Overview

Brief Summary

Biology

Like many crocodilians, the African slender-snouted crocodile is apparently a rather shy and timid reptile (6), and despite being a remarkably agile swimmer (6), it is often found resting in the shade of trees (8). It is the only crocodilian species known to climb as high as several meters into the limbs of trees fallen along streams (7). Although it is a fish-eating specialist, the slender-snouted crocodile also feeds on frogs, snakes, shrimps, crabs, and even waterbirds and mammals (6) (8) (9); its slender snout has evolved to move quickly through the water, allowing rows of razor-sharp teeth to snatch fish in open water, or prey from burrows and amongst roots and fallen trees (8). Depending on the region and its climatological patterns, mating is reported to begin in February; and from March the female constructs a nest by scraping vegetation together with her hindfeet (6). These large mounds, up to 80 centimetres high and two metres wide, are situated in a shady spot a few metres from small rainforest streams (6). The female lays between 12 and 30 large, hard-shelled eggs in two layers in the mound, where a temperature of 27.4 to 34 degrees Celsius is maintained (6). At the beginning of the rainy season, after 90 to 100 days of incubation, young crocodiles start to emerge from the elliptical eggs (6). Their characteristic chirping instigates the mother to break open the nest and assist with the hatching process, causing the hatchlings to scatter over the flooded rainforest floor (10). Slender-snouted crocodiles display some degree of parental care of hatchlings, with females aggressively defending their young when they emit distress calls. It is unknown for how many months this maternal care is given (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The African slender-snouted crocodile is among the least known of the world's crocodilians (5). Its defining feature is its extremely slender snout, devoid of any bony ridges (6). The leathery skin of the adult is brownish-yellow with large black spots, and the olive coloured head is spotted with brown. Young crocodiles are greenish-grey to greenish-yellow in colour with black blotches and markings (6). Six or so rows of tough scales run down the crocodile's back, leading to the species name cataphractus, meaning 'clad in armour' in Greek (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Occurs in central and western Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa
Distribution: Angola, Benin, Burkina Faso, Cameroon, Central African Republic,  Chad, Congo, Equatorial Guinea, Gabon, Gambia, Ghana,  Guinea, Guinea Bissau, Ivory Coast, Liberia, Mali, Mauritania,  Nigeria, Senegal, Sierra Leone, Tanzania, Togo, Zaire, Zambia  
Type locality: Unknown; restricted to "Senegal," by Fuchs, Mertens, and Wermuth 1974
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in the equatorial rainforest belt of Central and West Africa; from southern Mauritania, east to the Central African Republic and south to Angola and Tanzania (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The African slender-snouted crocodile inhabits rivers, marshes, lakes and pools within rainforests (6). While habitat data are not exhaustive, the slender-snouted crocodile is apparently confined to freshwater and typically prefers larger, swift-flowing streams (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 56.1 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crocodylus cataphractus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCTTATACTTTATTTTCGGCGCCTGAGCTGGAATGGTAGGAACAGCCCTAAGCCTCCTAATCCGGACAGAACTCAGCCAGCCAGGTCCATTTATAGGAGATGACCAAATTTACAACGTTATCGTTACAGCACATGCCTTTATCATAATCTTTTTTATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGACTACTACCACTAATAATTGGAGCACCAGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTACTACCACCTTCATTTACCCTATTATTATTTTCCGCCTTTATTGAAACAGGTGCCGGCACCGGCTGAACAGTTTACCCACCACTAGCTGGAAACCTGGCCCACGCAGGACCATCAGTAGACCTAACTATCTTCTCCCTCCATCTTGCTGGAGTGTCCTCAATCTTAGGGGCAATTAACTTTATTACCACCGCTATTAACATAAAACCACCATCAATATCACAGCAACAAACACCACTTTTTGTGTGATCTGTGTTAGTCACTGCTGTACTCCTACTGCTCGCCCTGCCAGTCCTAGCTGCAGGTATTACTATGCTGCTTACTGACCGAAACTTGAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGATCCAATCTTATA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus cataphractus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Mecistops cataphractus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTTTTTTCCACCAACCACAAAGATATCGGCACCTTGTATTTTATCTTCGGCGCCTGAGCTGGAATAGTGGGGACAGCCCTA---AGCCTCCTAATCCGGACAGAACTTAGCCAGCCAGGTCCATTTATGGGAGAT---GACCAAATCTACAATGTCGTCGTTACAGCACACGCCTTTATCATAATCTTTTTTATAGTAATACCAATCATGATCGGAGGATTTGGAAACTGACTACTACCATTAATG---ATTGGAGCACCAGACATAGCATTCCCTCGAATAAATAACATGAGCTTCTGATTACTCCCCCCTTCATTCACCTTACTCTTATTTTCCGCCTTTATTGAAACCGGTGCCGGCACCGGTTGAACAGTCTACCCACCACTAGCTGGAAACCTGGCCCACGCAGGACCATCAGTAGACCTA---ACTATCTTCTCCCTTCACCTTGCTGGAGTATCATCAATCTTAGGGGCAATTAACTTCATTACCACTGCTATTAACATAAAACCCCCATCAATATCACAACAACAAACACCACTTTTTGTGTGATCTGTATTAGTCACTGCTGTACTTCTACTGCTAGCCCTACCAGTCCTAGCTGCA---GGCATTACTATACTGCTTACTGACCGAAACTTGAACACCACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATCTTATACCAACACCTTTTCTGATTTTTCGGCCACCCAGAAGTCTACATCCTCATCCTACCAGGGTTTGGAATGATCTCCCATGTTATTACTTTCTACTCAAGTAAAAAA---GAACCATTTGGATATATGGGGATAGTATGAGCTATGATATCAATTGGATTCTTAGGTTTCATTGTCTGAGCCCACCACATATTTACAGTAGGAATAGATGTCGATACCCGCGCATACTTCACATCCGCCACAATAATTATCGCCATCCCTACAGGAGTAAAAGTATTTAGCTGATTA---GCCACC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mecistops cataphractus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) by the IUCN Red List (3), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The sparse information on the African slender-snouted crocodile makes it difficult to determine its conservation status, and thus the World Conservation Union (IUCN) has declared it Data Deficient (3). However, the little survey data that is available suggests that many populations may be depleted, and possibly even extirpated in The Gambia, Senegal and Guinea-Bissau (2). These declines are likely to be the result of hunting, for its hide and for food (2), and the disruption of vital riverside vegetation (2). Slender-snouted crocodiles are extremely vulnerable to being caught and drowned in fishing nets when attempting to eat fish struggling in the nets. Very few significant populations of this species exist in Central or West Africa, and additional data and protection is urgently required (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The African slender-snouted crocodile is legally protected in many of its range countries, although this is poorly enforced. The sparse information available indicates that populations of this rare 'armour-clad' crocodile are declining, so better enforcement of laws, changes in legal status, and firmer hunting regulations are clearly needed. However, the lack of definitive information on this species' ecology, population dynamics and status makes such actions hard to develop, and the inaccessibility and political instability throughout much of its range hinders most efforts for further research or action (2) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Slender-snouted crocodile

The African slender-snouted crocodile (Mecistops cataphractus) is a species of crocodile. Recent studies in DNA and morphology suggest that it may belong in its own genus, Mecistops.[1][2][3][4]

Description[edit]

African slender-snouted crocodiles are native to freshwater habitats in central and western Africa. They are medium sized crocodile, typically a bit smaller than the Nile crocodile, but are larger than several other species of crocodilians. The adult length is from 3 to 4 m (9.8 to 13 ft) and adult weight is from 125–230 kg (280–510 lb). The occasional large specimen can weigh up to 325 kg (720 lb).[5][6] They have a slender snout used for catching prey, hence their name.

Behaviour[edit]

Slender snouted crocodiles bear a strong resemblance to gharial which also have a very slender snout

The diet of the slender-snouted crocodile consists mainly of fish, snakes, amphibians and crustaceans. This species is not typically found in groups, except during the onset of the breeding season. The female constructs a mound nest consisting mainly of plant matter. Nests are sited on the banks of rivers, and construction generally begins at the onset of the wet season, although breeding is asynchronous even within members of one population. It has a similar, but generally shorter nesting season than that of the sympatric dwarf crocodile, which may nest further from the riverine habitat frequented by C. cataphractus.

The slender-snouted crocodile lays an average of 16 (minimum 13, maximum 27) very large eggs (relative to body size) about a week after completion of the mound nest. The incubation period is long compared with most other crocodilian species, sometimes lasting over 110 days. The female remains close to the nest, but does not defend it with the same vigor as some other species of crocodilians. Once the eggs begin to hatch, and the juveniles emit their characteristic chirping, she will break open the nest and assist in the hatching process. Hatchlings then disperse across the flooded forest floor. Although losses from predators do occur (e.g. by soft-shelled turtles), they apparently are minimal, possibly accounting for the small number of relatively large eggs laid, and the long incubation period. They also have very sharp teeth for protection. It is one of four species of crocodile found in Africa. The others are the Nile, desert and dwarf crocodiles.

Status[edit]

This species has not been intensively studied and not enough information is known to provide guidance on its status. It is believed that the population may be dwindling and may be threatened but whether this is in fact so is unclear. The range is still largely unknown, even where these animals are common. For these reasons, the IUCN has listed this species as "Data Deficient" as it has not been assessed since 1996 at which time it was listed as "Vulnerable".[7]

References[edit]

  1. ^ McAliley, Willis, Ray, White, Brochu & Densmore (2006). Are crocodiles really monophyletic?—Evidence for subdivisions from sequence and morphological data. Molecular Phylogenetics and Evolution 39: 16-32.
  2. ^ Brochu, C. A.; Njau, J.; Blumenschine, R. J.; Densmore, L. D. (2010). "A New Horned Crocodile from the Plio-Pleistocene Hominid Sites at Olduvai Gorge, Tanzania". PLoS ONE 5 (2): e9333. doi:10.1371/journal.pone.0009333. PMC 2827537. PMID 20195356. 
  3. ^ Robert W. Meredith, Evon R. Hekkala, George Amato and John Gatesy (2011). "A phylogenetic hypothesis for Crocodylus (Crocodylia) based on mitochondrial DNA: Evidence for a trans-Atlantic voyage from Africa to the New World". Molecular Phylogenetics and Evolution 60: 183–191. doi:10.1016/j.ympev.2011.03.026. 
  4. ^ Brochu, C. A.; Storrs, G. W. (2012). "A giant crocodile from the Plio-Pleistocene of Kenya, the phylogenetic relationships of Neogene African crocodylines, and the antiquity of Crocodylus in Africa". Journal of Vertebrate Paleontology 32 (3): 587. doi:10.1080/02724634.2012.652324.  edit
  5. ^ [1]
  6. ^ [2]
  7. ^ Crocodile Specialist Group (1996). "Mecistops cataphractus". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-12-14. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!