Articles on this page are available in 1 other language: Spanish (12) (learn more)

Overview

Brief Summary

The painted turtle (Chrysemys picta) is largely aquatic, living in shallow-water habitats, and is among the most conspicuous of the basking turtles. Painted turtles are medium-sized turtles (10 to 18 cm). Males are smaller than females; adult males average from 170 to 190 g, whereas adult females average from 260 to 330 g in some populations (Congdon et al., 1986; Ernst 1971b). In general, the shell comprises approximately 30 percent of the total wet weight of turtles of this size (Hall, 1924).

Painted turtle habitat requirements include soft and muddy bottoms, basking sites, and aquatic vegetation (Sexton, 1959). Painted turtles prefer slow-moving shallow water such as ponds, marshes, ditches, prairie sloughs, spring runs, canals, and occasionally brackish tidal marshes (Conant and Collins, 1991). They frequent areas with floating surface vegetation for feeding and for cover (Sexton, 1959). These areas tend to be warmer than more open water, which is important in the early fall as temperatures begin to drop (Sexton, 1959). For winter hibernation or dormancy, painted turtles seek deeper water (Sexton, 1959). If outlying marsh areas are dry during the summer, the turtles may return to the more permanent bodies of water sooner (McAuliffe, 1978). Painted turtles sometimes inhabit stagnant and polluted water (Smith, 1956).

Painted turtles are omnivorous. Depending on habitat and on age, painted turtles may consume predominantly vegetation or predominantly animal matter. Marchand (1942, cited in Mahmoud and Klicka, 1979) found in one population that juveniles consumed approximately 85 percent animal matter and 15 percent plant matter, whereas the adults were primarily herbivorous, consuming 88 percent plant matter and 12 percent insects and amphipods.

Painted turtles are diurnal and usually spend their nights sleeping submerged (Ernst, 1971c). During the day, they forage in the late morning and late afternoon and bask during the rest of the day (Ernst, 1971c). Active feeding does not occur until water temperatures approach 20 degrees C, and these turtles are most active around 20.7 to 22.4 degrees C (Ernst, 1972; Ernst and Barbour, 1972; Hutchinson, 1979). Basking is most frequent in the spring, summer, and fall, but occasionally painted turtles bask during warm spells in the winter (Ernst and Barbour, 1972).

Most painted turtles become dormant during the colder months but will become active during warm periods in the winter (Ernst and Barbour, 1972).
  • See article source for references and additional information.
Public Domain

 

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Continent: Middle-America North-America Asia
Distribution: S Canada (Nova Scotia, New Brunswick, Quebec, Ontario, Manitoba, Saskatchewan, Alberta, British Columbia),  USA (Georgia, Alabama, Mississippi, Louisiana, Oklahoma, Arkansas, Colorado, Wyoming, Idaho, Oregon, Washington, Montana, North Dakota, South Dakota, Nebraska, Kansas, Minnesota, Iowa, Missouri, Wisconsin, Illinois, Tennessee, Indiana, Kentucky, Michigan, Ohio, West Virginia, Virginia, South Carolina, North Carolina, Maryland, Delaware, New Jersey, Pennsylvania, Connecticut, Massachusetts, Vermont, New York, New Hampshire, Maine, scattered in W Texas, New Mexico, Arizona, Utah, introduced to Florida and California),  Mexico (Chihuahua)  introduced to the Philippine Islands, Germany, Indonesia, Spain (Rhodin et al. 2010).  
Type locality: Lancaster, Philadelphia, USA (designated by MITLLEMAN 1945).  dorsalis: USA (Alabama, Arizona, Arkansas, Illinois, Louisiana, Mississippi, Missouri, Oklahoma, Texas);
Type locality: vicinity of New Orleans, Louisiana (restricted by K.P. SCHMIDT 1953).  marginata: SE Canada (Ontario, Québec), E USA (Alabama, Illinois, Indiana, Kentucky, Michigan, New York, Ohio,Pennsylvania, Tennessee, West Virginia); [Syntype: UIMNH 41529 (MCZ 1796)]  belli: S Canada (Alberta, British Columbia, Manitoba, Ontario, Saskatchewan), USA (Colorado, Idaho, Illinois, Iowa, Kansas, Michigan,Minnesota, Missouri, Montana, Nebraska,New Mexico, North Dakota, Oklahoma, Oregon, South Dakota, Texas, Utah, Washington, Wisconsin, Wyoming), Mexico (Chihuahua);
Type locality: “Manhattan, Kansas” (designated by K.P. SCHMIDT 1953).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Painted turtles are one of the most common turtles in North America and are found from southern Canada to northern Mexico.

Biogeographic Regions: nearctic (Native )

  • Canadian Forest Service, 2005. "Turtles of Ontario" (On-line). Natural Resources Canada. Accessed July 28, 2005 at http://www.glfc.cfs.nrcan.gc.ca/landscape/turt_e.html.
  • Kawartha Turtle Watch, 2005. "Midland Painted Turtle (Chrysemys picta marginata)" (On-line). Kawartha Turtle Watch. Accessed July 28, 2005 at http://www.trentu.ca/biology/turtlewatch/painted.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

Chrysemys picta inhabits Canada, the continental United States and northern Chihuahua, Mexico, from British Columbia to Nova Scotia to southern Georgia and the upper Colorado River system of Utah and Arizona (Iverson 1992).
  • C. p. picta: occupies mainly the Atlantic lowlands east of the Appalachian Mountains, from Nova Scotia to northern Georgia.
  • C. p. bellii: western areas from the Pacific coast through the upper Missouri basin to southwestern Ontario, Wisconsin and Missouri, as well as in the Upper Colorado system. Populations attributed to bellii inhabit the Rio Grande/Rio Bravo del Norte as it flows into Mexico, as well as the endorrheic basin(s) west of Ciudad Juarez, northern Chihuahua (Iverson, 1992).
  • C. p. dorsalis: restricted to the lower Mississippi basin from extreme southern Illinois and southeastern Missouri through Tennessee, Kentucky (?), Arkansas, Mississippi, Alabama to Louisiana and east Texas, USA (Iverson 1992, Starkey et al. 2003).
  • C. p. marginata: from southern Canada, New Hampshire and New York to Illinois and Tennessee, except the Atlantic coastal plain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends from southern Canada, from British Columbia to Nova Scotia, south through Oregon, northern Idaho, Colorado, and most of the central and eastern United States (but not Florida), and disjunctly southwest to southwestern Colorado, New Mexico, Texas, and Chihuahua (Mexico). This species has been introduced in several locations in the western United States and western Canada. Populations from the Gulf Coast to southern Illinois, formerly included in C. picta, are now recognized as a distinct species, C. dorsalis (Starkey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Louisiana, eastern Texas, southeastern Oklahoma, Arkansas, southeastern Missouri, southern Illinois, western Kentucky, western Tennessee, Mississippi, and Alabama; precise range limits may be better defined after completion of ongoing studies (Starkey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Painted turtles are brightly marked. They have a smooth shell about 90 to 250 mm long. Their shell acts as protection, but since the ribs are fused to the shell, the turtle cannot expand its chest to breathe but must force air in and out of the lungs by alternately contracting the flank and shoulder muscles. The painted turtle has a relatively flat upper shell with red and yellow markings on a black or greenish brown background. Males mature at about 70 to 95 mm plastron (lower shell) length, usually at 3 to 5 years of age. Females at take longer (6 to 10 years) and are larger at maturity (c. 100 to 130 mm plastron length). The growth rate, for both sexes is rapid during the first several years of the of their lives. Turtles continue to grow slowly after maturity, and this species may reach 250 mm carapace (upper shell) length and live for many decades.

Average mass: 57.5 g.

Range length: 90 to 250 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Average mass: 371.812 g.

Average basal metabolic rate: 0.0236 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Size

Length: 25 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Painted turtles prefer living in freshwater that is quiet, shallow, and has a thick layer of mud.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Habitat and Ecology

Habitat and Ecology
Chrysemys picta inhabits a wide variety of permanent and temporary water bodies, from rivers to marshes and brackish situations, though its optimal habitat is characterized by shallow, densely vegetated waters with little or no flow. The species is an omnivorous generalist, consuming almost any kind of animal or vegetable matter available.

Males reach 15.3 cm carapace length (CL), females up to 25.4 cm, with extensive variation depending on subspecies and location. Maturity is reached at age 2–4 years (at latest six years) and about 8–10 cm CL in males, and at 6–10 years and 11–18 cm CL in females. Longevity can be up to 61 years. Generation time has not been clearly calculated but is probably somewhere around 20 years.

Females usually produce two clutches (range 1–5) of about 5–11 (range 1–23) eggs, but not all females reproduce each year, and great variability occurs among subspecies, populations and individuals. Incubation takes about 70 (62–80) days. Hatchlings measure about 26.6 (range 18–31) mm.

[Information taken from review by Ernst and Lovich 2009].

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Painted turtles live in slow-moving, shallow waters with soft bottoms, basking sites, and aquatic vegetation: streams, marshes, swamps, ponds, lakes, and reservoirs. They may colonize seasonally flooded areas near permanent water. Hibernations occurs in water. Females dig nests in soft soil in open areas up to several hundred meters from water (1-621 meters, average 90 meters, in Quebec, Christens and Bider 1987; 1-164 meters, average 60 meters, in Michigan, Congdon and Gatten 1989). Hatchlings usually remain in nest in winter and emerge in spring (Packard and Packard 1995). Hatchling painted turtles are able to withstand periodic partial freezing of their body fluids as they overwinter in shallow nests in the north.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Ponds, marshes, swamps, slowly flowing waters; areas with aquatic vegetation, relatively clear water, basking sites, and a soft bottom (Dundee and Rossman 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Females migrate between terrestrial nesting areas and aquatic habitats.

In small marsh systems, home range size may be very small (e.g., average of 1.2 ha in Michigan) (Rowe 2003), whereas in rivers individual home range sizes are much larger (e.g., 7-26 km (MacCulloch and Secoy 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Painted turtles feed mainly on plants, small animals, such as fish, crustaceans, aquatic insects, and some carrion. Young painted turtles are mainly carnivorous, acquiring a taste for plants later in life. Because they have no teeth, the turtle jaw has tough, horny plates for gripping food. Painted turtles must eat in the water, their tongue does not move freely and they cannot manipulate food well on land.

Animal Foods: fish; carrion ; insects; aquatic crustaceans

Plant Foods: leaves; algae; macroalgae

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comments: Feeds opportunistically on various plants and animals, living or dead, obtained from bottom of water or among aquatic plants. Diet is dominated by invertebrates in some areas. Juvenile diet sometimes includes cladoceran zooplankton (Mauer 1995, Herpetological Review 26:34).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predation

A variety of predators will capture painted turtles. raccoons, otters, mink, foxes, and other medium-sized predators will prey on turtles and their eggs. Painted turtles are vigilant and seek refuge in the water at the slightest sign of danger, they can also retract their head and legs into the protection of their shell.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Ecosystem Roles

Painted turtles are important predators of small fish, crustaceans, and other invertebrates in aquatic ecosystems of North America.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Chrysemys picta is prey of:
Lontra canadensis
Mustela vison
Procyon lotor
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Chrysemys picta preys on:
non-insect arthropods
Pimephales notatus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Represented by many and/or large occurrences throughout much of the large range (e.g., Ernst 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Very abundant in suitable habitat in most areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Many occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In many areas, eggs and hatchlings incur high mortality from various predators (e.g., see Christens and Bider 1987). However, of 13 monitored nests in northern Idaho, none was lost to predation; overall survivorship (from laying until emergence from nest) for 193 eggs was 0.21-0.33 (Lindeman 1991). Annual survivorship of adult females in Virginia was high (0.94-0.96) (Mitchell 1988). In Michigan, annual survivorship of adult males and females was 0.64-0.83 and 0.29-0.50, respectively; annual survivorship of juveniles was 0.21-0.51; maximum age was estimated at 34 years; population density increased and survival rate apparently decreased over a period of 2+ decades (Frazer et al. 1991). In Nebraska, annual adult survivorship was at least 91% (Iverson and Smith 1993). See Iverson (1991) for a compilation of survivorship data on eggs and juveniles. Density in ponds and lakes varies greatly; up to several hundred per ha in some areas, as few as a dozen per ha in other areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Sound perception is poor in turtles, but they do have a good sense of smell and color vision. They use touch to communicate with each other, particularly during mating.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Cyclicity

Comments: In most of the range, this turtle is most active diurnally, March (late April or May in far north) through October, though warm weather may stimulate activity in other months, especially in the south.Evening activity on land may occur during nesting; in Michigan, peak initiation of nesting migrations occurred between 1600 and 1800 h (Congdon and Gatten 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The sex of the turtle is determined during a critical phase of embryogenesis according to the incubation temperature. These temperature-dependent reptiles lack sex chromosomes. Low temperatures during incubation produce males and high temperatures produce females. Hatchlings have two threshold temperatures, 27 to 32 C and 22C. These thresholds may be important to some northern or woodland populations. The availability of water in the nests is more important than temperature in influencing survival, metabolism, and growth of the embryos.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Painted turtles may live as long as 35 to 40 years, but most will not survive for this long.

Average lifespan

Status: captivity:
30.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 61 years (wild) Observations: Field studies have failed to find statistical differences between the mortality rates and reproductive outputs of young and old painted turtles (Congdon et al. 2003). As such, this is considered a species with negligible senescence.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating begins after hibernation and before feeding begins when the water temperatures are still low. Fall mating may also occur. Temperature is a major environmental cue for the regulation of the seasonal gonadal cycle, but the thermal dependence of the reproductive system differs markedly for the two sexes.

Mating System: polygynous

The breeding season lasts from late spring to early summer. Males mature at about 70-95 mm plastron (lower shell) length, usually at 3-5 years of age. Females take longer (6-10 years) and are larger at maturity (c. 100-130 mm plastron length).

Breeding interval: Breeding occurs once yearly.

Breeding season: The breeding season lasts from late spring to early summer.

Range number of offspring: 4 to 15.

Range age at sexual or reproductive maturity (female): 6 to 10 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

In the early summer females lay 4 to 15 oval, soft-shelled eggs, in a flask-shaped hole. Females choose soft, sandy soil with good exposure to the sun in which to dig the hole. Once the eggs are laid they cover the hole and leave. The young hatch and dig out of the nest on their own, they are independent immediately.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Most nesting occurs between late May and early July, perhaps earlier in the south. Individual females often produce more than one clutch/year in most of the range (often 2 in Wisconsin, 2-3 and sometimes 4 in Nebraska). Clutch size averages 4 in Virginia, 8 in Maine and Michigan, 10 in Wisconsin and New Mexico, 13 in Washington, 14 in Nebraska, 16 in Idaho, 20 in Saskatchewan. Hatchlings usually remain in the nest in winter and emerge in spring. Females are sexually mature in 5 years (Tennessee, Pennsylvania, New Mexico), 5-6 years (Nebraska), 6 years (Ontario and Virginia), 6-7 years (Idaho), 7 years (Canada, Michigan), 8 years (Wisconsin), or 8-10 years (Washington). Males mature at younger ages. In Nebraska, some females apparently survived beyond 30 years (Iverson and Smith 1993). In Michigan, warmer years with a longer growing season resulted more rapid attainment of sexual maturity in males (Frazer et al., 1993, Am. Midl. Nat. 130:314-324).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Often more than one clutch/year in most of the range (often 4 in Louisiana). Clutch size averages 4 in Louisiana. Hatchlings usually winter in nest, emerge in spring. Females are sexually mature in 4 years in Louisiana. Males mature at younger ages.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysemys picta

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC1504-06|NC_002073|Chrysemys picta| ACCCGCTGATTTTTCTCTACCAACCACAAAGACATTGGCACCTTATATTTTATTTTCGGGGCCTGAGCAGGAATAGTAGGCACAGCATTG---AGTTTACTAATCCGCGCAGAATTAAGCCAACCAGGTACCCTTTTAGGAGAC---GACCAGATCTACAATGTTATCGTCACAGCCCATGCTTTCATTATAATTTTCTTCATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGACTCGTACCAATGATA---ATTGGAGCACCAGATATAGCATTTCCACGTATAAACAATATAAGTTTTTGACTTTTACCCCCTTCATTACTATTACTTCTAGCTTCATCAGGAATTGAAGCAGGCGCAGGTACAGGCTGAACTGTATACCCCCCATTAGCCGGAAACCTAGCCCACGCCGGTGCCTCTGTAGACCTA---ACTATCTTTTCTCTCCACTTAGCAGGGGTGTCTTCAATTCTAGGAGCTATCAACTTCATTACTACAGCAATTAACATAAAATCCCCGGCTATATCACAATACCAAACACCCCTATTTGTATGATCAGTACTTATTACAGCTGTCCTATTATTACTATCACTACCAGTACTAGCTGCA---GGTATCACTATACTATTAACAGACCGAAACCTAAATACAACCTTCTTTGACCCTTCAGGAGGAGGAGACCCAATCCTATATCAACACTTATTCTGATTCTTTGGTCACCCCGAAGTATACATCCTAATCCTACCTGGATTCGGCATAATCTCCCATGTTGTCACTTATTACGCTGGCAAAAAA---GAACCTTTTGGCTACATAGGAATAGTTTGAGCAATAATATCCATTGGATTCTTAGGCTTCATCGTATGGGCCCACCACATATTTACCGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysemys picta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Painted turtles are relatively common and abundant throughout most of their range. However, in some areas they are threatened by the destruction of freshwater habitats, such as ponds and small lakes. In some areas many painted turtles are killed on roadways. In Canada, painted turtles have been placed on the federal blue list, which identifies animals considered vulnerable to human activities or natural events, but not immediately threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Van Dijk, P.P.

Reviewer/s
Horne, B.D., Mittermeier, R.A., Philippen, H.-D., Quinn, H.R., Rhodin, A.G.J., Shaffer, H.B. & Vogt, R.C

Contributor/s

Justification
The Painted Turtle is one of the most widespread and abundant turtle species in the USA and Canada, and although there are some threats it is considered to be of Least Concern in terms of current extinction risk.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Highly to moderately vulnerable.

Environmental Specificity: Moderate to broad.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Highly to moderately vulnerable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Canada: No specific population data are available.

United States: The species is widespread and generally common to abundant in suitable habitat. Usually this is the most abundant turtle in shallow vegetated wetlands, where they may comprise 62–76% of all turtle individuals, and reach densities between 100 and 590 animals per hectare (from review by Ernst and Lovich 2009).

Mexico: No specific population data are available.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Likely stable in most respects.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Any declines likely have been more than offset by increases associated with human-augmented increases in suitable habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Likely stable but not really quantifiable.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Individuals and populations are impacted by habitat loss, road mortality, increased predation by subsidized predators (i.e., unnaturally large populations of predators subsidized by easily available resources near human settlements), intolerable levels of pollution, and capture for personal possession and trade. However, all four subspecies appear secure in their survival prospects.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Localized threats from habitat degradation, mortality on roads, and human-associated increases in predators (e.g., raccoons).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Chrysemys picta is subject to a variety of state legislation and regulations. The species occurs in a large number of protected areas across its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

As with many other reptile species, this species frequently has bacteria living naturally in its guts that can be harmful to humans (they are normal members of the gut flora of the reptiles). In particular, these turtles can be source of bacteria in the genus Salmonella. This is why it is illegal to sell small turtles as pets in the United States. Anyone keeping and handling turtles should be careful to maintain hygienic methods and wash their hands after handling.

Negative Impacts: injures humans (carries human disease); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Economic Importance for Humans: Positive

Painted turtles are often used for educational purposes, they make excellent pets with proper care.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Wikipedia

Painted turtle

The painted turtle (Chrysemys picta) is the most widespread native turtle of North America. It lives in slow-moving fresh waters, from southern Canada to Louisiana and northern Mexico, and from the Atlantic to the Pacific. The turtle is the only species of the genus Chrysemys, which is part of the pond turtle family Emydidae. Fossils show that the painted turtle existed 15 million years ago, but four regionally based subspecies (the eastern, midland, southern, and western) evolved during the last ice age.

The adult painted turtle female is 10–25 cm (4–10 in) long; the male is smaller. The turtle's top shell is smooth and oval without a keel (ridge) on the top. Its skin is olive to black with red, orange, or yellow stripes on its extremities. The subspecies can be distinguished by their shells: the eastern has straight-aligned top shell segments; the midland has a large gray mark on the bottom shell; the southern has a red line on the top shell; the western has a red pattern on the bottom shell.

The turtle eats aquatic vegetation, algae, and small water creatures including insects, crustaceans, and fish. Although they are frequently consumed as eggs or hatchlings by rodents, canines, and snakes, the adult turtles' hard shells protect them from most predators except alligators and raccoons. Reliant on warmth from its surroundings, the painted turtle is active only during the day when it basks for hours on logs or rocks. During winter, the turtle hibernates, usually in the muddy bottoms of waterways. The turtles mate in spring and autumn; between late spring and mid-summer females dig nests on land and lay their eggs. Hatched turtles grow until sexual maturity: 2–9 years for males, 6–16 for females. Adults in the wild can live for more than 55 years.

In the traditional tales of Algonquian tribes, the colorful turtle played the part of a trickster. In modern times, the painted turtle has become the United States' second most popular pet turtle, although trapping is increasingly restricted. Habitat loss and road killings have reduced the turtle's population, but its ability to live in human-disturbed settings has helped it remain the most abundant turtle in North America. Only in Oregon and British Columbia is its range in danger of eroding. Four U.S. states have named the painted turtle their official reptile.


Taxonomy and evolution

a line drawing of Schneider's portrait at a 3/4 angle. he looks resolute and has long hair.
German naturalist Johann Gottlob Schneider first categorized the painted turtle.

The painted turtle (C. picta) is the only species in the genus Chrysemys.[4] The parent family for Chrysemys is Emydidae: the pond turtles. Emydidae is split into two sub families; Chrysemys is part of the Deirochelyinae (Western Hemisphere) branch.[5] The four subspecies of the painted turtle are the eastern (C. p. picta), midland (C. p. marginata), southern (C. p. dorsalis), and western (C. p. bellii).[6]

The painted turtle's generic name is derived from the Ancient Greek words for "gold" (chryso) and "freshwater tortoise" (emys); the species name originates from the Latin for "colored" (pictus).[7] The subspecies name, marginata, derives from the Latin for "border" and refers to the red markings on the outer (marginal) part of the upper shell; dorsalis is from the Latin for "back", referring to the prominent dorsal stripe; and bellii honors zoologist Thomas Bell, a collaborator of Charles Darwin.[8] An alternate East Coast common name for the painted turtle is "skilpot", from the Dutch for turtle, schildpad.[9]

Classification

Originally described in 1783 by Johann Gottlob Schneider as Testudo picta,[4][10] the painted turtle was called Chrysemys picta first by John Edward Gray in 1855. The four subspecies were then recognized: the eastern by Schneider in 1783,[10][11] the western by Gray in 1831,[11][12] and the midland and southern by Louis Agassiz in 1857.[13][14]

Until the 1930s many of the subspecies of the painted turtle were labeled by biologists as full species within Chrysemys, but this varied by the researcher. The painted turtles in the border region between the western and midland subspecies were sometimes considered a full species, treleasei. In 1931, Bishop and Schmidt defined the current "four in one" taxonomy of species and subspecies. Based on comparative measurements of turtles from throughout the range, they subordinated species to subspecies and eliminated treleasei.[15]

Since at least 1958,[16][nb 2] the subspecies were thought to have evolved in response to geographic isolation during the last ice age, 100,000 to 11,000 years ago.[17] At that time painted turtles were divided into three different populations: eastern painted turtles along the southeastern Atlantic coast; southern painted turtles around the southern Mississippi River; and western painted turtles in the southwestern United States.[18] The populations were not completely isolated for sufficiently long, hence wholly different species never evolved. When the glaciers retreated, about 11,000 years ago, all three subspecies moved north. The western and southern subspecies met in Missouri and hybridized to produce the midland painted turtle, which then moved east and north through the Ohio and Tennessee river basins.[16][18]

Biologists have long debated the genera of closely related subfamily-mates Chrysemys, Pseudemys (cooters), and Trachemys (sliders). After 1952, some combined Pseudemys and Chrysemys because of similar appearance.[19] In 1964, based on measurements of the skull and feet, Samuel B. McDowell proposed all three genera be merged into one. However, further measurements, in 1967, contradicted this taxonomic arrangement. Also in 1967, J. Alan Holman,[20] a paleontologist and herpetologist, pointed out that, although the three turtles were often found together in nature and had similar mating patterns, they did not crossbreed. In the 1980s, studies of turtles' cell structures, biochemistries, and parasites further indicated that Chrysemys, Pseudemys, and Trachemys should remain in separate genera.[21]

fossils in a tray, paper labels nearby
Top and bottom shell fossils, about 5 million years old, from a Tennessee sinkhole[22]

David E. Starkey and collaborators advanced a new view of the subspecies in 2003. Based on a study of the mitochondrial DNA, they rejected the glacial development theory and argued that the southern painted turtle should be elevated to a separate species, C. dorsalis, while the other subspecies should be collapsed into one and not differentiated.[23] However, this proposition was largely unrecognized because successful breeding between all subspecies was documented wherever they overlapped.[11][24] Nevertheless, in 2010, the IUCN recognized both C. dorsalis and C. p. dorsalis as valid names for the southern painted turtle.[2]

DNA

The turtle's karyotype (nuclear DNA, rather than mitochondrial DNA) consists of 50 chromosomes, the same number as the rest of its subfamily-mates and the most common number for Emydidae turtles in general.[25][26][27] Less well-related turtles have from 26 to 66 chromosomes.[28] Little systematic study of variations of the painted turtle's karotype among populations has been done.[29] (However, in 1967, research on protein structure of offshore island populations in New England, showed differences from mainland turtles.[30])

Comparison of subspecies chromosomal DNA has been discussed, to help address the debate over Starkey's proposed taxonomy, but as of 2009 had not been reported.[29][31] Interestingly, the complete sequencing of the genetic code for the painted turtle was at a "draft assembed" state in 2010. The turtle was one of two reptiles chosen to be first sequenced.[32]

Fossils

Although its evolutionary history—what the forerunner to the species was and how the close relatives branched off—is not well understood, the painted turtle is common in the fossil record.[33] The oldest samples, found in Nebraska, date to about 15 million years ago. Fossils from 15 million to about 5 million years ago are restricted to the Nebraska-Kansas area, but more recent fossils are gradually more widely distributed. Fossils newer than 300,000 years old are found in almost all the United States and southern Canada.[1]

Description

A painted turtle is swimming, apparently in an aquarium, and we see it front on at large scale, with its left webbed foot raised.
The painted turtle's yellow face-stripes, philtrum (nasal groove), and foot webbing

The painted turtle's shell is 10–25 cm (4–10 in) long, oval, smooth, and flat-bottomed.[34][nb 3][35][25] The color of the top shell (carapace) varies from olive to black, allowing the turtle to blend in with its surroundings. The bottom shell (plastron) is yellow, sometimes red, sometimes with dark markings in the center. Similar to the top shell, the turtle's skin is olive to black, but with red and yellow stripes on its neck, legs, and tail.[36][37] As with other pond turtles, such as the bog turtle, the painted turtle's feet are webbed to aid swimming.[38][39][40]

The head of the turtle is distinctive. The face has only yellow stripes, with a large yellow spot and streak behind each eye, and on the chin two wide yellow stripes that meet at the tip of the jaw.[34][25][36] The turtle's upper jaw is shaped into an inverted "V" (philtrum), with a downward-facing, tooth-like projection on each side.[41]

The hatchling has a proportionally smaller head, eyes, and tail, and a more circular shell than the adult.[42][43] The adult female is generally longer than the male, 10–25 cm (4–10 in) versus 7–15 cm (3–6 in).[36][44] For a given length, the female has a higher (more rounded, less flat) top shell.[45] The female's greater body volume supports her egg-production.[46] The male has longer foreclaws and a longer, thicker tail, with the anus (cloaca) located further out on the tail.[34][35][25][47]

Subspecies

Although the subspecies may hybridize (intergrade), especially at range boundaries,[48] they are distinct within the hearts of their ranges.[49]

  • The male eastern painted turtle (C. p. picta) is 13–17 cm (5–7 in) long, while the female is 14–17 cm (6–7 in). The upper shell is olive green to black and may possess a pale stripe down the middle and red markings on the periphery. The segments (scutes) of the top shell have pale leading edges and occur in straight rows across the back, unlike all other North American turtles, including the other three subspecies of painted turtle, which have alternating segments.[49] The bottom shell is plain yellow or lightly spotted.[50]
  • The midland painted turtle (C. p. marginata) is 10–25 cm (4–10 in) long.[51] The centrally located midland is the hardest to distinguish from the other three subspecies.[49] Its bottom shell has a characteristic symmetrical dark shadow in the center which varies in size and prominence.[18]
  • The southern painted turtle (C. p. dorsalis), the smallest subspecies, is 10–14 cm (4–6 in) long.[52] Its top stripe is a prominent red,[49] and its bottom shell is tan and spotless or nearly so.[53]
  • The largest subspecies is the western painted turtle (C. p. bellii), which grows up to 25 cm (10 in) long.[54] Its top shell has a mesh-like pattern of light lines,[17] and the top stripe present in other subspecies is missing or faint. Its bottom shell has a large colored splotch that spreads to the edges (further than the midland) and often has red hues.[17]
Eastern painted turtle
C. p. picta
Midland painted turtle
C. p. marginata
Southern painted turtle
C. p. dorsalis
Western painted turtle
C. p. bellii
A full overhead shot of an eastern painted turtleA midland painted turtle sitting on rocky ground facing left with his head slightly retracted into his shellA southern painted turtle facing left, top-side view, stripe prominent, on pebblesA western painted turtle standing in grass, with neck extended
A hand holds a turtle, exposing the orange-yellow undershell.The under shell(plastron) of a midland painted turtleThe under shell(plastron) of a southern painted turtleThe under shell(plastron) of a western painted turtle

Distribution

Range

The most widespread North American turtle,[55] the painted turtle is the only turtle whose native range extends from the Atlantic to the Pacific.[nb 4] It is native to eight of Canada's ten provinces, forty-five of the fifty United States, and one of Mexico's thirty-one states. On the East Coast, it lives from the Canadian Maritimes to the U.S. state of Georgia. On the West Coast, it lives in British Columbia, Washington, and Oregon and offshore on southeast Vancouver Island.[nb 5] The northernmost American turtle,[57] its range includes much of southern Canada. To the south, its range reaches the U.S. Gulf Coast in Louisiana and Alabama. In the southwestern United States there are only dispersed populations. It is found in one river in extreme northern Mexico. It is absent in a part of southwestern Virginia and the adjacent states as well as in north-central Alabama.[17][56][58]

Map of North America showing the subspecies' specific ranges in different colors
Native range of the painted turtle (C. picta)
Dark grey for national borders
White for state and province borders
Dark blue for rivers, only showing those in article
  Eastern (C. p. picta)
  Midland (C. p. marginata)
  Southern (C. p. dorsalis)
  Western (C. p. bellii)
Intergrade mixtures (large areas only)
  Mix of eastern and midland
  Mix of eastern and southern
  Mix of midland and western

The borders between the four subspecies are not sharp, because the subspecies interbreed. Many studies have been performed in the border regions to assess the intermediate turtles, usually by comparing the anatomical features of hybrids that result from intergradation of the classical subspecies.[nb 6] Despite the imprecision, the subspecies are assigned nominal ranges.

Eastern painted turtle

The eastern painted turtle ranges from southeastern Canada to Georgia with a western boundary at approximately the Appalachians. At its northern extremes, the turtle tends to be restricted to the warmer areas closer to the Atlantic Ocean. It is uncommon in far north New Hampshire and in Maine is common only in a strip about 50 miles from the coast.[63][64] In Canada, it lives in New Brunswick and Nova Scotia but not in Quebec or Prince Edward Island. To the south it is not found in the coastal lowlands of southern North Carolina, South Carolina, or Georgia, or in southern Georgia in general or at all in Florida. [17][56][65][66]

The eastern subspecies's range extends slightly into east central Alabama, where it intergrades with the southern subspecies.[56] In the northeast, there is extensive mixing with the midland subspecies, and some writers have called these turtles a "hybrid swarm".[16][67][68] In the southeast, the border between the eastern and midland is more sharp as mountain chains separate the subspecies to different drainage basins.[56][69]

Midland painted turtle

The midland painted turtle lives from southern Ontario and Quebec, through the eastern U.S. Midwest states, to Kentucky, Tennessee and northwestern Alabama, where it intergrades with the southern painted turtle.[70] It also is found eastward through West Virginia, western Maryland and Pennsylvania. The midland painted turtle appears to be moving east, especially in Pennsylvania.[71] To the northeast it is found in western New York and much of Vermont, and it intergrades extensively with the eastern subspecies.[53][56]

Southern painted turtle

The southern painted turtle ranges from extreme southern Illinois and Missouri, roughly along the Mississippi River valley, to the south. In Arkansas, it branches out to the west towards Texas, where it is found in the far northeast part of that state (Caddo Lake region)[72] as well as extreme southeastern Oklahoma (McCurtain County).[73] It is found in much of Louisiana, where it reaches the Gulf of Mexico (in fresh water). Eastward it is found in western Tennessee, northern Mississippi and much of Alabama, including the Gulf Coast city of Mobile[17][56][66] An isolated population in central Texas has been reported but is now believed to be non-native.[74]

Western painted turtle

The western painted turtle's northern range includes southern parts of western Canada from Ontario to Manitoba, Saskatchewan, Alberta and British Columbia. In Ontario, the western subspecies is found north of Minnesota and directly north of Lake Superior, but there is a 130 km (80 mi) gap to the east of Lake Superior (in the area of harshest winter climate) where no painted turtles of any subspecies occur. Thus Ontario's western subspecies does not intergrade with the midland painted turtle of southeastern Ontario.[60] In Manitoba, the turtle is numerous and ranges north to Lake Manitoba and the lower part of Lake Winnipeg. The turtle is also common in south Saskatchewan, but in Alberta, there may only be 100 individuals, all found very near the U.S. border, mostly in the southeast. In British Columbia, populations exist in the interior in the vicinity of the Kootenai, Columbia, Okanagen, and Thompson river valleys. At the British Columbia coast, turtles occur near the mouth of the Fraser and a bit further north, as well as the bottom of Vancouver Island, and some other nearby islands. Within British Columbia, the turtle's range is not continuous and can better be understood as northward extensions of the range from the United States; high mountains present barriers to east-west movement of the turtles within the province or from Alberta. Some literature has shown isolated populations much further north in Alberta and British Columbia, but these were probably pet-releases.[17][56][75][76]

In the United States, the western subspecies forms a wide intergrade area with the midland subspecies covering much of Illinois as well as a strip of Wisconsin along Lake Michigan and part of the Upper Peninsula of Michigan (UP). Further west, the rest of Illinois, Wisconsin and the UP are part of the range proper, as are all of Minnesota and Iowa, as well as all of Missouri except a narrow strip in the south. All of North Dakota is within range, all of South Dakota except a very small area in the west, and all of Nebraska. Almost all of Kansas is in range; the border of that state with Oklahoma is roughly the species range border, but the turtle is found in three counties of north central Oklahoma.[17][56][73][75]

To the northwest, almost all of Montana is in range. Only a narrow strip in the west, along most of the Idaho border (which is at the Continental Divide) lacks turtles.[77] Wyoming is almost entirely out of range; only the lower elevation areas near the eastern and northern borders have painted turtles.[78] In Idaho, the turtles are only found in the far north (upper half of the Idaho Panhandle).[79] In Washington state, turtles are common throughout the state within lower elevation river valleys.[80][81] In Oregon, the turtle is native to the northern part of the state throughout the Columbia River valley as well as the Willamette River valley north of Salem.[17][75][82]

To the southwest, the painted turtle's range is fragmented. In Colorado, while range is continuous in the eastern, prairie, half of the state, it is absent in most of the western, mountainous, part of the state. However, the turtle is confirmed present in the lower elevation southwest part of the state (Archuleta and La Plata counties), where a population ranges into northern New Mexico in the San Juan River basin. There are also some unconfirmed sightings in parts of the far west of the state (e.g. Mesa County).[83] In New Mexico, the main distribution follows the Rio Grande and the Pecos River, two waterways that run in a north-south direction through the state.[84] Within the aforementioned rivers, it is also found in the northern part of Far West Texas.[72] In Utah, the painted turtle lives in an area to the south (Kane County) in streams draining into the Colorado River, although it is disputed if they are native.[75][85][86] In Arizona, the painted turtle is native to an area in the east, Lyman Lake.[87][88] The painted turtle is not native to Nevada or California.[17][75]

In Mexico,[84] painted turtles have been found about 50 miles south of New Mexico near Galeana in the state of Chihuahua. There, two expeditions[89][90] found the turtles in the Rio Santa Maria which is in a closed basin.[17][75]

Human-introduced range

Pet releases are starting to establish the painted turtle outside its native range. In California, it is an invasive species that endangers the local western pond turtle, although competition from similarly released red-eared sliders is a greater threat.[91] It has also been introduced into waterways near Phoenix, Arizona,[87] and Miami, Florida,[92] and to Germany, Indonesia, the Philippines, and Spain.[2]

Habitat

An open pond
Painted turtle habitat in New Hampshire

To thrive, painted turtles need fresh waters with soft bottoms, basking sites, and aquatic vegetation. They find their homes in shallow waters with slow-moving currents, such as creeks, marshes, ponds, and the shores of lakes. The subspecies have evolved different habitat preferences.[93]

  • The eastern painted turtle is very aquatic, leaving the immediate vicinity of its water body only when forced by drought to migrate.[94] Along the Atlantic, painted turtles have appeared in brackish waters.[93]
  • The midland and southern painted turtles seek especially quiet waters, usually shores and coves. They favor shallows that contain dense vegetation and have an unusual toleration of pollution.[52][95]
  • The western painted turtle lives in streams and lakes, similar to the other painted turtles, but also inhabits pasture ponds and roadside pools. It is found as high as 1,800 m (5,900 ft).[54]


Population features

Within much of its range, the painted turtle is the most abundant turtle species. Population densities range from 10 to 840 turtles per hectare (2.5 acres) of water surface. Warmer climates produce higher relative densities among populations, and habitat desirability also influences density. Rivers and large lakes have lower densities because only the shore is desirable habitat; the central, deep waters skew the surface-based estimates. Also, lake and river turtles have to make longer linear trips to access equivalent amounts of foraging space.[96]

two diagrams showing numbes on the outer segments of turtle shells. There are some notches and then corresponding numbered code.
Shell marking code

Adults outnumber juveniles in most populations, but gauging the ratios is difficult because juveniles are harder to catch; with current sampling methods, estimates of age distribution vary widely.[97] Annual survival rate of painted turtles increases with age. The probability of a painted turtle surviving from the egg to its first birthday is only 19%. For females, the annual survival rate rises to 45% for juveniles and 95% for adults. The male survival rates follow a similar pattern, but are lower overall than females, creating an average male age lower than that of the female.[98] Natural disasters can confound age distributions. For instance, a hurricane can destroy many nests in a region, resulting in fewer hatchlings the next year.[98] Age distributions may also be skewed by migrations of adults.[97]

To understand painted turtle adult age distributions, researchers require reliable methods.[99] Turtles younger than four years (up to 12 years in some populations) can be aged based on "growth rings" in their shells.[100] For older turtles, some attempts have been made to determine age based on size and shape of their shells or legs using mathematical models, but this method is more uncertain.[100][101] The most reliable method to study the long-lived turtles is to capture them, permanently mark their shells by notching with a drill, release the turtles, and then recapture them in later years.[102][103] The longest-running study, in Michigan, has shown that painted turtles can live more than 55 years.[100][104]

Adult sex ratios of painted turtle populations average around 1:1.[105] Many populations are slightly male-heavy, but some are strongly female-imbalanced; one population in Ontario has a female to male ratio of 4:1.[106] Hatchling sex ratio varies based on egg temperature. During the middle third of incubation, temperatures of 23–27 °C (73–81 °F) produce males, and anything above or below that, females.[107] It does not appear that females choose nesting sites to influence the sex of the hatchlings;[42] within a population, nests will vary sufficiently to give both male and female-heavy broods.[97]

Ecology

Diet

An 11-week-old dragonfly larvae.
Dragonfly larvae are a preferred prey of the southern painted turtle.

The painted turtle hunts along water bottoms. It quickly juts its head into and out of vegetation to stir potential victims out into the open water, where they are pursued.[108] Large prey it holds in its mouth and tears up with its forefeet. It also consumes plants and skims the surface of the water with its mouth open to catch small particles of food.[108]

Although all subspecies of painted turtle eat plants and animals, either alive or dead, their tendencies vary.[108][109]

  • The eastern painted turtle's diet is the least studied. It prefers to eat in the water, but has been observed eating on land. The fish it consumes are typically dead or injured.[109]
  • The southern painted turtle's diet changes with age. Juveniles have a 13% vegetarian diet, adults 88%. This perhaps shows the turtle prefers meat, but can only obtain the amounts desired (by eating small larvae and such) while young.[111] The reversal of feeding habits with age has also been seen in the false map turtle, which inhabits some of the same range. The most common plants eaten by adult southern painted turtles are duckweed and algae, and the most common prey items are dragonfly larvae and crayfish.[112]
  • The western painted turtle's consumption of plants and animals changes seasonally. In early summer, 60% of its diet comprises insects. In late summer, 55% includes plants.[113] Of note, the western painted turtle also eats many white water-lily seeds. Because the hard-coated seeds remain viable after passing through the turtle, they are dispersed by it.[113]

Predators

A common raccoon standing at the shore of a small pond
Raccoons are noted predators of painted turtles.

Painted turtles are most vulnerable to predators when young.[96] Nests are frequently ransacked and the eggs eaten by garter snakes, crows, chipmunks, thirteen-lined ground and gray squirrels, skunks, groundhogs, raccoons, badgers, gray and red fox, and humans.[96] The small and sometimes bite-size, numerous hatchlings fall prey to water bugs, bass, catfish, bullfrogs, snapping turtles, three types of snakes (copperheads, racers and water snakes), herons, rice rats, weasels, muskrats, minks, and raccoons. As adults, the turtles' armored shells protect them from many potential predators, but they still occasionally fall prey to alligators, ospreys, crows, red-shouldered hawks, bald eagles, and especially raccoons.[96]

Painted turtles defend themselves by kicking, scratching, biting, or urinating.[96] In contrast to land tortoises, painted turtles can right themselves if they are flipped upside down.[114]

Behavior

Daily routine and basking

A painted turtle standing on a floating log
Basking for warmth

A cold-blooded reptile, the painted turtle regulates its temperature through its environment, notably by basking. All ages bask for warmth, often alongside other species of turtle. Sometimes more than 50 individuals are seen on one log together.[115] Turtles bask on a variety of objects, often logs, but have even been seen basking on top of common loons that were covering eggs.[116]

The turtle starts its day at sunrise, emerging from the water to bask for several hours. Warmed for activity, it returns to the water to forage.[117] After becoming chilled, the turtle re-emerges for one to two more cycles of basking and feeding.[118] At night, the turtle drops to the bottom of its water body or perches on an underwater object and sleeps.[117]

To be active, the turtle must maintain an internal body temperature between 17–23 °C (63–73 °F). When fighting infection, it manipulates its temperature up to 5 °C (8 °F) higher than normal.[115]

Seasonal routine and hibernation

mound of sticks in the water about 10 feet from shore
Muskrat burrow—possible painted turtle hibernation spot

In the spring, when the water reaches 15–18 °C (59–64 °F), the turtle begins actively foraging. However, if the water temperature exceeds 30 °C (86 °F), the turtle will not feed. In fall, the turtle stops foraging when temperatures drop below the spring set-point.[108]

During the winter, the turtle hibernates. In the north, the inactive season may be as long as from October to March, while the southernmost populations may not hibernate at all.[94] While hibernating, the body temperature of the painted turtle averages 6 °C (43 °F).[119] Periods of warm weather bring the turtle out of hibernation, and even in the north, individuals have been seen basking in February.[120]

The painted turtle hibernates by burying itself, either on the bottom of a body of water, near water in the shore-bank or the burrow of a muskrat, or in woods or pastures. When hibernating underwater, the turtle prefers shallow depths, no more than 2 m (7 ft). Within the mud, it may dig down an additional 1 m (3 ft).[119] In this state, the turtle does not breathe, although if surroundings allow, it may get some oxygen through its skin.[121] The species is one of the best-studied vertebrates able to survive long periods without oxygen. Adaptations of its blood chemistry, brain, heart, and particularly its shell allow the turtle to survive extreme lactic acid buildup while oxygen-deprived.[122]

Movement

Painted turtle with green slime on its shell, on pebbles, with a coupld leafs on its back. Sun shining.
Moving on land

Searching for water, food, or mates, the painted turtles travel up to several kilometers at a time.[123] During summer, in response to heat and water-clogging vegetation, the turtles may vacate shallow marshes for more permanent waters.[123] Short overland migrations may involve hundreds of turtles together.[94] If heat and drought are prolonged, the turtles will bury themselves and, in extreme cases, die.[124]

Foraging turtles frequently cross lakes or travel linearly down creeks. Daily crossings of large ponds have been observed.[124] Tag and release studies show that sex also drives turtle movement. Males travel the most, up to 26 km (16 mi), between captures; females the second most, up to 8 km (5 mi), between captures; and juveniles the least, less than 2 km (1.2 mi), between captures.[123] Males move the most and are most likely to change wetlands because they seek mates.[124]

The painted turtles, through visual recognition, have homing capabilities.[123] Many individuals can return to their collection points after being released elsewhere, trips that may require them to traverse land. One experiment placed 98 turtles varying several-kilometer distances from their home wetland; 41 returned. When living in a single large body of water, the painted turtles can home from up to 6 km (4 mi) away. Females may use homing to help locate suitable nesting sites.[123]

Life cycle

Mating

The painted turtles mate in spring and fall in waters of 10–25 °C (50–77 °F).[93] Males start producing sperm in early spring, when they can bask to an internal temperature of 17 °C (63 °F).[125][126] Females begin their reproductive cycles in mid-summer, and ovulate the following spring.[107]

Courtship begins when a male follows a female until he meets her face-to-face.[106] He then strokes her face and neck with his elongated front claws, a gesture returned by a receptive female. The pair repeat the process several times, with the male retreating from and then returning to the female until she swims to the bottom, where they copulate.[106][107] As the male is smaller than the female, he is not dominant.[106] The female stores sperm, to be used for up to three clutches, in her oviducts; the sperm may remain viable for up to three years.[127] A single clutch may have multiple fathers.[127]

Egg-laying

A female digging a nest with her hind legs.
A female digging a nest

Nesting is done, by the females only, between late May and mid-July.[107] The nests are vase-shaped and are usually dug in sandy soil, often at sites with southern exposures.[128] Nests are often within 200 m (220 yd) of water, but may be as far away as 600 m (660 yd), with older females tending to nest further inland. Nest sizes vary depending on female sizes and locations but are about 5–11 cm (2–4 in) deep.[128] Females may return to the same sites several consecutive years, but if several females make their nests close together, the eggs become more vulnerable to predators.[128]

The female's optimal body temperature while digging her nest is 29–30 °C (84–86 °F).[128] If the weather is unsuitable, for instance a too hot night in the Southeast, she delays the process until later at night.[128] Painted turtles in Virginia have been observed waiting three weeks to nest because of a hot drought.[129]

While preparing to dig her nest, the female sometimes exhibits a mysterious preliminary behavior. She presses her throat against the ground of different potential sites, perhaps sensing moisture, warmth, texture, or smell, although her exact motivation is unknown. She may further temporize by excavating several false nests[128] as the wood turtles also do.[130]

The female relies on her hind feet for digging. She may accumulate so much sand and mud on her feet that her mobility is reduced, making her vulnerable to predators. To lighten her labors, she lubricates the area with her bladder water.[128] Once the nest is complete, the female deposits into the hole. The freshly laid eggs are white, elliptical, porous, and flexible.[131] From start to finish, the female's work may take four hours. Sometimes she remains on land overnight afterwards, before returning to her home water.[128]

Females can lay five clutches per year, but two is a normal average after including the 30–50% of a population's females that do not produce any clutches in a given year.[128] In some northern populations, no females lay more than one clutch per year.[128] Bigger females tend to lay bigger eggs and more eggs per clutch.[132] Clutch sizes of the subspecies vary, although the differences may reflect different environments, rather than different genetics. The two more northerly subspecies, western and midland, are larger and have more eggs per clutch—11.9 and 7.6, respectively—than the two more southerly subspecies, southern (4.2) and eastern (4.9). Within subspecies, also, the more northerly females lay larger clutches.[128]

Growth

Incubation lasts 72–80 days in the wild[107] and for a similar period in artificial conditions.[129] In August and September, the young turtle breaks out from its egg, using a special projection of its jaw called the egg tooth.[57] Not all offspring leave the nest immediately, though.[107] Hatchlings north of a line from Nebraska to northern Illinois to New Jersey[133] typically arrange themselves symmetrically[134] in the nest and overwinter to emerge the following spring.[107]

Several baby painted turtles on moss on a light table.
Hatchling painted turtles

The hatchling's ability to survive winter in the nest has allowed the painted turtle to extend its range further north than any other American turtle. The painted turtle is genetically adapted to survive extended periods of subfreezing temperatures with blood that can remain supercooled and skin that resists penetration from ice crystals in the surrounding ground.[133] The hardest freezes nevertheless kill many hatchlings.[107]

Immediately after hatching, turtles are dependent on egg yolk material for sustenance.[134] About a week to a week and a half after emerging from their eggs (or the following spring if emergence is delayed), hatchlings begin feeding to support growth. The young turtles grow rapidly at first, sometimes doubling their size in the first year. Growth slows sharply at sexual maturity and may stop completely.[135] Likely owing to differences of habitat and food by water body, growth rates often differ from population to population in the same area. Among the subspecies, the western painted turtles are the fastest growers.[136]

Females grow faster than males overall, and must be larger to mature sexually.[135] In most populations males reach sexual maturity at 2–4 years old, and females at 6–10.[126] Size and age at maturity increase with latitude;[44] at the northern edge of their range, males reach sexual maturity at 7–9 years of age and females at 11–16.[106]

Conservation

An orange, diamond-shaped sign on the right side of a winding road way that says "Slow: crossing season" with a picture of a turtle.
British Columbia road sign

The decline in painted turtle populations is not a simple matter of dramatic range reduction, like that of the American bison. Instead the turtle is classified as G5 (demonstrably widespread) in its Natural Heritage Global Rank,[55] and the IUCN rates it as a "Least Concern" species.[2] The painted turtle's high reproduction rate and its ability to survive in polluted wetlands and artificially made ponds have allowed it to maintain its range,[34][137] but the post-Columbus settlement of North America has reduced its numbers.[111][138]

Only within the Pacific Northwest is the turtle's range eroding. Even there, in Washington, the painted turtle is designated S5 (demonstrably widespread). However, in Oregon, the painted turtle is designated S2 (imperiled),[139] and in British Columbia, the turtle's populations in the Coast and Interior regions are labeled "endangered"[140] and "of special concern", respectively.[141][nb 7]

Much is written about the different factors that threaten the painted turtle, but they are unquantified, with only inferences of relative importance.[96][98][111] A primary threat category is habitat loss in various forms. Related to water habitat, there is drying of wetlands, clearing of aquatic logs or rocks (basking sites), and clearing of shoreline vegetation, which allows more predator access[146] or increased human foot traffic.[147][148] Related to nesting habitat, urbanization or planting can remove needed sunny soils.[149]

Oregon's Native Turtles.ogv
Oregon conservation video: 0:30–0:60 conservation factors; 1:50–2:00 hoop trap.(If video play problematic, see[150] or [151] for alternative video streams.)

Another significant human impact is roadkill—dead turtles, especially females, are commonly seen on summer roads.[152] In addition to direct killing, roads genetically isolate some populations.[152] Localities have tried to limit roadkill by constructing underpasses,[153] highway barriers,[114] and crossing signs.[154] Oregon has introduced public education on turtle awareness, safe swerving, and safely assisting turtles across the road.[155]

In the West, human-introduced bass, bullfrogs, and especially snapping turtles, have increased the predation of hatchlings.[114][156] Outside the Southeast, where sliders are native, released pet red-eared slider turtles increasingly compete with painted turtles.[157] In cities, increased urban predators (raccoons, canines, and felines) may impact painted turtles by eating their eggs.[146]

Other factors of concern for the painted turtles include over-collection from the wild,[158] released pets introducing diseases[159] or reducing genetic variability,[157] pollution,[160] boating traffic, angler's hooks (the turtles are noteworthy bait-thieves), wanton shooting, and crushing by agricultural machines or golf course lawnmowers or all-terrain vehicles.[161][162][163] Gervais and colleagues note that research itself impacts the populations and that much funded turtle trapping work has not been published. They advocate discriminating more on what studies are done, thereby putting fewer turtles into scientists' traps.[164] Global warming represents an uncharacterized future threat.[138][165]

Use

Pets

"... we do not necessarily encourage people to collect these turtles. Turtles kept as pets usually soon become ill ... The best way to enjoy our native turtles is to observe them in the wild ... it would be better to take a picture than a 'picta'!"

Pennsylvania Fish and Boat Commission[71]

According to a trade data study, painted turtles were the second most popular pet turtles after red-eared sliders in the early 1990s.[166] As of 2010, most U.S. states allow, but discourage, painted turtle pets, although Oregon forbids keeping them as pets,[167] and Indiana prohibits their sale.[159] U.S. federal law prohibits sale or transport of any turtle less than 10 cm (4 in), to limit human contact to salmonella.[168] However, a loophole for scientific samples allows some small turtles to be sold, and illegal trafficking also occurs.[156][169]

Painted turtle pet-keeping requirements are similar to those of the red-eared slider. Keepers are urged to provide them with adequate space and a basking site, and water that is regularly filtered and changed. The animals are described as being somewhat unsuitable for children as they do not enjoy being held. Hobbyists have kept turtles alive for decades.[170][171][172]

Other uses

The painted turtle is sometimes eaten but is not highly regarded as food,[111][173][174] as even the largest subspecies, the western painted turtle, is inconveniently small and larger turtles are available.[175] Schools frequently dissect painted turtles, which are sold by biological supply companies;[176] specimens often come from the wild but may be captive-bred.[177] In the Midwest, turtle racing is popular at summer fairs.[176][178][179]

Capture

Commercial harvesting of painted turtles in the wild is controversial, and increasingly restricted.[180][181] For instance, Wisconsin formerly had virtually unrestricted trapping of painted turtles, but based on qualitative observations forbade all commercial harvesting in 1997.[182] In neighboring Minnesota trappers collected more than 300,000 painted turtles during the 1990s.[152]

Worried by Wisconsin's example, Minnesota commissioned Gamble and Simon to undertake a quantitative study of the impact of harvesting on their own painted turtles.[176] The scientists found that harvested lakes averaged half the painted turtle density of off-limit lakes. Population modeling demonstrated that unrestricted harvests could produce a large decline in turtle populations.[158] Minnesota forbade new harvesters in 2002, and limited trap numbers. Although harvesting continued,[158] subsequent takes averaged half those of the 1990s.[183]

A square turtle trap is floating near some reeds. There is a plank across the middle, but open access to a space in the middle otherwise, that three turtles are basking on, one crawling on the other. The outer sides of the trap slope and one turtle is starting to climb out of the water, up onto the trap. It is sunny.
A basking trap in Minnesota

As of 2009, painted turtles faced virtually unlimited harvesting in Arkansas, Iowa, Missouri, Ohio, and Oklahoma.[184] Since then, Missouri has prohibited their harvesting.[185]

Individuals who trap painted turtles typically do so to earn additional income,[158][180] selling a few thousand a year at $1–2 each.[176] Many trappers have been involved in the trade for generations, and value it as a family activity.[182] Some harvesters disagree with limiting the catch, saying the populations are not dropping.[182]

Many U.S. state fish and game departments allow non-commercial taking of painted turtles under a creel limit, and require a fishing (sometimes hunting) license;[nb 8] others completely forbid the recreational capture of painted turtles. Trapping is not allowed in Oregon, where western painted turtle populations are in decline,[190] and in Missouri, where there are populations of both southern and western subspecies.[185] In Canada, Ontario protects both subspecies present, the midland and western,[191] and British Columbia protects its dwindling western painted turtles.[57]

Capture methods are also regulated by locality. Typically trappers use either floating "basking traps" or partially submerged, baited "hoop traps".[192] Trapper opinions,[192] commercial records,[183] and scientific studies[192][193][194] show that basking traps are more effective for collecting painted turtles, while the hoop traps work better for collecting "meat turtles" (snapping turtles and soft-shell turtles). Nets, hand capture, and fishing with set lines are generally legal, but shooting (either deliberate or wanton), chemicals, and explosives are forbidden.[nb 9]

Culture

"Whereas, the Painted Turtle is a hard worker and can withstand cold temperatures like the citizens of Vermont, and Whereas, the colors of the Painted Turtle represent the beauty of our state in autumn... the General Assembly hereby recognizes the Painted Turtle as the official state reptile... "

Vermont J.R.S. 57[195]

Indian tribes were familiar with the painted turtle—young braves were trained to recognize its splashing into water as an alarm—and incorporated it in folklore.[196] A Potawatomi myth describes how the talking turtles, "Painted Turtle" and allies "Snapping Turtle" and "Box Turtle", outwit the village squaws. Painted Turtle is the star of the legend and uses his distinctive markings to trick a woman into holding him so he can bite her.[197] An Illini myth recounts how Painted Turtle put his paint on to entice a chief's daughter into the water.[198]

As of 2010, four U.S. states designated the painted turtle as official reptile. Vermont honored the reptile in 1994, following the suggestion of Cornwall Elementary School students.[195] In 1995, Michigan followed, based on the recommendation of Niles fifth graders, who discovered the state lacked an official reptile.[199] Illinois citizens, in 2004, voted to select the painted turtle as their state reptile and the legislature made it official in 2005.[200] Colorado chose the western painted turtle in 2008, following the efforts of two succeeding years of Jay Biachi's fourth grade classes.[201] In New York, the painted turtle narrowly lost (5,048 to 5,005, versus the common snapping turtle) a 2006 statewide student election for state reptile.[202]

A large turtle statue standing on two legs and holding a Canadian flag in one hand an American flag in the other.
Tommy the Turtle

In the border town of Boissevain, Manitoba, a 10,000 lb (4,500 kg) western painted turtle, Tommy the Turtle, is a roadside attraction. The statue was built in 1974 to celebrate the Canadian Turtle Derby, a festival including turtle races that ran from 1972–2001.[203]

Another Canadian admirer of the painted turtle is Jon Montgomery, who won the 2010 Olympic gold medal in skeleton (a form of sled) racing, while wearing a painted turtle painting on the crown of his helmet, prominently visible when he slid downhill. Montgomery, who also iconically tattoed his chest with a maple-leaf,[204] explained his visual promotion of the turtle, saying that he had assisted one to cross the road. BC Hydro referred to Montgomery's action when describing its own sponsorship of conservation research for the turtle in British Columbia.[205][206]

Several private entities use the painted turtle as a symbol. Wayne State University Press operates an imprint "named after the Michigan state reptile" that "publishes books on regional topics of cultural and historical interest".[207] In California, The Painted Turtle is a camp for ill children, founded by Paul Newman. Painted Turtle Winery of British Columbia trades on the "laid back and casual lifestyle" of the turtle with a "job description to bask in the sun".[208] Also, there are two Internet companies in Michigan,[209][210] a guesthouse in British Columbia,[211] and a café in Maine that use the painted turtle commercially.[212]

In children's books, the painted turtle is a popular subject, with at least seven books published between 2000 and 2010.[nb 10] "Painted turtle: state reptile of Michigan" is a short song for children.[220][221]

Notes and references

Notes
  1. ^ In December 2010 the turtle taxonomy working group provisionally elevated Chrysemys picta dorsalis to the species Chrysemys dorsalis but kept the classification as a subspecies as valid.[2]
  2. ^ Bishop and Schmidt alluded to glacial origins even earlier.[15]
  3. ^ All turtle lengths in this article refer to the top shell (carapace) length, not the extended head to tail length.
  4. ^ The range description and map primarily rely on Conant and Collins (1998)[56] and Ernst and Lovich have a similar range map.[17] Additional citations and notes cover details of range boundaries especially in the West.
  5. ^ Vancouver Island painted turtle populations may have resulted from escaped pets.[57]
  6. ^ See the following sources.[48][59][60][61][62]
  7. ^ The iconic painted turtle is popular in British Columbia, and the province is spending to save the painted turtle as only a few thousand turtles remain in the entire province.[142][143][144][145]
  8. ^ State fish and game creel limits.[66][162][163][186][187][188][189]
  9. ^ State fish and game taking restrictions.[66][162][163][187][188][189]
  10. ^ 2000–2010 children's books on the painted turtle.[213][214][215][216][217][218][219]
Citations
  1. ^ a b Ernst & Lovich 2009, pp. 184–185.
  2. ^ a b c d e f g h i Rhodin et al. 2010, p. 000.99.
  3. ^ a b Mann 2007, p. 6.
  4. ^ a b c Ercelawn, Aliya. "Taxonomic information". Herpetology Species Page. Prof. Theodora Pinou (Western Connecticut State University Biological and Environmental Sciences Department). http://people.wcsu.edu/pinout/herpetology/cpicta/taxonomicinfo.html. Retrieved 2011-02-06. 
  5. ^ Rhodin et al. 2010, pp. 000.91,000.99.
  6. ^ Carr 1952, p. 214.
  7. ^ "Taxonomy chapter for turtle, eastern painted (030060)". BOVA Booklet. Virginia Fish and Wildlife Information Service. 2010. http://www.vafwis.org/fwis/booklet.html?&bova=030060&Menu=_.Taxonomy. Retrieved 2010-12-17. 
  8. ^ Beltz, Ellin (2006). "Scientific and common names of the reptiles and amphibians of North America – explained". http://ebeltz.net/herps/etymain.html#Turtles. Retrieved 2010-12-13. 
  9. ^ Hoffman, Richard L. (1987-03). "'Skilpot': a request for information". Virginia Herpetological Society Bulletin 85. http://www.virginiaherpetologicalsociety.com/bulletins/VHS%20Bulletin%2085.pdf. "When I was a child living in Clifton Forge, VA, the name by which I learned Chrysemys picta, painted turtle, was 'skilpot'." 
  10. ^ a b Schneider, Johann Gotttlob (1783) (in German) (Gothic script). Allgemeine naturgeschichte der schildkröten. Leipzig. p. 348. http://books.google.com/books?id=wl5HAAAAYAAJ&pg=PA348&dq=unter%20dem%20namen. Retrieved 2011-02-08. "...unter dem namen Testudo picta..." 
  11. ^ a b c Fritz 2007, p. 177.
  12. ^ Gray, John Edward (1831). "A synopsis of the species of the class reptilia". In Griffith, Edward. The Animal Kingdom Arranged in Conformity with Its Organization: The class reptilia, with specific descriptions, volume 9. London: Whittikar, Treacher. p. 12. http://books.google.com/?id=_n1IAAAAMAAJ&pg=PA1&dq=John+edward+gray. Retrieved 2011-07-20. 
  13. ^ Fritz 2007, p. 178.
  14. ^ Agassiz, Louis (1857). Contributions to the natural history of the United States of America: First monograph: in three parts. Boston: Little, Brown. pp. 439–440. http://books.google.com/?id=M2Q_AAAAcAAJ&pg=PA439&dq=agassiz. Retrieved 2011-07-20. 
  15. ^ a b Bishop, Sherman; Schmidt, F. J. W. (1931). "The painted turtles of the genus Chrysemys". Zoological Series (Field Museum of Natural History) 18 (4): 123–139. http://books.google.com/books?id=9sNJAAAAYAAJ&pg=RA123. Retrieved 2011-01-06. 
  16. ^ a b c Bleakney, Sherman (1958-07-23). "Postglacial dispersal of the turtle Chrysemys picta". Herpetologica 14 (2): 101–104. JSTOR 3889448.  (Subscription required)
  17. ^ a b c d e f g h i j k l Ernst & Lovich 2009, p. 185.
  18. ^ a b c Ernst & Lovich 2009, p. 187.
  19. ^ Carr 1952, p. 213.
  20. ^ Holman, J. Alan (1977-09). "Comments on turtles of the genus Chrysemys Gray". Herpetologica 33 (3): 274. JSTOR 3891939.  (Subscription required)
  21. ^ Ernst & Barbour 1989, p. 203.
  22. ^ Williams, Robert W (2007-12-17). "Mass grave from the remote past" (also avail. as pdf). Norwegian Continental Shelf (Norwegian Petroleum Directorate) 2007 (3). http://www.npd.no/en/Publications/Norwegian-Continental-Shelf/No-3-2007/Mass-grave-from-the-remote-past/. Retrieved 2011-02-08. 
  23. ^ Starkey, David; Shaffer, H. Bradley; Burke, Russel; Forstner, Micheal R. J.; Iverson, John B.; Janzen, Fredric J.; Rhodin, Anders G. J.; Ultsch, Gordon R. (2003). "Molecular systematics, phylogeography, and the effects of pleistocene glaciation in the painted turtle (Chrysemys picta) complex". Evolution 57 (1): 119–128. PMID 12643572. http://people.hofstra.edu/russell_l_burke/PDFs/starkey_et_al.pdf. 
  24. ^ Mann 2007, p. 2.
  25. ^ a b c d Ernst, Barbour & Lovich 1994, p. 276.
  26. ^ Bickham, J. W.; Carr, J. L. (1983). "Taxonomy and phylogeny of the higher categories of". Copeia 4: 918–932.  as cited in Mann 2007, p. 10.
  27. ^ Killebrew, F. C. (1977). "Mitotic chromosomes of turtles. IV. The Emydidae". Texas Journal of Science 24: 249–253.  as cited in Mann 2007, p. 10.
  28. ^ Killebrew, Flavius C. (1975-07-28). "Mitotic chromosomes of turtles: I. The Pelomedusidae". Journal of Herpetology 9 (3): 282–285. 
  29. ^ a b Mann 2007, p. 11.
  30. ^ Waters, J. H. (1969). "Additional observations of Southeastern Massachusetts insular and". Copeia 1: 179–182.  as cited in Mann 2007, p. 11.
  31. ^ Gervais et al. 2009, p. 22.
  32. ^ "Approved sequencing targets". National Human Genome Research Institutes (National Institutes of Health). http://www.genome.gov/10002154. Retrieved 2011-02-14. 
  33. ^ Dobie, James L. (1981–1982). "The taxonomic relationship between Malaclemys Gray, 1844 and Graptemys agassiz, 1857 (Testudines: Emydidae)". Tulane Studies in Zoology and Botany 23: 85–103. http://www.archive.org/stream/tulanestudiesinz2319811982tula/tulanestudiesinz2319811982tula_djvu.txt. Retrieved 2011-01-04. 
  34. ^ a b c d Ercelawn, Aliya. "Species identification". Herpetology Species Page. Prof. Theodora Pinou (Western Connecticut State University Biology and Environmental Sciences). http://people.wcsu.edu/pinout/herpetology/cpicta/speciesidentification.html. Retrieved 2011-02-06. 
  35. ^ a b "Painted turtle (Chrysemys picta)". Savannah River Ecology Laboratory Herpetology Program. http://www.uga.edu/srelherp/turtles/chrpic.htm. Retrieved 2010-09-18. 
  36. ^ a b c Ernst & Lovich 2009, p. 184.
  37. ^ Cohen, Mary (1992-10). "The painted turtle, Chrysemys picta". Tortuga Gazette 28 (10): 1–3. http://www.tortoise.org/archives/chrysemy.html. Retrieved 2011-01-05. 
  38. ^ Ernst & Lovich 2009, p. 263.
  39. ^ "Reptiles: Turtle & tortoise". Animal Bytes. http://www.sandiegozoo.org/animalbytes/t-turtle.html. Retrieved 2011-01-02. "Turtle— Spends most of its life in the water. Turtles tend to have webbed feet for swimming." 
  40. ^ "Painted turtle". US Bureau of Land Management. http://www.blm.gov/id/st/en/prog/wildlife/reptiles/turtles_and_lizards/painted_turtle1.html. Retrieved 2011-01-02. "They have webbed toes for swimming..." 
  41. ^ Ernst, Barbour & Lovich 1994, p. 277.
  42. ^ a b Ernst, Barbour & Lovich 1994, p. 291.
  43. ^ Ernst & Barbour 1972, p. 143.
  44. ^ a b Ernst & Lovich 2009, p. 197.
  45. ^ Jolliceur, Pierre; Mosimann, James E. (1960). "Size and shape variation in the painted turtle. A prinicipal component analysis". Growth 24: 339–354. PMID 13790416. http://www.faculty.biol.ttu.edu/strauss/Morphometrics/Readings/JolicoeurMosimann1960.pdf. 
  46. ^ Rowe, John W. (1997-07-01). "Growth rate, body size, sexual dimorphism and morphometric variation in four populations of painted turtles (Chrysemys picta bellii) from Nebraska" (subscription). American Midland Naturalist 138 (1): 174–188. doi:10.2307/2426664. JSTOR 2426664. 
  47. ^ Senneke, Darrell (2003). "Differentiating male and female Chrysemys picta (painted turtle)". World Chelonian Trust. http://www.chelonia.org/sexing/sexing_Chrysemys_picta.htm. Retrieved 2011-02-07. 
  48. ^ a b Lee-Sasser, Marisa (2007-12). "Painted turtle in Alabama". Alabama Department of Conservation and Natural Resources. http://www.outdooralabama.com/watchable-wildlife/what/Reptiles/Turtles/pt.cfm. Retrieved 2010-08-12. "Intergrades exhibit a mix of characteristics where their ranges overlap." 
  49. ^ a b c d Senneke, Darrell (2003). "Differentiating painted turtles (Chrysemys picta ssp)". World Chelonian Trust. http://www.chelonia.org/Articles/diffpaintedturtles.htm. Retrieved 2010-12-09. 
  50. ^ "Eastern painted turtle Chrysemys picta picta (Schneider)". Nova Scotia Museum. 2007. http://museum.gov.ns.ca/amphibians/en/turtles/painted.asp. Retrieved 2010-09-29. 
  51. ^ "Midland painted turtle (Chrysemys picta marginata)". Natural Resources Canada. 2007-09-24. http://cfs.nrcan.gc.ca/subsite/glfc-amphibians/chrysemys-picta-marginata. Retrieved 2010-09-29. [dead link]
  52. ^ a b Carr 1952, p. 226.
  53. ^ a b Ernst & Lovich 2009, p. 186.
  54. ^ a b Carr 1952, p. 221.
  55. ^ a b Gervais et al. 2009, p. 5.
  56. ^ a b c d e f g h i Conant, Roger; Collins, Joseph T. (1998). Field guide to reptiles and amphibians of eastern and central North America. New York: Houghton Mifflin Harc. pp. 185–186. ISBN 978-0-395-90452-7. 
  57. ^ a b c d Blood, Donald A.; Macartney, Malcom (1998-03). "Painted turtle" (brochure). Wildlife Branch, Ministry of Environment, Lands and Parks, British Columbia. http://www.paintedturtle.ca/content/pdf/Painted_Turtles_Willife_at_Risk.pdf. 
  58. ^ "County occurrence maps for turtle, eastern painted". Eastern painted turtle (Chrysemys picta picta). Virginia Department of Game and Inland Fisheries. 2004-05-13. http://www.dgif.virginia.gov/wildlife/species/maps/030060-map.jpg. Retrieved 2011-02-10. 
  59. ^ Wright, Katherine M.; Andrews, James S. (2002). "Painted turtles (Chrysemys picta) of Vermont: An examination of phenotypic variation and intergradation". Northeastern Naturalist (Humboldt Field Research Institute) 9 (4): 363–380. doi:10.1656/1092-6194(2002)009[0363:PTCPOV]2.0.CO;2. ISSN 1092-6194. http://www.bioone.org/doi/abs/10.1656/1092-6194(2002)009%5B0363:PTCPOV%5D2.0.CO%3B2. Retrieved 2011-01-02. 
  60. ^ a b Weller, Wayne F.; Hecnar, Stephen J.; Hecnar, Darlene R.; Casper, Gary S.; Dawson, F. Neil (2010). "Quantitative assessment of intergradation between two subspecies of painted turtles, Chrysemys picta bellii and C. p. marginata, in the Algoma district of west central Ontario, Canada". Herpetological Conservation and Biology 5 (2): 166–173. http://www.herpconbio.org/Volume_5/Issue_2/Weller_etal_2010.pdf. 
  61. ^ Mann 2007, p. 20.
  62. ^ Ultsch, Gordon R.; G. Milton Ward, Chere' M. LeBerte, Bernard R. Kuhajda, and E. Ray Stewart (2001). "Intergradation and origins of subspecies of the turtle Chrysemys picta: morphological comparisons" (link to full text, subscription). Canadian Journal of Zoology 79 (3): 485–498. doi:10.1139/z01-001. http://www.nrcresearchpress.com/doi/pdf/10.1139/z01-001. 
  63. ^ "Eastern painted turtle". New Hampshire Fish and Game Department. http://www.wildlife.state.nh.us/Wildlife/Nongame/turtles/painted_turtle.htm. Retrieved 2011-02-10. 
  64. ^ Hunter, Malcom L.; Calhoun, Aram J. K.; McCollough, Mark (1999). Maine amphibians and reptiles. University of Maine Press. ISBN 978-0-89101-096-8.  as cited by "Amphibians and reptiles". Damariscotta Lake Watershed Association. http://www.dlwa.org/docs/reptiles_and_amphibians.pdf. Retrieved 2011-02-10. 
  65. ^ Carr 1952, p. 215.
  66. ^ a b c d "Nongame species protected by Alabama regulations". Alabama Division of Wildlife and Freshwater Fisheries. http://www.outdooralabama.com/watchable-wildlife/regulations/nongame.cfm. Retrieved 2010-12-08. 
  67. ^ Pugh, F. Harvey; Pugh, Margaret B. (1968-07-31). "The systematic status of painted turtles (Chrysemys) in the northeastern United States" (subscription). Copeia 1968 (1): 612–618. doi:10.2307/1442033. JSTOR 1442033. 
  68. ^ DeGraaf, Richard M.; Yamasaki, Mariko (2000). New England wildlife: habitat, natural history, and distribution. Lebanaoon, New Hampshire: University Press of New England. p. 52. ISBN 978-0-87451-957-0. "In New England there are no midland populations per se. Individuals are part of an intergrade swarm." 
  69. ^ Green, N. Baynard; Pauley, Thomas K. (1987). Amphibians and reptiles in West Virginia. University of Pittsburgh Press. ISBN 978-0-8229-5802-4.  as cited in Mann p 18.
  70. ^ Ernst, Carl H. (1970-05-29). "The status of the painted turtle, Chrysemys picta, in Tennessee and Kentucky" (subscription). Journal of Herpetology 4 (1): 39–45. doi:10.2307/1562701. JSTOR 1562701. 
  71. ^ a b Shiels, Andrew L. "A picta worth a thousand words: Portrait of a painted turtle". P ennsylvania Angler and Boater catalog. Pennsylvania Fish and Boating Commission. pp. 28–30. http://www.fish.state.pa.us/education/catalog/pictathousand.pdf. Retrieved 2011-07-20. 
  72. ^ a b Dixon, James Ray (2000). "painted+turtle" Amphibians and reptiles of Texas. Texas A&M University Press. p. 196. ISBN 978-0-89096-920-5. http://books.google.com/books?id=-sNcnJoQMD4C&pg=PA196&dq="painted+turtle". Retrieved 2011-01-14. 
  73. ^ a b "Species of turtles in OK". Oklahoma Department of Wildlife Conservation. Archived from the original on 2011-05-25. http://web.archive.org/web/20110525184242/http://www.wildlifedepartment.com/fishregs/turtlebullfrogreg.htm. Retrieved 2011-07-21. 
  74. ^ McAllister, Chris T.; Forstner, Michael R.J.; Fuller, Jonathan P. (2007-05-01). "Second report of the southern painted turtle, Chrysemys dorsalis (testudines: emydidae), from Texas, with comments on its genetic relationship to other populations". The Texas Journal of Science 59 (2). 
  75. ^ a b c d e f Stebbins, Robert C.; Peterson, Roger Tory (2003). A field guide to western reptiles and amphibians (Peterson field guide). New York: Houghton Mifflin Harcourt. pp. 251–252. ISBN 978-0-395-98272-3. http://books.google.com/books?id=9JznHN2VFzkC&pg=PT105&dq=rio+santa+maria+chrysemys+picta. Retrieved 2011-01-08. 
  76. ^ COSEWIC 2006, pp. 6–8.
  77. ^ "Painted turtle - Chrysemys picta". Montana field guides. Montana Fish, Wildlife, and Parks. http://fieldguide.mt.gov/detail_ARAAD01010.aspx. Retrieved 2011-02-11. 
  78. ^ "Western painted turtle (Chrysemys picta belli)". Wyoming conservation strategy. Wyoming Game and Fish Department. pp. 430–431. http://gf.state.wy.us/wildlife/CompConvStrategy/Species/Reptiles/PDFS/Western%20Painted%20Turtle.pdf. Retrieved 2011-02-11. 
  79. ^ "Painted turtle (Chrysemys picta)". Idaho's reptiles. U.S. Department of the Interior Bureau of Land Management. http://www.blm.gov/id/st/en/prog/wildlife/reptiles/turtles_and_lizards/painted_turtle1.html. Retrieved 2011-02-11. 
  80. ^ "Painted turtle - known distribution". Washington Department of Natural Resources. http://www1.dnr.wa.gov/nhp/refdesk/herp/html/map_chpi.html. Retrieved 2011-02-11. 
  81. ^ Hallock, L. A.; McAllister, K. R. (2005-02-01). "Painted turtle". Washington herp atlas. Washington Department of Natural Resources. http://www1.dnr.wa.gov/nhp/refdesk/herp/html/4chpi.html. Retrieved 2011-02-11. 
  82. ^ Gervais et al. 2009, pp. 26–31.
  83. ^ "Painted turtle". Species profiles. Colorado Division of Wildlife. http://wildlife.state.co.us/WildlifeSpecies/Profiles/ReptilesAndAmphibians/Pages/PaintedTurtle.aspx. Retrieved 2011-02-11. 
  84. ^ a b Degenhardt, William G.; Painter, Charles W.; Price, Andrew H. (1996). Amphibians and reptiles of New Mexico. University of New Mexico Press. p. 100. ISBN 0-8263-1695-6. http://books.google.com/books?id=r-Liq4O4udsC&dq=painted+turtle&pg=PA100. Retrieved 2011-01-03. "...extreme Northern Chihuahua, Mexico." 
  85. ^ Dotson, P.. "Painted turtle". Utah Department of Natural Resources. http://dwrcdc.nr.utah.gov/rsgis2/search/Display.asp?FlNm=chrypict. Retrieved 2011-02-11. 
  86. ^ "Utah GAP analysis - painted turtle". Utah Department of Natural Resources. http://dwrcdc.nr.utah.gov/rsgis2/search/Map.asp?Id=671. Retrieved 2011-02-11. 
  87. ^ a b "Arizona game and fish department". Unpublished abstract compiled and edited by the Heritage Data Management System, Arizona Game and Fish Department, Phoenix, AZ. 2007-02-22. http://www.azgfd.gov/w_c/edits/documents/Chrypibe.d.pdf. 
  88. ^ "Chrysemys picta belli occurrences in Arizona". Arizona Game and Fish Department. 2007-07-22. http://www.azgfd.gov/w_c/edits/images/chrypibe.GIF. Retrieved 2011-02-11. 
  89. ^ Smith, Hobart M.; Taylor, Edward H. (1950). An annotated checklist and key to the reptiles of Mexico exclusive of the snakes. 199. Smithsonian Institute. pp. 33–34. http://si-pddr.si.edu/dspace/handle/10088/10203. Retrieved 2011-01-08. "Recorded only from the state of Chihuahua: Rio Santa Maria, near Progreso" 
  90. ^ Tanner, Wilmer W. (1987-07). "Lizards and turtles of western Chihuahua" (linked pdf). Great Basin Naturalist 47 (3): 383–421. https://ojs.lib.byu.edu/ojs/index.php/wnan/article/viewArticle/1829. Retrieved 2011-01-09. "Rio Santa Maria, above bridge west of Galeana..." 
  91. ^ Spinks, Phillip Q.; Pauly, Gregory B.; Crayon, John J.; Shaffer, H. Bradley (2003). "Survival of the western pond turtle (Emys marmorata) in an urban California environment". Biological Conservation 113 (2): 257–267. doi:10.1016/S0006-3207(02)00392-0. http://www.cnah.org/pdf_files/203.pdf. 
  92. ^ "Nonindigenous aquatic species: Chrysemys picta". U.S. Geological Survey. http://nas.er.usgs.gov/queries/CollectionInfo.aspx?SpeciesID=1229. Retrieved 2011-02-11. 
  93. ^ a b c Ernst & Barbour 1989, p. 202.
  94. ^ a b c Carr 1952, p. 217.
  95. ^ Carr 1952, p. 231.
  96. ^ a b c d e f Ernst, Barbour & Lovich 1994, p. 294.
  97. ^ a b c Ernst, Barbour & Lovich 1994, p. 295.
  98. ^ a b c Ernst & Lovich 2009, p. 211.
  99. ^ Gibbons, J. Whitfield (1987-05). "Why do turtles live so long". BioScience 37 (4): 262–269. doi:10.2307/1310589. JSTOR 1310589. http://140.122.143.143/snake/%E8%84%8A%E6%A4%8E%E5%8B%95%E7%89%A9/%E8%84%8A%E6%A4%8E%E5%8B%95%E7%89%A9%E5%AD%B8%E8%AC%9B%E7%BE%A9%E9%9B%BB%E5%AD%90%E6%AA%94/9.%20why%20do%20turtles%20live%20so%20long.pdf. 
  100. ^ a b c Zweifel, Richard George (1989). Long-term ecological studies on a population of painted turtles, Chrysemys picta, on Long Island, New York (American Museum novitates no. 2952). New York: American Museum of Natural History. pp. 18–20. http://digitallibrary.amnh.org/dspace/bitstream/2246/5106/1/N2952.pdf. 
  101. ^ Fowle, Suzanne C. (1996). "Effects of roadkill mortality on the western painted turtle (Chrysemys picta belli) in the Mission valley, western Montana". In Evink, G.; Zeigler, D.; Garrett, P.; Berry, J. Highways and movement of wildlife: improving habitat connections and wildlife passageways across highway corridors. Proceedings of the transportation-related wildlife mortality seminar of the Florida Department of Transportation and the Federal Highway Administration. Report FHWA-PD-96-041. Florida Department of Transportation (Orlando). pp. 205–223. http://www.icoet.net/downloads/96paper16.pdf. Retrieved 2011-07-20. 
  102. ^ Cagle, Fred R. (1939-09-09). "A system of marking turtles for future identification". Copeia 3 (3): 170–173. JSTOR 1436818. "A system to be used in marking turtles must be permanent, since turtles have a long life span, must definitely identify each individual, must not handicap the turtle in any way, and should be simple and easy to use."  (Subscription required)
  103. ^ Macartney, M.; Gregory, P. T. (1985). The western painted turtle in Kikomun Creek Provincial Park (report).  as cited in "Inventory methods for pond-breeding amphibians and painted turtle". 3.1.3 Marking and identification: Ministry of Environment, British Columbia. 1998-03-18. http://www.ilmb.gov.bc.ca/risc/pubs/tebiodiv/pond/baptml20-06.htm. Retrieved 2011-02-08. 
  104. ^ Congdon, Justin D.; Nagleb, Roy D.; Kinneyc, Owen M.; van Loben Selsd, Richard C.; Quinter, Todd; Tinkle, Donald W. (2003). "Testing hypotheses of aging in long-lived painted turtles (Chrysemys picta)". Experimental Gerontology 38 (7): 765–772. doi:10.1016/S0531-5565(03)00106-2. PMID 12855285. http://www.cnah.org/pdf_files/251.pdf. 
  105. ^ Ernst, Barbour & Lovich 1994, pp. 294–295.
  106. ^ a b c d e "Painted turtle research in Algonquin provincial park". The Friends of Algonquin Park. 2005. Archived from the original on 2007-10-11. http://web.archive.org/web/20071011165743/http://sbaa.ca/projects.asp?cn=316. Retrieved 2010-09-17. 
  107. ^ a b c d e f g h Ercelawn, Aliya. "Reproduction". Herpetology Species Page. Prof. Theodora Pinou (Western Connecticut State University Biology and Environmental Sciences). http://people.wcsu.edu/pinout/herpetology/cpicta/reproduction.html. Retrieved 2011-02-06. 
  108. ^ a b c d Ernst & Lovich 2009, p. 293.
  109. ^ a b Carr 1952, p. 218.
  110. ^ Carr 1952, pp. 232–233.
  111. ^ a b c d Carr 1952, p. 228.
  112. ^ Carr 1952, pp. 227–228.
  113. ^ a b Carr 1952, p. 223.
  114. ^ a b c Chaney, Rob (2010-07-01). "Painted native: Turtles indigenous to western Montana have vivid designs, secrets". Missoulian. http://missoulian.com/lifestyles/recreation/article_2e84c830-84a3-11df-a614-001cc4c03286.html. Retrieved 2010-12-08. 
  115. ^ a b Ernst, Barbour & Lovich 1994, p. 283.
  116. ^ Gervais et al. 2009, p. 13.
  117. ^ a b Ernst, Barbour & Lovich 1994, p. 282.
  118. ^ Ernst, Barbour & Lovich 1994, pp. 282–283.
  119. ^ a b Ernst, Barbour & Lovich 1994, p. 284.
  120. ^ Ernst, Barbour & Lovich 1994, p. 281.
  121. ^ Jackson, D. C.; Rauer, E. M.; Feldman, R. A.; Reese, S. A. (2004-08). "Avenues of extrapulmonary oxygen uptake in western painted turtles (Chrysemys picta belli) at 10 °C". Comparative Biochemistry and Physiology. Part A, Molecular & Integrative Physiology 139 (2): 221–227. doi:10.1016/j.cbpb.2004.09.005. PMID 15528171. 
  122. ^ Jackson, Donald C. (2002). "Hibernating without oxygen: physiological adaptations of the painted turtle". The Journal of Physiology 543 (3): 731–737. doi:10.1113/jphysiol.2002.024729. PMC 2290531. PMID 12231634. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2290531. Retrieved 2010-12-13. 
  123. ^ a b c d e Ernst, Barbour & Lovich 1994, p. 286.
  124. ^ a b c Ernst & Lovich 2009, p. 195.
  125. ^ Ernst, Barbour & Lovich 1994, p. 289.
  126. ^ a b Ernst, Barbour & Lovich 1994, p. 287.
  127. ^ a b Ernst & Lovich 2009, p. 200.
  128. ^ a b c d e f g h i j k Ernst & Lovich 2009, p. 201.
  129. ^ a b Ernst, Barbour & Lovich 1994, p. 290.
  130. ^ Ernst & Lovich 2009, p. 259.
  131. ^ Ernst & Lovich 2009, p. 203.
  132. ^ Ernst & Lovich 2009, p. 202.
  133. ^ a b Packard et al. 2002, p. 300.
  134. ^ a b Ernst & Lovich 2009, p. 206.
  135. ^ a b Ernst, Barbour & Lovich 1994, p. 292.
  136. ^ Ernst & Lovich 2009, p. 207.
  137. ^ "Painted turtle: Chrysemys picta". Turtle Conservation Project. http://www.turtleconservationproject.org/painted-turtle-facts.html. Retrieved 2010-12-10. 
  138. ^ a b Ernst & Lovich 2009, pp. 23–32.
  139. ^ Gervais et al. 2009, p. 9.
  140. ^ "Species profile western painted turtle Pacific coast population". Species at Risk Public Registry (Government of Canada). 2010-01-11. http://www.sararegistry.gc.ca/species/speciesDetails_e.cfm?sid=902. Retrieved 2010-11-12. 
  141. ^ "Species profile western painted turtle intermountain – Rocky Mountain population". Species at Risk Public Registry (Government of Canada). 2010-01-11. http://www.sararegistry.gc.ca/species/speciesDetails_e.cfm?sid=903. Retrieved 2010-11-12. 
  142. ^ Carnahan, Todd. "Western painted turtles". Habitat Acquisition Trust. Archived from the original on 2010-11-02. http://web.archive.org/web/20101102010513/http://www.hat.bc.ca/stewardship-projects/stewardship-group1-helping-people-steward-nature/turtles.html. Retrieved 2010-12-11. 
  143. ^ "B.C. frogwatch program: Painted turtle". British Columbia Ministry of Environment. http://www.env.gov.bc.ca/okanagan/esd/atlas/species/turtle.html. Retrieved 2011-07-21. 
  144. ^ Nilsen, Emily (2010-08-09). "Protecting the painted turtle". Nelson Express. http://blog.conservancy.bc.ca/2010/08/protecting-the-painted-turtle/. Retrieved 2010-12-11. 
  145. ^ COSEWIC 2006, p. 29.
  146. ^ a b Gervais et al. 2009, p. 33.
  147. ^ Hayes, M. P.; Beilke, S. G.; Boczkiewicz, S. M.; P. B. Hendrix, P. I.; Ritson, P. I.; Rombough, C. J. (2002). The western painted turtle (Chrysemys picta bellii) at the Rivergate industrial district: management options and opportunities.  cited in Gervais, Jennifer; Rosenberg, Daniel; Barnes, Susan; Puchy, Claire; Stewart, Elaine (September 2009). "Conservation assessment for the western painted turtle in Oregon: (Chrysemys picta bellii) version 1.1" (technical report). U.S.D.A. Forest Service. Archived from the original on 2010-12-17. http://www.webcitation.org/5v20ZYJM9. 
  148. ^ Leuteritz, T. E.; Manson, C. J. (1996). "Preliminary observations on the effects of human perturbation on basking behavior in the midland painted turtle (Chrysemys picta marginata)". Bulletin of the Maryland Herpetological Society 32: 16–23.  cited in Gervais, Jennifer; Rosenberg, Daniel; Barnes, Susan; Puchy, Claire; Stewart, Elaine (September 2009). "Conservation assessment for the western painted turtle in Oregon: (Chrysemys picta bellii) version 1.1" (technical report). U.S.D.A. Forest Service. p. 36. Archived from the original on 2010-12-17. http://www.webcitation.org/5v20ZYJM9. 
  149. ^ Gervais et al. 2009, p. 36.
  150. ^ "News and Highlights: Video Gallery - Oregon Department of Fish and Wildlife". Dfw.state.or.us. 2011-01-26. http://www.dfw.state.or.us/images/video_gallery/oregon_native_turtles.asp. Retrieved 2011-02-06. 
  151. ^ "Oregon's Native Turtles". YouTube. http://www.youtube.com/watch?feature=player_embedded&v=UeTVghxdZwI. Retrieved 2011-02-06. 
  152. ^ a b c Gervais et al. 2009, p. 34.
  153. ^ Gervais et al. 2009, p. 47.
  154. ^ Holmes, Dianne. "Report on turtle crossing signs proposal". Region of Ottawa-Carleton. http://www.ottawa.ca/calendar/ottawa/archives/rmoc/Regional_Council/11Oct00/item2_70.pdf. "...inexpensive and morally exemplary..."" 
  155. ^ Kenagy, Meg (2010-02). "On the ground: The Oregon conservation strategy at work". Oregon Department of Fish and Wildlife (ODFW). http://www.dfw.state.or.us/conservationstrategy/news/2010/2010_february.asp. Retrieved 2011-01-07. 
  156. ^ a b Gervais et al. 2009, p. 35.
  157. ^ a b Gervais et al. 2009, p. 6.
  158. ^ a b c d Gamble, Tony; Simon, Andrew M. (2004). "Comparison of harvested and nonharvested painted turtle populations". Wildlife Society Bulletin 32 (4): 1269–1277. doi:10.2193/0091-7648(2004)032[1269:COHANP]2.0.CO;2. ISSN 0091-7648. http://www.tc.umn.edu/~gambl007/publications/Gamble_Simons_2004.pdf. 
  159. ^ a b "Turtles as pets". Indiana Department of Natural Resources. http://www.in.gov/dnr/fishwild/3327.htm. Retrieved 2010-12-11. "It is illegal in the State of Indiana to sell native species of turtles" 
  160. ^ Gervais et al. 2009, pp. 36–37.
  161. ^ Gervais et al. 2009, p. 37.
  162. ^ a b c "Arizona reptile and amphibian regulations". Arizona Game and Fish Department. http://www.azgfd.gov/pdfs/h_f/herp_regs.pdf. Retrieved 2011-07-20. 
  163. ^ a b c "Nongame fish, reptile, amphibian and aquatic invertebrate regulations". Virginia Department of Game and Inland Fisheries. http://www.dgif.virginia.gov/fishing/regulations/nongame.asp. Retrieved 2010-12-08. 
  164. ^ Gervais et al. 2009, p. 40.
  165. ^ Gervais et al. 2009, p. 38.
  166. ^ Ernst & Lovich 2009, p. 26.
  167. ^ "Oregon native turtles". Oregon Department of Fish and Wildlife. http://www.dfw.state.or.us/conservationstrategy/docs/TurtleIDCardFRONT.pdf. Retrieved 2011-07-20. 
  168. ^ "Title 21 CFR 1240.62". U. S. Food and Drug Administration. http://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/cfrsearch.cfm?fr=1240.62. Retrieved 2010-12-12. 
  169. ^ Reinberg, Steven (2010-03-23). "Pet turtles pose salmonella danger to kids: They're banned from sale by law but still appear at flea markets, pet shops, experts say". ABC News. http://abcnews.go.com/Health/Healthday/story?id=4507824&page=1. Retrieved 2010-12-12. 
  170. ^ Senneke, Darrel (2003). "Chrysemys picta – (Painted turtle) care". World Cheledonian Trust. http://www.chelonia.org/articles/pdfs/chrysemys.pdf. 
  171. ^ Bartlett, R. D.; Bartlett, Patricia (2003). Aquatic turtles: Sliders, cooters, painted, and map turtles. Hong Kong: Barron's Educational Series. pp. 1–48. ISBN 978-0-7641-2278-1. http://books.google.com/books?id=NV3Dzc2HIA4C&pg=PP1. Retrieved 2011-01-05. 
  172. ^ "Choosing a turtle". Myturtlecam.com. http://www.myturtlecam.com/choose.php. Retrieved 2011-01-25. 
  173. ^ Carr 1952, pp. 218–219.
  174. ^ Carr 1952, p. 233.
  175. ^ Carr 1952, p. 224.
  176. ^ a b c d Gamble, Tony; Simons, Andrew M. (2003-05-30). "The commercial harvest of painted turtles in Minnesota: final report to the Minnesota department of natural resources, natural heritage and nongame research program" (technical report). Minnesota Department of Natural Resources. http://files.dnr.state.mn.us/eco/nongame/projects/consgrant_reports/2003/2003_gamble.pdf. 
  177. ^ Pike, Sue (2010-07-2010). "Painted turtles often used for classroom dissection". Seacoast Media (Dow Jones wire service). http://www.seacoastonline.com/articles/20100721-LIFE-7210312. Retrieved 2010-12-07. 
  178. ^ Freeman, Eric (2010-06-08). "Rupp, grandson trap turtles to compete in local races". Columbus Telegram. http://columbustelegram.com/news/local/article_11f50372-730c-11df-9a36-001cc4c03286.html. Retrieved 2010-12-18. 
  179. ^ "Fast times in Nisswa: Swift turtles mix with power shoppers in a Minnesota lake-country oasis". Midwest Weekends. http://www.midwestweekends.com/plan_a_trip/family_friends/travel_with_kids/nisswa_turtle_races.html. Retrieved 2010-12-18. 
  180. ^ a b Keen, Judith (2009-07-20). "States rethink turtle trapping". USA Today. http://www.usatoday.com/news/nation/environment/2009-07-19-turtle-hunt_N.htm. Retrieved 2010-12-21. 
  181. ^ Thorbjarnarson, J.; Lageux, C. L.; Bolze, D.; Klemens, M. W.; Meylan, A. B. (2000). "Human use of turtles". In Klemens, M. W. Turtle conservation. Washington and London: Smithsonian Institution Press. pp. 33–84.  cited in Gamble, Tony; Simon, Andrew M. (2004). "Comparison of harvested and nonharvested painted turtle populations". Wildlife Society Bulletin 32 (4): 1269–1277. doi:10.2193/0091-7648(2004)032[1269:COHANP]2.0.CO;2. ISSN 0091-7648. http://www.tc.umn.edu/~gambl007/publications/Gamble_Simons_2004.pdf. 
  182. ^ a b c Arnie, Jennifer. "The turtle trap". Imprint Magazine (The University of Minnesota Bell Museum of Natural History). Archived from the original on 2010-11-19. http://web.archive.org/web/20101119125046/http://bellmuseum.org/imprint/turtle02.html. Retrieved 2010-12-21. 
  183. ^ a b "Minnesota commercial turtle harvest: 2005" (report). Minnesota Department of Natural Resources. http://files.dnr.state.mn.us/eco/nongame/projects/2005_commercialturtleharvest.pdf. Retrieved 2011-07-20. 
  184. ^ "Southern and midwestern turtle species affected by commercial harvest". Center for Biological Diversity. http://www.biologicaldiversity.org/campaigns/southern_and_midwestern_freshwater_turtles/pdfs/Southern-and-midwestern-turtle-species-affected-by-harvest.pdf. Retrieved 2011-07-20. 
  185. ^ a b "MDC discover nature turtles". Missouri Department of Conservation. http://mdc.mo.gov/discover-nature/outdoor-recreation/nature-viewing/amphibians-and-reptiles/turtles. Retrieved 2010-12-21. "Missouri has 17 kinds of turtles; all but three are protected ... common snapping turtles and two softshells ..." 
  186. ^ "Resident license information and applications packets". Alabama Department of Conservation and Natural Resources. http://www.outdooralabama.com/licenses/WFFLicenseApps/ResLic/. Retrieved 2010-12-08. 
  187. ^ a b "Regulations on the take of reptiles and amphibians". Michigan Department of Natural Resources. http://www.michigan.gov/documents/RegsOnTheTakeOfReptilesAndAmphibians_164917_7.pdf. Retrieved 2011-07-20. 
  188. ^ a b "Summary of Pennsylvania fishing laws and regulations – reptiles and amphibians – seasons and limits". Pennsylvania Fish and Boat Commission. http://www.fish.state.pa.us/fishpub/summary/repamp.html. Retrieved 2010-12-08. 
  189. ^ a b "Rules and regulations for reptiles and amphibians in New Hampshire". New Hampshire Fish and Game Department. http://www.wildnh.com/Wildlife/Nongame/RAARP/herp_rules.htm. Retrieved 2010-12-08. 
  190. ^ "Holding, propagating, protected wildlife". Oregon Department of Fish and Wildlife. http://www.dfw.state.or.us/OARs/44.pdf. Retrieved 2011-07-20. 
  191. ^ "Hunting regulations 2010–2011". Ontario Ministry of Natural Resources. http://www.mnr.gov.on.ca/stdprodconsume/groups/lr/@mnr/@fw/documents/document/239841.pdf. Retrieved 2011-07-20. 
  192. ^ a b c Gamble, Tony (2006). "The relative efficiency of basking and hoop traps for painted turtles (Chrysemys picta)". Herpetological Review 37 (3): 308–312. http://www.tc.umn.edu/~gambl007/publications/Gamble_2006.pdf. 
  193. ^ Browne, C. L.; Hecnar, S. J. (2005). "Capture success of northern map turtles (Graptemys geographica) and other turtle species in basking vs. baited traps". Herpetological Review 36: 145–147.  cited in Gamble, Tony (2006). "The relative efficiency of basking and hoop traps for painted turtles (Chrysemys picta)". Herpetological Review 37 (3): 308–312. http://www.tc.umn.edu/~gambl007/publications/Gamble_2006.pdf. 
  194. ^ McKenna, K. C. (2001). "Chrysemys picta (painted turtle). Trapping". Herpetological Review 32: 184.  cited in Gamble, Tony (2006). "The relative efficiency of basking and hoop traps for painted turtles (Chrysemys picta)". Herpetological Review 37 (3): 308–312. http://www.tc.umn.edu/~gambl007/publications/Gamble_2006.pdf. 
  195. ^ a b "Joint resolution relating to the designation of the painted turtle as the state reptile". http://www.leg.state.vt.us/DOCS/1994/ACTS/ACTR179.HTM. Retrieved 2010-12-15. 
  196. ^ Macfarlan, Allan; Macfarlan, Paulette (1985-03-01). Handbook of American Indian games. Dover Publications. p. 62. ISBN 978-0-486-24837-0. 
  197. ^ "Potawatomi oral tradition". Milwaukee Public Museum. http://www.mpm.edu/wirp/ICW-137.html. Retrieved 2010-12-17.  Adapted from Skinner, Alanson (1927). "Mythology and Folklore". The Mascoutens or Prairie Potawatomi Indians, Volume 6. 3. Indiana University: Board of Trustees. 
  198. ^ Illinois State Museum. The painted turtle. Retrieved 2010-12-10. "As told by an unidentified Peoria informant to Truman Michelson, 1916; after Knoepfle 1993."
  199. ^ "Michigan's state symbols". Michigan History magazine 100. 2002-05. http://www.michigan.gov/documents/mhc_mhm_statesymbols2002_47909_7.pdf. 
  200. ^ "State symbols". Illinois.gov. http://www2.illinois.gov/about/Pages/StateSymbols.aspx. Retrieved 2010-12-15. 
  201. ^ "Colorado state archives symbols & emblems". colorado.gov. State of Colorado. http://www.colorado.gov/dpa/doit/archives/history/symbemb.htm#Reptile. Retrieved 2011-01-23. 
  202. ^ "The voting is over: Students nominate common snapping turtle as official state reptile". Assemblyman Joel M. Miller. 2006-04-26. http://assembly.state.ny.us/mem/Joel-M-Miller/story/18722/. Retrieved 2011-02-25. 
  203. ^ Raynor, Paul (2005-12-17). "Celebration coins minted and ready". Boissevain Recorder. http://www.boissevainrecorder.mb.ca/placed%20news/17dec05.htm. Retrieved 2011-01-28. [dead link]
  204. ^ Kevin McGran (2010-02-21). "Jon Montgomery is the life of Whistler's party". Toronto Star. http://olympics.thestar.com/2010/article/769062--jon-montgomery-is-the-life-of-whistler-s-party. Retrieved 2010-02-22. 
  205. ^ Walker-Larson, Jennifer (2010-02-26). "Painted Turtle in Games spotlight, at a speed of 145 km/h". This Week at BC Hydro. BC Hydro. http://www.bchydro.com/news/press_centre/media_updates/painted_turtle.html. Retrieved 2011-02-04. 
  206. ^ editor (2010-02-26). "BC Hydro plans painted turtle study this summer". The Revelstoke Current. http://www.revelstokecurrent.com/2010/02/26/bc-hydro-plans-painted-turtle-study-this-summer/. Retrieved 2011-02-04. 
  207. ^ "Painted turtle publishing imprint website". Wayne State University Press. http://wsupress.wayne.edu/series/paintedturtle. Retrieved 2010-12-07. 
  208. ^ "Painted turtle winery". http://www.paintedturtlewine.com/. Retrieved 2010-12-07. 
  209. ^ "Painted turtle web hosting". Painted Turtle Web Hosting. http://www.paintedturtlehosting.info/. Retrieved 2011-01-02. 
  210. ^ "Painted turtle web design". Painted Turtle Web Design. http://www.paintedturtlewebdesign.com/. Retrieved 2011-01-02. 
  211. ^ "Painted turtle guesthouse website". http://www.paintedturtle.ca/home.php. Retrieved 2010-12-06. 
  212. ^ Staff reports (2010-03-12). "Eat & run". The Portland Press Herald. http://www.pressherald.com/archive/eat-and-run_2009-01-07.html. Retrieved 2010-12-07. 
  213. ^ Collier, Kevin Scott (2010). The Esther Chronicles. 
  214. ^ Collier, Kent Scott (2005-04-15). Esther's Channel. Baker Tritten. ISBN 978-0-9752880-6-1. 
  215. ^ Hughes, Marghanita (2010). Nika and the painted turtle. 
  216. ^ Gillis, Jennifer Blizen (2004-10-30). Turtles: Pets at my House. Heinemann Library. ISBN 978-1-4034-5056-2. 
  217. ^ Hipp, Andrew (2005-01-01). The Life Cycle of a Painted Turtle. Rosen Classroom. ISBN 978-1-4042-5208-0. 
  218. ^ Falwell, Cathryn (2008-02-26). Turtle Splash!: Countdown at the Pond. Greenwillow Books. ISBN 978-0-06-142927-9. 
  219. ^ Chrustowski, Rick (2006). Turtle Crossing. Henry Hold & Co. ISBN 978-0-8050-7498-7. http://books.google.com/books?id=fdqZMkc_nWIC&pg=PP1. "So the next time you see a TURTLE CROSSING sign, keep your eyes open—if you're lucky, you just might see a painted turtle on her way to make a nest." 
  220. ^ "Painted turtle state reptile O (legal title)". BMI Reptoire. http://repertoire.bmi.com/title.asp?blnWriter=True&blnPublisher=True&blnArtist=True&page=1&keyid=9500029&ShowNbr=0&ShowSeqNbr=0&querytype=WorkID. Retrieved 2011-02-08. 
  221. ^ ScribbleMonster & his pals (Kevin Kammeraad) (2007-01-01). A curious glimpse of Michigan the music (CD). Cooperfly Records/Industrial Puppytronics. Event occurs at track 30. ASIN B0012OSGEU. 
Bibliography
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Patterns of morphological variation (Ultsch et al. 2001) cast doubt on the validity of current subspecific designations. Patterns of mtDNA variation suggest that recognizing Chrysemys picta dorsalis (southern painted turtle) as an evolutionary species (C. dorsalis) distinct from C. picta may be justified (Starkey et al. 2003); data for other subspecies did not support status as distinct species. Starkey et al. (2003) proposed that the two species be recognized as monotypic (no subspecies), but conceded that the merits of recognizing subspecies are debatable. Starkey et al. (2003) stated that their conclusions on species boundaries must be regarded as tentative because they lacked evidence from nuclear genes. Studies currently underway by these authors should shed additional light on the phylogeography and taxonomy of the C. picta complex.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Chrysemys dorsalis formerly was regarded as a subspecies of Chrysemys picta. Based on molecular data, Starkey et al. (2003) recognized C. dorsalis as a distinct species. Some herpetologists, citing apparent intergrades in western Kentucky, southern Illinois, and southeastern Missouri, still regard it as conspecific with C. picta.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!