like the alligator snapping turtle, they need less space than a large, active species.

As with all aquatic turtles, water quality is one of the keys to keeping this species successfully in captivity. Warm, acidic water is the best type used with a high tannin content that should be maintained all year round. Moderate to heavy filtration is recommended.[16]

References[edit]

  1. ^ a b c d Turtle Taxonomy Working Group [van Dijk, P.P., Iverson, J.B., Rhodin, A.G.J., Shaffer, H.B., and Bour, R.]. 2014. Turtles of the world, 7th edition: annotated checklist of taxonomy, synonymy, distribution with maps, and conservation status. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., Iverson, J.B., and Mittermeier, R.A. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs 5(7):000.329–479, doi:10.3854/ crm.5.000.checklist.v7.2014.
  2. ^ a b c Duméril, A.M.C. 1806. Zoologie Analytique, ou Méthode Naturelle de Classification des Animaux. Paris: Perronneau, 344 pp.
  3. ^ a b Schneider, J.G. 1783. Allgemeine Naturgeschichte der Schildkröten, nebst einem Systematischen Verseichnisse der einzelnen Arten. Müller, Leipzig. xlviii + 364 p.
  4. ^ Oppel, M. 1811. Die Ordnungen, Familien und Gattungen der Reptilien als Prodrom einer Naturgeschichte derselben. München: J. Lindauer, 86 pp.
  5. ^ ICZN. 1963. Opinion 660. Suppression under the plenary powers of seven specific names of turtles (Reptilia: Testudines). Bulletin of Zoological Nomenclature 20:187-190.
  6. ^ Fritz Uwe; Peter Havaš (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 327. ISSN 18640-5755. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 
  7. ^ Giant fossil matamata turtles (matamatas part V), Tetrapod Zoology
  8. ^ a b c d Espenshade III, William H (1990), "Matamata, Chelus fimbriatus", Tortuga Gazette 26 (5): 3–5 
  9. ^ Matamata, Chelus fimbriatus, California Turtle & Tortoise Club
  10. ^ Chelus fimbriata, The Reptile Database
  11. ^ a b c d e f Bartlett, Dick (2007), "The Matamata", Reptiles Magazine 15 (12): 18–20 
  12. ^ a b (French) Toutes les tortues du monde by Franck Bonin, Bernard Devaux and Alain Dupré, second edition (1998), editions Delachaux and Niestlé/WWF.
  13. ^ Encyclopedia of Animals:Mammals,Birds,Reptiles and Amphibians, Harold G. Cogger, Edwin Gould, Joseph Forshaw
  14. ^ Rosenfeld, Arthur (1989), Exotic Pets, New York: Simon & Schuster, pp. 153–155, ISBN 0-671-47654-8 
  15. ^ a b c d e Cogger, Harold; Zweifel, Richard (1992), Reptiles & Amphibians, Sydney, Australia: Weldon Owen, p. 112, ISBN 0-8317-2786-1 
  16. ^ Mata mata Care Sheet
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Subspecies

None recognized. Orinoco and Amazon populations have been identified as morphologically distinct from each other, but have not been named.
  • Pritchard, P.C.H. 2008. Chelus fimbriata (Schneider 1783) – matamata turtle. In: Rhodin, A.G.J., Pritchard, P.C.H., van Dijk, P.P., Saumure, R.A., Buhlmann, K.A., and Iverson, J.B. (Eds.). Conservation Biology of Freshwater Turtles and Tortoises: A Compilation Project of the IUCN/SSC Tortoise and Freshwater Turtle Specialist Group. Chelonian Research Monographs No. 5, pp. 020.1-020.10, doi:10.3854/crm.5.020.fimbriata.v1.2008, http://www.iucn-tftsg.org/cbftt
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© IUCN/SSC Tortoise and Freshwater Turtle Specialist Group

Source: IUCN SSC Tortoise and Freshwater Turtle Specialist Group

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!