Overview

Distribution

Range Description

This species ranges from northeastern Spain; western, southern, eastern and northeastern France; and southern Switzerland, through most of Italy, to southwestern Slovenia and northern Croatia. It is present on the Mediterranean islands of Corsica (France), Sardinia, Sicily and most other Italian islands, Krk (Croatia), and Malta. The species may occur in Luxembourg, but this requires verification. The species is absent from Austria. It has also been translocated to the island of Gyaros (Greece) in the Aegean Sea where it was previously recognized as a distinct species Hierophis gyarosensis. It ranges from sea level up to 2,000m asl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Europe
Distribution: NE Spain,  France (+ Corsica), S Switzerland,  NW Yugoslavia: coastal Croatia (including some Adriatic islands), Slovenia, Italy (+ Sardinia, Elba), Malta  carbonarius: “Yugoslavia” (near Rovinj etc.)  gyarosensis: Greece;
Type locality: Gyaros Island  kratzeri: Montecristo Island  
Type locality: S France
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in dry, open, well vegetated habitats. It occurs in scrubland, macchia, open woodland (deciduous and mixed), heathland, cultivated areas, dry river beds, rural gardens, road verges, stone walls and ruins. The species lays four to 15 eggs.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hierophis viridiflavus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTGGTACTGGGTGAACCGTCTATCCCCCACTATCAGGAAACCTAGTCCACTCAGGCCCATCTGTTGACCTAGCAATCTTCTCCCTGCACCTGGCGGGTGCTTCATCCATCCTCGGAGCAATTAACTTTATTACTACATGTATTAACATGAAACCCAAATCTATACCAATATTCAATATCCCACTATTCGTCTGATCCGTACTAATCACCGCAATCATATTACTCTTAGCCCTACCCGTGCTAGCAGCAGCGATTACTATGCTGCTGACCGACCGAAACCTTAACACCTCTTTCTTCGACCCCTGCGGGGGCGGAGACCCAGTCTTATTCCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTGTATATTTTAATTTTACCCGGGTTTGGTATTATCTCAAGCATCATCACATTCTACACCGGAAAGAAAAACACATTCGGCTATACAAGCATAATCTGAGCAATAATGTCCATTGCCATTCTGGGGTTTGTTGTATGAGCCCACCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hierophis viridiflavus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Milan Vogrin, Claudia Corti, Valentin Pérez Mellado, Paulo Sá-Sousa, Marc Cheylan, Juan M. Pleguezuelos, Andreas Meyer, Benedikt Schmidt, Roberto Sindaco, Antonio Romano, Iñigo Martínez-Solano

Reviewer/s
Cox, N. and Temple, H.J. (Global Reptile Assessment)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 2006
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It can be a very common species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
It is locally threatened by high accidental mortality on roads, especially close to urban or tourist areas, but this is not considered to be a major threat to the species overall. It is also persecuted throughout its range because people mistakenly believe it to be venomous. It is not known to be collected in significant numbers. It is threatened by habitat loss through conversion of land to intensive agricultural use in Switzerland (Andreas Meyer pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on Annex II of the Bern Convention, and on Annex IV of the EU Habitats Directive. It is present in a number of protected areas throughout its range. This species is categorized as Endangered in Switzerland (Monney and Meyer, 2005) and is protected by national legislation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green whip snake

The Green Whip Snake or Western Whip Snake (Hierophis viridiflavus) is a species of snake in the Colubridae family. There is a larger, often pure black variant found in Southern Italy and referred to there as 'Il Biacco'.

Geographic range[edit]

It is found in Andorra, Croatia, France, Greece, Italy, Malta, Slovenia, Spain, Switzerland, and possibly Luxembourg.

Habitat[edit]

Its natural habitats are temperate forests, temperate shrubland, Mediterranean-type shrubby vegetation, arable land, pastureland, plantations, rural gardens, and urban areas.

Venom and toxicity[edit]

Commonly regarded as non-venomous, it is described that a subject who endured 'sustained biting' of up to 5 minutes began showing suspect symptoms, including problems with neuromotor skills.[1] It is described that a gland called the Duvernoy's gland, maybe similar to the venom gland, has some responsibility.

References[edit]

  1. ^ Some seemingly harmless snakes possess a secret venomous gland par Rachel Nuwer, smithsonianmag.com. October 18, 2013.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!