Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Biology

The indiscriminate and somewhat ferocious feeding behaviour of crocodiles is notorious, but less known is their sociable nature, a rare feature in the world of reptiles (4). Not only do female Belize crocodiles guard their nests and protect their young, males may also assist with care of the young hatchlings (2). The female constructs a mound of vegetation, up to one metre high and three metres across, situated close to water. At the end of the dry season (2), usually between April and June (5), a clutch of 20 to 45 eggs are laid, each measuring ten centimetres across. For the next 80 days, the female remains close to the nest, finally helping her young out of the nest once the eggs hatch (2). Young Belize crocodiles initially eat small fish and hunt invertebrates, such as crickets, at the water's edge (2). As they grow, the diet also expands, to include larger fish, aquatic snails, small mammals (2), crustaceans and frogs (5). Eventually, the Belize crocodile will devour anything that comes close to the water (5). During the hottest part of the day, the Belize crocodile takes refuge in an underground burrow which it has dug. This burrow, which may be several metres long, usually has an underwater entrance and a larger chamber with an air hole (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Like other crocodilians, the group of reptiles that inspire both fear and intrigue in people, the Belize crocodile has an elongated snout; a streamlined body protected with tough, scaly skin; and a long, muscular tail (4). Its armoured skin is variable in colour (5), although normally it is greyish-brown with black bands and spots on the tail and sides (2) (6). Juveniles are bright yellow with black banding (6), and adult males are usually darker than females, which retain more of the yellow colour (5). The eyes are pale silvery-brown (2), and placed on its head so that only these and the tip of its snout can be seen as the crocodile sits submerged in water, waiting to ambush its prey (4). Often in the past this species was confused with the American crocodile (Crocodylus acutus) (7), but it differs by its darker colouration and shorter and broader head (5) (6). The genus name of this species, Crocodylus, appropriately means 'pebble worm' in Greek (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Morelet's crocodiles are found on the eastern coastal plain of Mexico, across most of the Yucatan peninsula, and throughout Belize and northern Guatemala. Their range also overlaps that of the American crocodile, but the relationships between the two are unknown. Some Morelet's crocodiles have escaped from captive breeding areas in Mexico outside their normal range.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America
Distribution: Belize, Guatamala, Mexico (Chiapas)  
Type locality: "Lac Flores (Yucatan)," Guatemala; restricted by Smith and Taylor (1950: 211), and Smith and Taylor (1950: 318) to "Guatemala, El Peten, Laguna de Peten".
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Mexico, Belize, Guatemala

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Belize crocodile occurs on the Atlantic coast of Central America (7), from the state of Tamaulipas, Mexico, southwards to Belize and northern Guatemala. Its range may also extend into northern Honduras (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The primary distinguishing feature of Crocodylus moreletii is the snout, which is uncharacteristically blunt for a crocodile. The snout has nostrils centered at its end. The eyes are situated behind the snout and ears behind the eyes. The location of all the sensory receptors are on the same plane (the top of the head) which allows them to be completely submerged in water and still have the ability to hear, see, and smell. Their eyes, which are silvery-brown, have special eyelids with nictitating membranes covering them, allowing for vision underwater. Morelet's crocodiles generally have 66 to 68 teeth, with the distinguishing purely Crocodylus characteristic of having them in perfect alignment. Their appearance and color is similar to the American crocodile, but Morelet's crocodiles tend to be a darker grayish-brown. Adults have dark bands and spots before the tail, while juveniles are a brighter yellow with black banding. Morelet's crocodiles lack bony plates (ventral osteoderums) beneath the skin. They have powerful legs with clawed webbed feet, and large tails that allow them to swim with powerful thrusts. They are medium-sized crocodiles, averaging 3 m and attaining a maximum of 4.7 m.

Range mass: 38.5 to 58.1 kg.

Average mass: 51 kg.

Range length: 2.2 to 4.7 m.

Average length: 3.0 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Can also be found in brackish waters in some areas. Terrestial nest sites and basking areas.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morelet's crocodiles live primarily in freshwater areas such as swamps and marshes and can also be found in forested riparian habitats. Recently, C. moreletii has even been found residing in coastal brackish water. Juveniles prefer denser cover for protection, and adults tend to aestivate in burrows during the dry season.

Habitat Regions: temperate ; tropical ; terrestrial ; freshwater

Terrestrial Biomes: forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Wetlands: marsh ; swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

An inhabitant of swampland, ponds, marshes and lagoons, the Belize crocodile prefers areas of dense vegetation (2). Although it generally occurs in freshwater (2), it may also be found in the brackish waters of coastal lagoons (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Morelet's crocodiles vary in diet according to their age and size. Juveniles eat small invertebrates and fish. Sub adults feed on aquatic snails, fish, small birds, and mammals. Adults feed on larger prey, including birds, fish, lizards, turtles, and domestic animals such as dogs. They can also become cannibalistic in times of low food, eating newborns. Crocodylus moreletii is generally shy around humans, but larger ones may attack if provoked.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore )

  • Rainwater, T., B. Adair, S. Platt, T. Anderson, G. Cobb. 2002. Mercury in Morelet's Crocodile Eggs from Northern Belize. Archives of Environmental Contamination and Toxicology, 10.1007/s00244-001-0020-7: 319-324.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

While not much information is known about the specific impact of the Morelet's crocodiles on their ecosystem, they do share many similar traits with the American crocodile, such as the role of primary carnivore in the ecosystem, thus affecting nutrient dispersal and ecosystem dynamics.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

While Morelet's crocodiles tend to be dominant predators in their communities, their eggs and young often fall prey to older juveniles, larger mammals, snakes, wading birds, and gulls. A key protection from predators is their tough hide and their loud vocal cries. Larger individuals are potentially preyed upon by humans and jaguars.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Juveniles communicate through vocalization (known as barking) when born, though not much information is known about specific social communication. They tend to follow the basic patterns of all Crocodylus, which are the most vocal of all reptiles; their calls tend to differ depending on age, sex and situation. They may share the similar habit of the American crocodile, whose young are not as vocal as other species, which may be a response to high hunting pressures, resulting in a rapid adaptation for survival.

Scales covering most of the head and parts of the body are equipped with integumentary sense organs (ISO's) that perform a number of tasks, such as detecting pressure, salinity, and vibrations.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

When born, juveniles generally weigh about 31.9 grams. Morelet's crocodiles have three main life stages, classified through their length: juveniles < 100 cm, sub adults 100-150 cm, and adults >150 cm. Not much information is known about the specific life cycle of this crocodile. As in all crocodilians, however, sex is determined by the incubation temperature of the eggs.

Development - Life Cycle: temperature sex determination

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Because they are both rare and difficult to study, not much is known about specific life cycles. Morelet's crocodiles that are bred in captivity appear to have a slightly longer lifespan (up to 80 years) than those that live in the wild (50 to 65 years). Females appear to live slightly longer than males.

Range lifespan

Status: captivity:
80 (high) years.

Typical lifespan

Status: wild:
50 to 65 years.

Average lifespan

Status: wild:
60 years.

Typical lifespan

Status: captivity:
55 to 70 years.

Average lifespan

Status: captivity:
65 years.

  • Stafford, P. J., J. R. Meyer. 2000. A Guide to the Reptiles of Belize. London: Natural History Museum of London.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25.4 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Not much information is known about particular mating habits between males and females, although they appear to follow some of the same mating habits (such as being polygynous) of the American crocodile (Crocodylus acutus). Probably large males dominate the other males in their area, and females prefer to mate with the dominant males.

Mating System: polygynous

Oviposition for crocodiles living on the Yucatan primarily takes place in Chiapas between April and June. Crocodylus moreletii is unique because it is the only crocodile known to be exclusively mound nesting, laying between 20 and 40 eggs in nests that are approximately 3 m wide by 1 m high. Some nests have been found containing more than one female's eggs.

At hatching time, two to three months after laying the eggs, female Morelet's crocodiles have been known to carry eggs to water areas and crack them open. Reproductive rates are generally high among C. moreletii because of the relatively early maturation of the females. Not much information is available about the specific behavior of juveniles or the fertilization process. Research is currently being conducted in these areas.

Breeding interval: Morelet's crocodiles breed once a year directly before the rainy season.

Breeding season: Oviposition takes place between April and June. The incubation period lasts 2 to 3 months.

Range number of offspring: 20 to 40.

Range age at sexual or reproductive maturity (female): 7 to 8 years.

Average age at sexual or reproductive maturity (female): 7 years.

Range age at sexual or reproductive maturity (male): 7 to 8 years.

Average age at sexual or reproductive maturity (male): 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Female Morelet's crocodiles guard their nests until the eggs are ready to hatch. Studies among captive Crocodylus moreletii show females will respond to newborn vocalizations and open the nests. Males and females will also fiercely defend hatchlings against larger juveniles or other predators. Not much information is known about further interaction between juveniles and parents.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Platt, S. G., J. B. Thorbjarnason. November 2000. Population Status and Conservation of Morelet's Crocodile. Biological Conservation, 96/1: 21-29.
  • Britton, A. 2002. "Crocodilian Species-Morelet's Crocodile (Crocodylis Moreletii)" (On-line ). Crocodilian Species List. Accessed 03/18/03 at http://www.flmnh.ufl.edu/natsci/herpetology/brittoncrocs/csl.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crocodylus moreletii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGAATATTAATCGTTGACTTTTTTCCACTAACCACAAAGATATCGGCACCTTGTATTTTATTTTCGGCGCCTGAGCCGGAATAGTAGGCACAGCCATAAGCCTATTAATCCGAACAGAGCTCAGCCAGCCAGGTCCCTTCATAGGAGATGACCAAATTTATAATGTTATTGTTACAGCACATGCCTTTATCATAATTTTCTTTATAGTTATACCAATTATGATCGGGGGATTTGGAAATTGACTACTCCCATTAATAATTGGGGCACCCGACATAGCATTCCCTCGCATAAACAACATAAGCTTCTGATTGCTGCCCCCATCATTTACCCTACTTCTCTTTTCCGCCTTTATTGAAACTGGGGCTGGCACCGGATGAACAGTCTACCCACCACTAGCTGGAAACCTAGCCCACGCCGGACCGTCAGTAGACCTCACTATCTTCTCCCTTCACCTTGCTGGGGTATCATCCATCCTTGGAGCAATCAACTTTATTACCACAGCTATCAACATAAAACCCCCAGCAATGTCACAACAACAAACACCCCTTTTTGTATGGTCTGTTCTAGTTACAGCTGTTCTCCTACTGCTCTCACTACCCGTCCTAGCTGCAGGAATTACCATATTACTTACTGACCGAAACTTGAACACCACTTTCTTTGACCCGGCAGGAGGAGGAGACCCAATCCTATACCAACACCTTTTCTGATTTTTCGGCCACCCAGAAGTATACATCCTCATCCTCCCAGGGTTTGGAATAATCTCCCACGTAATTACCTTCTACTCAAGCAAAAAAGAACCATTTGGTTATATAGGAATARTCTGGGCCATAATGTCAATCGGCTTCCTTGGCTTCATTGTCTGAGCCCACCATATGTTTACAGTAGGAATAGATGTTGATACTCGAGCATATTTCACATCCGCCACAATAATTATCGCCATCCCCACTGGTGTAAAAGTATTCAGCTGATTAGCCACTATTTACGGGGGAGTAGTAAAATGACAAGCCCCCATGCTCTGAGCACTCGGCTTCATTTTCTTATTCACAGTTGGAGGACTAACAGGAATTGTACTAGCTAACTCGTCACTAGACATTATTCTCCACGATACCTACTATGTAGTAGCCCACTTCCACTATGTATTATCTATAGGAGCAGTGTTCGCCATCATAAGCGGGTTCACCCACTGATTCCCATTATTTACAGGATTCACCCTACACAGCACATGAACAAAAATTCAATTCATAATCATATTTACAGGTGTAAACCTAACCTTCTTCCCACAGCACTTCCTAGGCCTATCAGGAATGCCACGACGATATTCAGACTACCCAGATGCATATGCCTKCTGAAATATAATTTCCYCAATTGGGTCATTAAYCTCCATAGTATCAGTTATCCTACTCACATTTATTGTATGAGAAGCATTTTCATCAAAACGAAAAGTTCAAGTACCTRAAATGGCAAGCACAAATGTAGAATGACTAAACAATTGTCCACCATCATACCACACCTACGAAGAACCAGTCTTTGTTCAAGTACAACCAAAACTAAAGTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus moreletii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/cd
Lower Risk/conservation dependent

Red List Criteria

Version
2.3

Year Assessed
2000

Assessor/s
Ross, J.P.

Reviewer/s

Contributor/s

Justification
Now recorded at more than 40 localities around the Gulf of Mexico. Surveys and population estimates all show moderate densities, and it is confidently assessed to have more than 10,000 mature individuals in the wild. Still found in all historic localities.

History
  • 1996
    Data Deficient
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Due to their valuable hide, Morelet's crocodiles were hunted almost to extinction through the years 1940 to 1950. Under the Mexican Wildlife Protection Act, hunting them became illegal and their numbers have steadily risen, although illegal poaching and habitat loss continue to threaten the animal. To counteract this, Mexico has begun breeding Morelet's crocodiles in captivity. However, some individuals have escaped to form feral populations outside of their regular breeding zones, creating a problem for the populations of American crocodile, which must compete with this newly-invasive species.

Now primary focus remains in the development of sustainable use programs, such as commercial farming. More general knowledge about the species is required first, however. Status in the south of Belize is unknown; reports suggest the species is widely distributed in the Mexican states of Tabasco, Chiapas, Yucatan and Quintana Roo, and their situation in the interior of Guatemala is unknown. There remains little information on both specific numbers and general behavior patterns needed to judge their actual status throughout most of its range.

Morelet's crocodiles are listed as Endangered under the U.S. Endangered Species Act, and are included in Appendix I of the CITES Treaty. The IUCN rates the species as "Lower Risk", but this rating would revert to Threatened or Endangered if ongoing conservation efforts were ended.

US Federal List: threatened

CITES: appendix i

IUCN Red List of Threatened Species: lower risk - conservation dependent

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Crocodylus moreletii , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Conservation Dependent (LR/cd) on the IUCN Red List 2007 (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Numbers of the Belize crocodile have declined dramatically throughout its range, primarily as a result of hunting for its beautiful skin. The scale of hunting was once so massive that in the mid 1950s up to 1,000 skins could be sold in a day in a single market in Mexico. As a result, the Belize crocodile is now extinct in some parts of Mexico (2). While legal protection for the Belize crocodile now exists, enforcement is difficult and illegal hunting remains a major threat to the continued survival of this species (2). In some ways, the situation has actually worsened, with increasing development opening up some previously remote areas, allowing hunters to penetrate further into this crocodile's range (2). In addition, while in the past hunters were said to have left some of the older crocodiles so that they would continue to breed, hunters today are believed to decimate whole populations without any thought for their future (2). Furthermore, crocodiles are perceived as a threat to both humans and livestock, resulting in the occasional killing of a crocodile near human settlements, and a number of Belize crocodiles also drown in fishing and turtle nets each year (8). In Mexico, habitat destruction is believed to be causing a steady decline in numbers of the crocodile (6). Finally, the Belize crocodile may be threatened by long-term exposure to environmental contaminants, such as pesticides. While the effects of exposure are not yet fully known, the decline of American alligators (Alligator mississippiensis) in Florida following exposure to similar chemical contaminants, gives cause for concern (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I (except the populations of Belize and Mexico, which are included in Appendix II with a zero quota for wild specimens traded for commercial purposes).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Wild populations of Belize crocodiles are protected in Mexico, Belize and Guatemala (7). While enforcement of these laws is difficult (2), they have still been incredibly beneficial to this species, with population recoveries in Belize being largely attributed to a ban on crocodile skin exports. This has removed the incentive for people to hunt crocodiles and has allowed numbers to recover from previous over-harvesting (8). The Belize crocodile also occurs in a number of protected areas throughout its range (7) (8), such as the Centla Biosphere Reserve and the Sian Kaán Biosphere Preserve in Mexico, where healthy populations exist (7). Efforts to develop programmes for the sustainable use of this species are also underway, and a number of commercial farming operations have started in Mexico (7), which will lessen hunting pressure on wild populations. In addition, in Tuxtla Guiterrez Zoo, Mexico, Belize crocodiles were bred and hatchlings reared for a year before being released into areas where the species has been previously wiped out (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although generally shy, as with any crocodile, C. moreletii has been known to bite humans if provoked.

Negative Impacts: injures humans (bites or stings)

  • Matthews, D. 1995. "Four Faces of Mexico; in the Yucatan, a wild and seldom visited wetland". Washtington Post, 01908286: E01.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Unlike most other species of crocodilian, Morelet's crocodiles have no bony plates (called osteoderms) in their skin. This makes the skin more valuable as leather, and has motivated over-hunting.

Also, studies of the levels of mercury within the eggs of Morelet's crocodiles in Belize has also led to clues about biological contamination there.

Positive Impacts: body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Morelet's crocodile

Morelet's crocodile (Crocodylus moreletii), also known as the Mexican crocodile, is a modest sized crocodilian found only in fresh waters of the Atlantic regions of Mexico, Belize and Guatemala.[1][2] It usually grows to about 3 metres (9.8 ft) in length. It is an endangered species.

Contents

Taxonomy and etymology

Morelet's crocodile was discovered in Mexico in 1850[3] and named after the French naturalist who made the discovery, P.M.A. Morelet (1809–1892).[3] It was long confused with the Cuban crocodile and the American crocodile because of similar characteristics. It was not realized that they were a separate species until the 1920s.[4] Present day crocodilians come from an ancient lineage comprising over 125 genera.[5]

Characteristics

There are features of this species that set it apart and make it easy to identify. It has a very broad snout[4] with 66 to 68 teeth when they are fully mature.[3] Crocodiles can be distinguished from alligators because of their teeth in both their upper and lower jaws. Their teeth in both jaws are perfectly aligned.[4] The fourth tooth on the bottom jaw of the crocodile is visible when their jaw is closed because it is slightly bigger than the rest of its teeth.[4]

The nostrils are located in front of the snout, then directly behind them are the eyes, followed by the ears [4] and all three are on top of the crocodiles head. When almost fully submerged, it still has the capability to smell, hear, and see its surroundings.[4] Crocodiles can see under water due to their nictitating membrane which surrounds their eye.[4] This is a clear eyelid which can protect the crocodile’s eyes and allow it to see as well.[4]

Morelet's crocodiles are a dark grayish-brown color.[3] They have dark bands and spots on the body and the tail.[3] This is similar to other crocodiles like the American crocodile, but the Morelet is somewhat darker.[3] Juvenile crocodiles are bright yellow in color with some dark bands.[4] The crocodile’s iris is silvery brown in color.[3] They have 2 legs and 2 arms along with a long tail which is used for swimming. The hind feet of crocodiles are webbed. Crocodile legs are short so the crocodiles are located very close to the ground. They have very explosive capabilities because of their strong muscles and are fast runners.

Size

Morelet’s crocodile is small in size compared to several other crocodiles. The males can become larger than the females; this is known as sexual dimorphism.[4] The adult crocodile averages 2.2–3 m (7.2–9.8 ft) in length with a maximum reported length of 4.3 m (14 ft)[6] Body mass in this species is often around 38–58 kg (84–130 lb), though is likely much more in large individuals.[7] Overall, this species is similar to the Cuban and the larger American crocodiles in appearance.

Distribution and habitat

Morelet's crocodile in the wild next to Lake Coba, Quintana Roo, Mexico.

Morelet's crocodile can be found in freshwater habitats in Central America[3] and along the Gulf of Mexico stretching through Belize, Guatemala, and to Mexico.[3][5] In their freshwater habitats they prefer isolated areas that are secluded. This species of crocodile can be largely found in freshwater swamps and marshes[3] which are located inland, and in large rivers and lakes.[8] Both of these habitats are forested to help add cover.[3]

The Morelet can also be found along the coast in brackish waters.[1][4] Brackish waters are areas where the salt water from the ocean mixes along with the freshwater from the inlands.[4] In these areas the habitat is slightly different than the freshwater forested swamps inland. They also inhabit the grassy savannas on the Yucatán Peninsula.[9] These crocodiles become much more distributed during the rainy seasons when flooding occurs and it is easier for them to move elsewhere.[9] Juvenile crocodiles live in very dense cover to protect them from other predators that might be in the area and will remain there until they become older and able to fend for themselves.[3] The adult crocodiles are known to dig out burrows during times associated with the dry seasons in their area.[3] The range of this crocodile can overlap with the American crocodile, which can sometimes lead to them being confused with one another.[4]

Biology and behavior

Morelet's crocodile waiting for an ambush.

Hunting and diet

Crocodiles are carnivores. They capture their prey with stealth like techniques, slowing sneaking up on their prey. When a crocodile captures its prey they must first kill it before eating. Crocodiles kill the majority of their prey by grasping them in their muscular jaws and dragging their prey back into the water to drown.

Morelet's crocodiles prey on small mammals, birds, and other reptiles.[6] These small mammals can include domesticated animals like cats and dogs.[4] Juvenile crocodiles feed largely on fish and insects until they become bigger and more capable of bringing down larger prey.[8] Crocodiles have been known to be cannibalistic,[4] this includes eating their young.

Reproduction

6 month old, at Tiergarten Schönbrunn

Breeding usually talks place between April and June[9] and the eggs or laid before the start of the rainy season.[3] Morelet's crocodiles are unique among North American crocodiles in that they build mound nests only, and not mound and hole nests.[4] These mound nests are about 3 metres (9.8 ft) wide and 1 metre (3.3 ft) high[3] and can be found near the water or on floating vegetation.[3][4] A female crocodile can lay between 20 and 45 eggs[3] and nests have been found containing eggs from more than one female.[3] The eggs are buried and the nests are guarded by females that protect their unborn young from predators.[3] The eggs usually hatch after 80 days of incubation[9] and hatchlings are normally about 17 centimetres (6.7 in) long.[2] After the eggs have hatched the female crocodile will carry her young to the water where they are protected by both parents[3] and will later leave them to fend for themselves.

Conservation

Baby Morelet's crocodiles at the Cotswold Wildlife Park, England.

Morelet's crocodile has long been threatened by habitat destruction and illegal hunting.[10] Both of these factors have significantly lowered their populations. It was hunted for its hide during the 1940s and 1950s[10] because high quality leather can be made from their skins.[11] Crocodile leather can be used to make wallets, coats and shoes.

Morelet’s crocodile is an endangered species.[9] One of the key protectors of crocodiles today is the CSG, or Crocodile Specialist Group,[12] started in 1971.[12] This is a worldwide organization of biologist and other professions coming together to conserve the 23 species of alligators and crocodiles. The CSG monitor all trading of crocodile skins.[12] They help determine if the skins are legal or if they were illegally taken. When this organization started all of the crocodilian species were either threatened or endangered.[12] Today those numbers have greatly changed.

“By 1996 one third of the crocodilian species were abundant enough to support regulated annual harvests, another third were no longer in danger of extinction, but the final one third of the species still remain endangered.”[12]

References

  1. ^ a b c Ross, J.P. (2000). "Crocodylus moreletii". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 14 March 2012. 
  2. ^ a b "Crocodilians species (CSG)". 
  3. ^ a b c d e f g h i j k l m n o p q r s t Britton, Adam. ""Crocodylus Moreletii." Crocodilians Natural History and Conservation. 2002.". 
  4. ^ a b c d e f g h i j k l m n o p q ""Morelet's Crocodile." Angel Fire. 15 May 2003.". 
  5. ^ a b Dever, J. A; Richard E. Strauss, Thomas R. Rainwater, Scott T. McMurry, and Llewellyn D. Densmore III. “Genetic Diversity, Population Subdivision, and Gene Flow in Morelet’s Crocodile (Crocodylus moreletii) from Belize, Central America” Copeia. 2002. 4: 1078-1091.
  6. ^ a b ""Morelet's Crocodile." Belize Zoo. 2007.". 
  7. ^ [1]
  8. ^ a b ""Freshwater Crocodile." Australia Zoo.". 
  9. ^ a b c d e Navarro, Carlos. ""The Return of the Morelet’s Crocodile." Reptilia." (pdf). 
  10. ^ a b ""Crocodylus Moreletii." Florida Museum.". 
  11. ^ Platt, Steven; John Thorbjarnarson. “Population status and conservation of Morelet’s Crocodile, Crocodylus moreletii, in northern Belize” Biological Conservation. 2000. 96: 21-29.
  12. ^ a b c d e King, F. ""The Crocodile Specialist Group." Crocodile Specialist Group. 4 Mar. 2002.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!