Overview

Brief Summary

Biology

Like many crocodilians, the African slender-snouted crocodile is apparently a rather shy and timid reptile (6), and despite being a remarkably agile swimmer (6), it is often found resting in the shade of trees (8). It is the only crocodilian species known to climb as high as several meters into the limbs of trees fallen along streams (7). Although it is a fish-eating specialist, the slender-snouted crocodile also feeds on frogs, snakes, shrimps, crabs, and even waterbirds and mammals (6) (8) (9); its slender snout has evolved to move quickly through the water, allowing rows of razor-sharp teeth to snatch fish in open water, or prey from burrows and amongst roots and fallen trees (8). Depending on the region and its climatological patterns, mating is reported to begin in February; and from March the female constructs a nest by scraping vegetation together with her hindfeet (6). These large mounds, up to 80 centimetres high and two metres wide, are situated in a shady spot a few metres from small rainforest streams (6). The female lays between 12 and 30 large, hard-shelled eggs in two layers in the mound, where a temperature of 27.4 to 34 degrees Celsius is maintained (6). At the beginning of the rainy season, after 90 to 100 days of incubation, young crocodiles start to emerge from the elliptical eggs (6). Their characteristic chirping instigates the mother to break open the nest and assist with the hatching process, causing the hatchlings to scatter over the flooded rainforest floor (10). Slender-snouted crocodiles display some degree of parental care of hatchlings, with females aggressively defending their young when they emit distress calls. It is unknown for how many months this maternal care is given (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The African slender-snouted crocodile is among the least known of the world's crocodilians (5). Its defining feature is its extremely slender snout, devoid of any bony ridges (6). The leathery skin of the adult is brownish-yellow with large black spots, and the olive coloured head is spotted with brown. Young crocodiles are greenish-grey to greenish-yellow in colour with black blotches and markings (6). Six or so rows of tough scales run down the crocodile's back, leading to the species name cataphractus, meaning 'clad in armour' in Greek (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Slender-snouted crocodiles are native to central Africa, from as far west as Senegal, to Tanzania in the east, as far north as Chad, Mali, and Mauritania, and as far south as Zambia and Angola. The Saint Paul, Mafa, and Saint John Rivers are all Liberian rivers in which this species occurs. Slender-snouted crocodiles have also been reported in areas of Cameroon and Gabon.

Biogeographic Regions: ethiopian (Native )

  • Abercrombie, C. 1976. Notes on west African crocodilians (Reptilia, Crocodilia). Journal of Herpetology, 12: 260-262.
  • Groombridge, B. 1982. The IUCN Amphibia-Reptilia Red Data Book. Woking, Surrey, U.K.: Unwin Brothers Limited.
  • Kofron, C. 1992. Status and habitats of the three African crocodiles in Liberia. Journal of Tropical Ecology, 8/3: 265-273.
  • Pauwels, O., V. Mamonekene, P. Dumont, W. Branch, M. Burger, S. Lavoué. 2003. Diet records for Crocodylus cataphractus (Reptilia: Crocodylidae) at Lake Divangui Ogooué-Maritime province, southwestern Gabon. Hamadryad, 27/2: 200-204.
  • Radley, G., J. Sherlock. 2001. Waterways. Minneapolis, MN: Lerner Publishing Group.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

As the species is currently recognized it is distributed throughout western tropical Africa from Lake Tanganyika and Lake Mweru in the east/southeast to the Gambia River in the west (Shirley 2010). It occurs from sea level up to 600 m.


Taxonomic revisions in progress will recognize two divergent taxa within this species, one occurring from Lakes Tanganyika and Mweru to the coast of Gabon and up into southern/eastern Cameroon while the second occurs from Nigeria to the Gambia River. This species is distributed in the following countries:

West Africa - Côte d'Ivoire, Gambia, Ghana, Guinea, Liberia, Nigeria, Senegal, Sierra Leone. It is likely extirpated from Benin, Burkina Faso, Guinea-Bissau, Mali, and Togo if it ever occurred there.
Central Africa - Cameroon, Central African Republic, The Democratic Republic of the Congo, Gabon, Republic of Congo, Tanzania. It is likely extirpated from Angola, Chad, Equatorial Guinea, and Zambia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Africa
Distribution: Angola, Benin, Burkina Faso, Cameroon, Central African Republic,  Chad, Congo, Equatorial Guinea, Gabon, Gambia, Ghana,  Guinea, Guinea Bissau, Ivory Coast, Liberia, Mali, Mauritania,  Nigeria, Senegal, Sierra Leone, Tanzania, Togo, Zaire, Zambia  
Type locality: Unknown; restricted to "Senegal," by Fuchs, Mertens, and Wermuth 1974
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in the equatorial rainforest belt of Central and West Africa; from southern Mauritania, east to the Central African Republic and south to Angola and Tanzania (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Slender-snouted crocodiles are small to medium-sized crocodilians, with a maximum recorded length of approximately 4 meters. Sexual dimorphism is present (as in all crocodilian species), with males being larger than females of the same age class. As the common name suggests, this species has a long, slender snout. Protective scales cover the skin, some of which are reinforced by bony plates to provide extra support. The head is equipped with nostrils that sit high on the tip of the snout and eyes that are arranged facing forward at the top of the head.

Slender-snouted crocodiles can be distinguished from other crocodile species by their extremely slender snout, which lacks any bony ridges, as well as their dark, olive-colored back and bright yellow-colored ventral surface, which also shows several dark patches.

Range length: 3 to 4 m.

Sexual Dimorphism: male larger

Other Physical Features: ectothermic ; bilateral symmetry

  • Grigg, G., C. Gans. 1993. Morphology and physiology of the Crocodylia. Pp. 326-336 in C Glasby, G Ross, P Beesley, eds. Fauna of Australia, Vol. 2A, Amphibia and Reptilia. Canberra, Australia: Australian Government Publishing Service.
  • Kelly, L. 2006. Crocodile: Evolution's Greatest Survivor. Crows Nest, N.S.W: Allen & Unwin.
  • Steel, R. 1989. Crocodiles. Kent, U.K.: Christopher Helm Ltd..
  • Waitkuwait, W. 1989. Crocodiles: Their Ecology, Management, and Conservation. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Slender-snouted crocodiles are primarily found in tropical rainforests along the shores of shallow rivers and larger bodies of water, but also in lightly covered savanna woodlands. They are most frequently found in freshwater environments and occasionally in brackish waters of coastal lagoons. When these crocodiles leave the water they tend to stay in sheltered or protected areas to avoid predation. In the water they usually swim just below the surface.

Habitat Regions: tropical ; terrestrial ; freshwater

Terrestrial Biomes: rainforest

Aquatic Biomes: rivers and streams; brackish water

Wetlands: swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

The Slender-snouted Crocodile is a narrow-snouted, medium-sized species reaching a maximum length of up to 4 m (Brazaitis 1973), though individuals over 3-3.5 m are now rare.


Historically, M. cataphractus was widely distributed throughout West and Central Africa, but recent surveys suggest that its distribution has changed as a result of local extirpations. The most comprehensive ecological studies on wild M. cataphractus are that of Waitkuwait (1989) and Shirley (2013, unpub. data). This species prefers forested rivers and other densely vegetated bodies of water (e.g. reservoirs and freshwater lagoons), but has also been found in sparsely vegetated, gallery habitats within savanna woodland (Waitkuwait 1989, Shirley et al. 2009).


At the start of the annual wet season females lay an average of 16 eggs in mound nests composed of organic matter at the fringe of aquatic habitats. Nests are constructed at the base of trees at the edge of undisturbed forested wetland habitats, though some nests have also been encountered in cacao plantations in Côte d'Ivoire (Shirley 2007) suggesting a reasonable tolerance to disturbance when replacement "forest" habitat is available. The nesting season broadly overlaps that of the sympatric Dwarf Crocodile (Osteolaemus sp.), though there appears to be partitioning of nest habitat between the two species, and M. cataphractus has a more condensed nesting season (Waitkuwait 1989). Egg size is very large relative to female size and hatchlings tend to be larger than those of other crocodile species (Waitkuwait 1985, 1989; Thorbjarnarson 1996).


Like most crocodilians, young animals feed primarily on small fish and a variety of invertebrates; adult animals are primarily piscivorous although they have been observed to consume mammals (Pauwels et al. 2003, 2007), turtles and birds (M. Shirley pers. obs.). Gabonese fishermen reported it feeding on aquatic snakes (Pauwels et al. 2002). While there is nothing specific documented in the literature, M. cataphractus is known to be a very vocal species perhaps indicating a much more structured social hierarchy or breeding ethology than is presently known. An alternative hypothesis for their highly vocal behaviour has been proposed where adult M. cataphractus may live solitary lifestyles and their vocalizations are necessary for territory demarcation and finding mates. Both of these hypotheses have yet to be tested thoroughly.


Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The African slender-snouted crocodile inhabits rivers, marshes, lakes and pools within rainforests (6). While habitat data are not exhaustive, the slender-snouted crocodile is apparently confined to freshwater and typically prefers larger, swift-flowing streams (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Slender-snouted crocodiles have a predatory diet which, when young, consists mainly of fish and small crustaceans. At larger sizes they feed on mammals that drink from the rivers and lakes where the crocodiles live, such as water chevrotains (Hyemoschus aquaticus). The placement of the eyes and nostrils atop the head and snout, respectively, allows slender-snouted crocodiles (and all other crocodilians) to lie in wait at the edge of the water while almost completely submerged, striking when the prey animal dips its head to drink. Crocodilians have an extremely powerful bite force and their mouths are equipped with many sharp teeth that are designed for grabbing and hanging on to their prey. They also continuously grow new teeth to replace any that are lost through fighting or feeding.

Crocodilians do not secrete chitinases, so any chitinous or keratinous substances such as hair or mollusk shells accumulate in the gut and are most likely ejected through the mouth (which has been observed many times in captive individuals). The stomachs of slender-snouted crocodiles and other crocodilian species often contain gastroliths (rocks held in the digestive tract) of various sizes. Although the purpose of these stones has yet to be confirmed, it appears likely that they serve to grind and break down food in the digestive tract, as is the case in other groups (herbivorous birds, seals, sea lions) where they have been found.

Animal Foods: mammals; amphibians; reptiles; fish; insects; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore )

  • Platt, S., T. Rainwater, S. McMurry. 2002. Diet, gastrolith acquisition and initiation of feeding among hatchling Morelet's crocodiles in Belize. Herpetological Journal, 12: 81-84.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Slender-snouted crocodiles are predators of many aquatic species (particularly fishes), as well as some terrestrial mammals. Young individuals and eggs serve as prey to fish, birds, mammals, and larger crocodiles.

Commensal/Parasitic Species:

  • Junker, K., J. Boomker. 2006. A check-list of the pentastomid parasites of crocodilians and freshwater chelonians. Onderstepoort Journal of Veterinary Research, 73: 27-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation on crocodilians occurs mainly at the egg or hatchling stage. Various animals feed on the eggs of slender-snouted crocodiles, including otters (Hydrictis maculicollis), leopards (Panthera pardus), and various bird and rodent species. Recent hatchlings face many of the same predators, as well as potential cannibalism by larger conspecifics. The large size and heavy scales of adults likely protects them from predation by other species, with the exception of humans, who hunt slender-snouted crocodiles for their skin and meat.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Little research has been conducted on communication in slender-snouted crocodiles. However, most crocodile species show common communication methods. Hearing is very well-developed in crocodilians and is more sensitive than in other reptiles, with newly hatched young communicating with their mother through high-pitched squeaks. Crocodilians also vocalize during aggressive interactions and while attempting to attract mates.

Vision plays an integral role in crocodilian communication, with males showing their dominance to intruders using different rituals, including raising their bodies out of the water to try to appear larger to intimidate their intruders. During mating season, crocodilian species perform visual displays to attract potential mates.

When above the surface of the water, vision is an important pathway for perception of a crocodilian's environment. It's assumed that crocodilians can see in color because their eyes have both rods and cones. Their eyes also contain a tapetum lucidum, a layer of guanine-rich retinal cells that amplify incoming light and greatly improve night vision. However, when hunting underwater, a semi-transparent third eyelid closes over the eye, likely limiting vision to light/dark differentiation. Touch receptors and the ears are likely to be the primary sense organs used while crocodilians are underwater.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

All crocodilian species lay eggs, with the temperature of nesting conditions determining the sex of hatchlings. Young crocodilian hatchlings resemble mature adults, except smaller. They are fully capable of feeding and swimming from the moment that they hatch. Slender-snouted crocodiles are considered to be sexually mature when they reach 2.0 to 2.5 meters in length.

Development - Life Cycle: temperature sex determination; indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

No reliable information is available regarding the average life span of wild slender-snouted crocodiles. Captive individuals have been documented to live for at least 38 years.

Range lifespan

Status: captivity:
32 to 38 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 56.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little is known about the specific courtship and mating systems of slender-snouted crocodiles. In general, crocodilians engage in mating rituals that include sex-specific interactions. Females approach males in the water and begin the courtship ritual. During this courtship, crocodilians perform several activities involving swimming around each other and bodily contact, and the female may even briefly swim away to encourage the male to chase her, before continuing to circle. Following these ritualistic behaviors, the male places his tail under the female's body for stability in shallow waters and the pair then begins copulation. Crocodilians have been observed copulating on their sides, either with the male on top of the female, or with the female on top of the male.

Mating System: polygynous

Slender-snouted crocodiles typically reach sexual maturity at 10 to 15 years. Reproduction generally takes place at the start of the rainy season. The entire process begins in January or February and lasts until July. Oogenesis in females and spermatogenesis in males begins in January and February. Copulation generally occurs soon after. After copulation, the embryo and its surrounding eggshell begin to develop. Two to three months later (around April), egg-laying occurs.

Nests are made by the female, primarily using her hind legs to construct the nest of dead vegetation and mud. They are typically 50 to 80 cm high, 130 to 220 cm long, and 120 to 200 cm wide. Nests house incubating eggs for 90 to 100 days. Little information is available on the average number of eggs in a clutch, although one study found clutch sizes of 8, 17, and 22 eggs. On average, eggs measure approximately 8 cm long and 5 cm wide. Among species in the genus Crocodylus, slender-snouted crocodiles produce the lowest average number of eggs per clutch, but also exhibit the largest average egg size.

During incubation, mothers try to keep egg temperatures between 27.4ºC and 34ºC by keeping the eggs in the nest. The nest is kept moist by rainfall and humidity, helping to insulate the nest and keeping internal temperatures far more stable than temperatures outside the nest. Newly emerged hatchlings measure 28 to 35 cm long. The time for hatchlings to reach independence is unknown, but they have been found near the nest for as long as two weeks after hatching.

Breeding interval: Slender-snouted crocodiles reproduce once yearly in the rainy season

Breeding season: January-July

Range number of offspring: 8 to 22.

Range gestation period: 60 to 90 days.

Range age at sexual or reproductive maturity (female): 10 to 15 years.

Range age at sexual or reproductive maturity (male): 10 to 15 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

After a nest has been made and a clutch has been laid, crocodilian mothers guard their nests regularly throughout the incubation period. Soon after the offspring hatch they begin to make squeaking noises, triggering the female to uncover the nest. If some of the hatchlings show no sign of emerging, the mothers will carefully place these eggs in their mouth and crack them. The mother then scoops the hatchlings into her jaws and carries them to the water. Newborns are defended and cared for by both parents for some time after this relocation occurs.

Parental Investment: male parental care ; female parental care ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Protecting: Female); pre-independence (Protecting: Male, Female)

  • Grigg, G., C. Gans. 1993. Morphology and physiology of the Crocodylia. Pp. 326-336 in C Glasby, G Ross, P Beesley, eds. Fauna of Australia, Vol. 2A, Amphibia and Reptilia. Canberra, Australia: Australian Government Publishing Service.
  • King, F., J. Dobbs. 2007. Crocodilian propagation in American zoos and aquaria. International Zoo Yearbook, 15/1: 272-277.
  • Thorbjarnarson, J. 1996. Reproductive characteristics of the Order Crocodylia. Herpetologica, 52/1: 1/18.
  • Waitkuwait, W. 1985. Investigations of the breeding biology of the west African slender-snouted crocodile (Crocodylus cataphractus) Cuvier, 1824. Amphibia-Reptilia, 6/4: 387-399.
  • Waitkuwait, W. 1989. Crocodiles: Their Ecology, Management, and Conservation. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mecistops cataphractus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTTTTTTCCACCAACCACAAAGATATCGGCACCTTGTATTTTATCTTCGGCGCCTGAGCTGGAATAGTGGGGACAGCCCTA---AGCCTCCTAATCCGGACAGAACTTAGCCAGCCAGGTCCATTTATGGGAGAT---GACCAAATCTACAATGTCGTCGTTACAGCACACGCCTTTATCATAATCTTTTTTATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTACTACCATTAATG---ATTGGAGCACCAGACATAGCATTCCCTCGAATAAATAACATGAGCTTCTGATTACTCCCCCCTTCATTCACCTTACTCTTATTTTCCGCCTTTATTGAAACCGGTGCCGGCACCGGTTGAACAGTCTACCCACCACTAGCTGGAAACCTGGCCCACGCAGGACCATCAGTAGACCTA---ACTATCTTCTCCCTTCACCTTGCTGGAGTATCATCAATCTTAGGGGCAATTAACTTCATTACCACTGCTATTAACATAAAACCCCCATCAATATCACAACAACAAACACCACTTTTTGTGTGATCTGTATTAGTCACTGCTGTACTTCTACTGCTAGCCCTACCAGTCCTAGCTGCA---GGCATTACTATACTGCTTACTGACCGAAACTTGAACACCACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATCTTATACCAACACCTTTTCTGATTTTTCGGCCACCCAGAAGTCTACATCCTCATCCTACCAGGGTTTGGAATGATCTCCCATGTTATTACTTTCTACTCAAGTAAAAAA---GAACCATTTGGATATATGGGGATAGTATGAGCTATGATATCAATTGGATTCTTAGGTTTCATTGTCTGAGCCCACCACATATTTACAGTAGGAATAGATGTCGATACCCGCGCATACTTCACATCCGCCACAATAATTATCGCCATCCCTACAGGAGTAAAAGTATTTAGCTGATTA---GCCACC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mecistops cataphractus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Crocodylus cataphractus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCTTATACTTTATTTTCGGCGCCTGAGCTGGAATGGTAGGAACAGCCCTAAGCCTCCTAATCCGGACAGAACTCAGCCAGCCAGGTCCATTTATAGGAGATGACCAAATTTACAACGTTATCGTTACAGCACATGCCTTTATCATAATCTTTTTTATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGACTACTACCACTAATAATTGGAGCACCAGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTACTACCACCTTCATTTACCCTATTATTATTTTCCGCCTTTATTGAAACAGGTGCCGGCACCGGCTGAACAGTTTACCCACCACTAGCTGGAAACCTGGCCCACGCAGGACCATCAGTAGACCTAACTATCTTCTCCCTCCATCTTGCTGGAGTGTCCTCAATCTTAGGGGCAATTAACTTTATTACCACCGCTATTAACATAAAACCACCATCAATATCACAGCAACAAACACCACTTTTTGTGTGATCTGTGTTAGTCACTGCTGTACTCCTACTGCTCGCCCTGCCAGTCCTAGCTGCAGGTATTACTATGCTGCTTACTGACCGAAACTTGAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGATCCAATCTTATA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus cataphractus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Populations of slender-snouted crocodiles appear to be in a slow decline, mainly due to habitat loss caused by humans. However, there is not enough information on the species to know whether to place it within the endangered, vulnerable or rare category of the IUCN redlist. Some research in the early 1990’s suggested that slender-snouted crocodiles were severely depleted in West Africa, while a separate study in 2003 indicated that they are quite abundant in some parts of Gabon.

US Federal List: no special status

CITES: appendix i

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2acde+3cde+4acde

Version
3.1

Year Assessed
2014

Assessor/s
Shirley, M.H.

Reviewer/s
Webb, G.J.W. & Dacey, T.

Contributor/s
Blackburn, D. & Pauwels, O.S.G.

Justification
The Slender-snouted Crocodile was last assessed as Data Deficient on the 1996 IUCN Red List. Since that time, particularly in the last six years, sufficient information has been collected to review its status. As such, an updated assessment was the highest priority recommendation for this species in the 2010 IUCN SSC Crocodile Specialist Group Action Plan update (Shirley 2010).

The two regions (West and Central Africa) are completely isolated from each other underpinning the impending species split in this taxon. Central African habitats and populations do not seem to be fragmented despite some evidence for genetic isolation between major basins (Shirley 2013). In contrast, West African populations are highly fragmented due to a combination of severely fragmented forest habitats and the geology of the region and species-specific habitat use. For example, most major forested waterways throughout West Africa, especially in the Upper Guinea forest region, run north to south and show virtually no longitudinal communication except through the ocean which does not seem to be frequented by the Slender-snouted Crocodile.

The Slender-snouted Crocodile, particularly throughout West Africa, is incredibly shy and susceptible to human disturbance. As human populations throughout its distribution grow and occupy what were previously gallery forests and other forested wetland habitats this species is pushed out or hunted to local extinctions. In West Africa the extent of occurrence in the north of this species range has already declined drastically due to aridification and human settlement, it is projected that this species will likely be lost from the non-true forested areas (i.e., the wooded, gallery savanna areas in the north) of its West African range in the next 10–20 years if it currently still exists in these northern extremes. Additionally, surveys prior to 2005 already suggested that the Slender-snouted Crocodile may no longer occur in the Lake Mweru basin or throughout Lake Tanganyika. While very little historic survey data exists, that which does and can be compared to contemporary surveys (e.g., the Ogooué River and N’dougou Lagoon in Gabon – Behra 1987 and M. Shirley unpub. data, Côte d'Ivoire - Waitkuwait 1989, Shirley et al. 2009) show that populations are declining.

Long-running bushmeat studies in Gabon, Congo, and Democratic Republic of the Congo continually find adult Slender-snouted Crocodiles for sale in markets. In contrast, this species has not been detected in the bushmeat trade in West Africa for some time indicating it is not reliably available as a target species. Based on the current, estimated subpopulation declines and local extinctions throughout the Sahel, Lake Mweru, and Lake Tanganyika we anticipate these subpopulations to become extinct within one generation into the future. Additionally, while the Sene-Gambia subpopulation is currently well protected, any loss of will to continually protect the chimpanzee colonies will result in near instantaneous extinction of this subpopulation. Continuing decline in locationsThis species is significantly reduced in at least the Sahel zone and Lake Tanganyika and Mweru locations with anticipated complete extirpation in the near future. There is also continuing decline in the extent and quality of the habitat based on deforestation and forest degradation throughout this species range, especially in West Africa (Megevand 2013), which has resulted in sedimentation effecting prey species populations, as well as human settlement/encroachment and reduction in breeding habitat.

Based on known, extensive trade in crocodile skins and other products, as well as habitat alteration and human encroachment, since 1938 (three generations is 75 years), the Slender-snouted Crocodile meets the criteria for listing as Critically Endangered as it is inferred to have undergone a past population reduction of between 50-80% based on direct observation, loss of range and suitable habitat, direct exploitation and the impacts of introduced species (criterion A2acde). The reduction is closer to 50–60% for Central Africa and 70–90% for West Africa. There is no reason to expect the decline to slow, hence future reduction over the next 75 years is projected to be between 60–90% based on ongoing loss of range and habitat, exploitation and competition with other introduced crocodilian species (criterion A3cde). The future reduction is hard to quantify mostly due to extremely different threats and levels of active protection between West and Central Africa. On a global basis, however, this species is expected to lose 100% of mature individuals outside of protected areas and 60–90% inside of protected areas where fishing, hunting, and forest clearing remain issues. In West Africa subpopulations have already been reduced to the point where even small perturbations will result in localized extinctions and the state of protected area management (where most individuals are confined today) suggests that these reductions will continue into the future. For example, this species continues to exist in The Gambia solely due to the level of protection afforded the artificial chimpanzee colonies on the islands on which it breeds in the interior of the River Gambia National Park - it does not occur up or downstream of these core islands (M. Shirley unpub. data). Additionally, with increasing habitat conversion the West African Crocodile (Crocodylus suchus) will be able to occupy previously exclusive M. cataphractus habitat and out compete the latter species. Without intervention, in Central Africa the only remaining subpopulations at the end of three generations will be restricted to well-managed protected areas and remote areas of Gabon. In West Africa this species is anticipated to go completely extinct without significant revisions in protected area policy and management, as well as assisted efforts such as reintroductions.

Looking at a combination of the information on past and future reductions (i.e. subcriterion A4acde) it is estimated that population reduction would be between 50–80%, once again resulting in a Critically Endangered listing. This inference (for the past) and projection (for the future) is based on the period 1960-2035 and incorporates the extensive, post WWII skin trading that was happening throughout West and Central Africa and did not slow down until the mid-1980s. The majority of this trade was in Nile Crocodile products, but in certain parts of this range (i.e., Gabon, Côte d'Ivoire, Liberia, and the Congos) the Slender-snouted Crocodile was actually the primary traded species or heavily incidentally impacted. It is suspected that the slowdown of this trade in the 1980s was largely due to the significant reduction in crocodile populations (i.e., reduced efficiency and hunting output) and only partially due to international (e.g., CITES) and national legislative policies. From 2013 to 2035 it is estimated that continued habitat loss, habitat conversion for agriculture (e.g., palm oil and rubber developments throughout Gabon, the Democratic Republic of the Congo, Cote d'Ivoire, Liberia and Sierra Leone), and increasing human pressures on natural resources (notably freshwater fisheries) will greatly increase this species extinction risk.

History
  • 1996
    Data Deficient
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Data Deficient (DD) by the IUCN Red List (3), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

Surveys prior to 1998 painted a grim picture for C. cataphractus, particularly in West Africa and the extreme south and east of its distribution (e.g., Angola, Zambia, Tanzania). The species was recorded as severely depleted in Liberia (Kofron 1992) and Nigeria (Dore 1991, 1996; Akani et al. 1998a, b) and likely extinct in Gambia, Senegal, Guinea-Bissau (Jones 1991), Togo (Behra 1993), Chad and Angola (Ross 1998). It is possibly extinct in Equatorial Guinea where there is no clear evidence of the species’ presence since the 1980s (Lasso et al. 2002). Simbotwe (1993) suggested that Zambia was probably the southern range limit for this species and that changing habitat conditions in the Luapula River, Lake Mweru and Lake Tanganyika may mean C. cataphractus is now extinct in Zambia. However, other researchers suggested that C. cataphractus may have been common in Lake Mweru (Taylor 1998) and, while sparse, could still be found in the Luapula Basin (Thomas 1998) as late as 1991. There are still occasional reports of sightings from Tanzania (see below). Disruption of habitat through removal of riverside vegetation and direct harvest for meat and skins were the major threats in this eastern limit of its range. In contrast, populations in Côte d’Ivoire (Waitkuwait 1989), Gabon, Republic of Congo and Central African Republic (Behra 1987, 1994) were thought to be somewhat depleted but not imminently threatened.


Since 1998, much additional survey data has become available for C. cataphractus, though with the exception of a few key countries much of what is available is composed of incidental observations from general biodiversity reports focused on other taxa. For example, the Malagarasi-Muyovozi Wetland Complex in Tanzania was designated as a Ramsar Wetland in 2000 partially on the basis that C. cataphractus was still present. Survey data from Nigeria (Luiselli et al. 2000), Benin (Kpera 2003), Liberia (G. Miller, unpublished data), Ghana and Côte d'Ivoire (Shirley et al. 2009), and Gambia and Senegal (M. Shirley unpub. data) suggest that C. cataphractus is all but extinct in West Africa (i.e., west of the Cross River, Nigeria) with fewer than 50 individuals and five adults detected in all these surveys. However, recent reports from Central Africa have found a number of localized, robust populations in the Ogooue River and coastal basins in Gabon and the Lac Tele region of Republic of Congo (Thorbjarnarson and Eaton 2004, Eaton and Barr 2005, Pauwels 2006, Shirley unpub. data). Surveys in the Democratic Republic of the Congo in 2011 found small populations in the Ituri River and upper Lomami River regions and it is suspected that the vast area of uninhabited wilderness within the arc of the Congo River may support significant populations of this species (Shirley 2010; M. Shirley unpub. data).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Population decline in the past has been attributed to the commercial skin hunting associated with the decline of C. niloticus populations throughout their sympatric ranges, though available evidence suggests that M. cataphractus was not directly targeted until the economic extinction of the Nile Crocodile, as well as subsistence hunting and habitat destruction (Abercrombie 1978, Pooley 1982). Currently, hunting for skins in Central and West Africa has abated, largely as the result of declines in crocodile populations and the availability of skins, but to a lesser extent from restrictions on international trade established by CITES (Thorbjarnarson 1999). Modern anthropogenic pressures impeding the recovery of M. cataphractus populations include small-scale, subsistence fisheries (resulting in a reduced prey base and incidental mortality in fishing nets) and habitat modification (where large tracts of forest are cleared for cacao and rubber plantations or settlements), as well as on-going limited hunting for the bushmeat markets.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The sparse information on the African slender-snouted crocodile makes it difficult to determine its conservation status, and thus the World Conservation Union (IUCN) has declared it Data Deficient (3). However, the little survey data that is available suggests that many populations may be depleted, and possibly even extirpated in The Gambia, Senegal and Guinea-Bissau (2). These declines are likely to be the result of hunting, for its hide and for food (2), and the disruption of vital riverside vegetation (2). Slender-snouted crocodiles are extremely vulnerable to being caught and drowned in fishing nets when attempting to eat fish struggling in the nets. Very few significant populations of this species exist in Central or West Africa, and additional data and protection is urgently required (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
To date the only known conservation actions for this species are not targeted specifically at it but rather at communities and landscapes (e.g. national parks and national legislation). A recently renewed initiative in Côte d'Ivoire is looking at captive breeding and reintroduction. The species is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The African slender-snouted crocodile is legally protected in many of its range countries, although this is poorly enforced. The sparse information available indicates that populations of this rare 'armour-clad' crocodile are declining, so better enforcement of laws, changes in legal status, and firmer hunting regulations are clearly needed. However, the lack of definitive information on this species' ecology, population dynamics and status makes such actions hard to develop, and the inaccessibility and political instability throughout much of its range hinders most efforts for further research or action (2) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

As with all crocodilian species, adult slender-snouted crocodiles are capable of severely injuring or killing humans.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Slender-snouted crocodiles provide two major economic benefits. Their skin is very valuable due to its durability and coloring and is often used to make various clothing items and accessories. The meat of slender-snouted crocodiles also provides a means of sustenance in many areas.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Slender-snouted crocodile

The African slender-snouted crocodile (Mecistops cataphractus) is a species of crocodile. Recent studies in DNA and morphology suggest that it may belong in its own genus, Mecistops.[1][2][3][4]

Description[edit]

African slender-snouted crocodiles are native to freshwater habitats in central and western Africa. They are medium sized crocodiles, typically slightly smaller than the Nile crocodile, but are larger than several other species of crocodilians. The adult length is from 3 to 4 m (9.8 to 13.1 ft) and adult weight is from 125–230 kg (276–507 lb). The occasional large specimen can weigh up to 325 kg (717 lb).[5][6] They have a slender snout used for catching prey, hence their name.

Behaviour[edit]

Slender snouted crocodiles bear a strong resemblance to gharial which also have a very slender snout

The diet of the slender-snouted crocodile consists mainly of fish, snakes, amphibians and crustaceans. This species is not typically found in groups, except during the onset of the breeding season. The female constructs a mound nest consisting mainly of plant matter. Nests are sited on the banks of rivers, and construction generally begins at the onset of the wet season, although breeding is asynchronous even within members of one population. It has a similar, but generally shorter nesting season than that of the sympatric dwarf crocodile, which may nest further from the riverine habitat frequented by C. cataphractus.

The slender-snouted crocodile lays an average of 16 (minimum 13, maximum 27) very large eggs (relative to body size) about a week after completion of the mound nest. The incubation period is long compared with most other crocodilian species, sometimes lasting over 110 days. The female remains close to the nest, but does not defend it with the same vigor as some other species of crocodilians. Once the eggs begin to hatch, and the juveniles emit their characteristic chirping, she will break open the nest and assist in the hatching process. Hatchlings then disperse across the flooded forest floor. Although losses from predators do occur (e.g. by soft-shelled turtles), they apparently are minimal, possibly accounting for the small number of relatively large eggs laid, and the long incubation period. They also have very sharp teeth for protection. It is one of four species of crocodile found in Africa. The others are the Nile, desert and dwarf crocodiles.

Status[edit]

This species has not been intensively studied and not enough information is known to provide guidance on its status. It is believed that the population may be dwindling and may be threatened, but whether this is in fact so is unclear. The range is still largely unknown, even where these animals are common. For these reasons, the IUCN has listed this species as "Data Deficient" as it has not been assessed since 1996, at which time it was listed as "Vulnerable".[7]

Taxonomy[edit]

Recent genetic and morphological evidence suggests that the slender-snouted crocodile in fact comprises two separate species composed of a central African population (Mecistops cataphractus) and the as yet unnamed west African population. The western species would, in fact, class as one of the most endangered species of crocodilian, and scientists have estimated that the two populations have been separate for 6.5-7.5 million years.

References[edit]

  1. ^ McAliley, Willis, Ray, White, Brochu & Densmore (2006). Are crocodiles really monophyletic?—Evidence for subdivisions from sequence and morphological data. Molecular Phylogenetics and Evolution 39: 16–32.
  2. ^ Brochu, C. A.; Njau, J.; Blumenschine, R. J.; Densmore, L. D. (2010). "A New Horned Crocodile from the Plio-Pleistocene Hominid Sites at Olduvai Gorge, Tanzania". PLoS ONE 5 (2): e9333. doi:10.1371/journal.pone.0009333. PMC 2827537. PMID 20195356. 
  3. ^ Robert W. Meredith, Evon R. Hekkala, George Amato and John Gatesy (2011). "A phylogenetic hypothesis for Crocodylus (Crocodylia) based on mitochondrial DNA: Evidence for a trans-Atlantic voyage from Africa to the New World". Molecular Phylogenetics and Evolution 60: 183–191. doi:10.1016/j.ympev.2011.03.026. 
  4. ^ Brochu, C. A.; Storrs, G. W. (2012). "A giant crocodile from the Plio-Pleistocene of Kenya, the phylogenetic relationships of Neogene African crocodylines, and the antiquity of Crocodylus in Africa". Journal of Vertebrate Paleontology 32 (3): 587. doi:10.1080/02724634.2012.652324.  edit
  5. ^ African Slender-Snouted Crocodile | The Maryland Zoo in Baltimore. Marylandzoo.org. Retrieved on 2014-05-07.
  6. ^ Slender-Snouted Crocodile | San Diego Zoo Animals. Sandiegozoo.org. Retrieved on 2014-05-07.
  7. ^ Crocodile Specialist Group (1996). "Mecistops cataphractus". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-12-14. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!