Overview

Brief Summary

Biology

The Nile crocodile shows a shift in diet with increasing body size. Young individuals usually feed on insects, small fish, amphibians and crustaceans, the diet changing to include more vertebrates, including fish, turtles, birds and mammals, as the individual matures (3) (6) (7). The largest Nile crocodiles are capable of taking prey up to the size of antelope, buffalo, zebras and wildebeest, dragging the prey into the water and spinning the body around to tear off chunks of flesh (2) (3). Like other reptiles, Nile crocodiles control body temperature by seeking shade when hot and basking in the sun when cool (6), and basking crocodiles are often a common sight along riverbanks. Nile crocodiles may also dig dens, which they use to retreat from adverse environmental conditions (3). These reptiles have quick reflexes and can be surprisingly fast runners on land (2) (6), though they may tire quickly (7). Breeding usually takes place during the dry season (6) (7), though the exact timing varies with location (3). Mating takes place in the water. The nest is a hole, up to 50 centimetres deep, dug by the female into a sandy bank, several metres from the water (2) (3) (6). The female Nile crocodile is an attentive parent, and, after laying up to around 60 eggs, will cover the nest with sand and guard it for the entire incubation period, around 90 days (2) (3) (4). Sex in the Nile crocodile is determined by the temperature at which the eggs are incubated, with females produced below 31 degrees Celsius, and males at above 31 to 34 degrees Celsius (8). When about to hatch, the young make a “peeping” noise, which encourages the female to excavate the nest. The female then gathers the hatchlings in her mouth and transports them to the water, where they remain in a group for several months, protected by the female (2) (4) (7). Amazingly, the Nile crocodile's powerful jaws can be used incredibly gently, and the female can even help hatchlings emerge by carefully rolling and squeezing the eggs in her mouth. However, despite this care and vigilance, nests may be raided by a variety of other animals, and hatchling crocodiles are very vulnerable to predation (3) (7). Young females reach sexual maturity at a body size of around 2.6 metres, and males at 2.7 to 3.1 metres (3) (9), achieved at around 12 to 15 years old (2). The Nile crocodile can be long-lived in the wild (6). The social behaviour of the Nile crocodile is often underestimated (3). Males are territorial, patrolling and defending territories which may encompass a length of shoreline and extend up to 50 metres out into the water (4). Co-operative feeding behaviour has also been reported. For example, several animals may cordon off an area of water to concentrate fish within it, and dominance hierarchies determine the order in which individuals feed (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The largest of Egypt's reptiles, with perhaps the exception of Dermochelys coriacea, reaching a total length of up to 6,000 mm, but usually smaller. Dorsal surface of head rough; back with juxtaposed, strongly keeled plates, in 6 longitudinal rows at mid-body, being reduced in number toward the tip of the tail, where only one plate is found. Tail long, laterally compressed, with a serrated dorsal crest. Venter with small, square, smooth scales. Hind limbs more webbed than forelimbs. Dorsum dark olive-brown with black cross-banding on the tail and body; this banding becomes fainter in adults. Venter yellowish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

One of the largest of all crocodilians (6), the Nile crocodile is a supremely adapted aquatic predator, with a streamlined body, a long, powerful tail, webbed hind feet, and long, powerful jaws, ideally suited for grabbing and holding onto prey (7). The eyes, ears and nostrils are located on top of the head, allowing the crocodile to lie low in the water, almost totally submerged and hidden from prey. A special valve at the back of the throat allows the mouth to be opened to catch and hold prey underwater without water entering the throat. In addition to a good sense of smell and excellent night vision, crocodiles also possess sensory pits in the scales along the side of the jaw, used to detect movement and vibrations in the water. Like all true crocodiles, the enlarged fourth tooth on the lower jaw is clearly visible when the mouth is closed, a feature which distinguishes this group from other crocodilians, such as alligators (7). The body of the adult Nile crocodile is a grey-olive colour, with a yellowish belly, while the juvenile is more greenish or dark olive-brown, with black cross-banding on the tail and body, which becomes fainter in adults (2) (3). In general, the male Nile crocodile grows larger than the female (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution in Egypt

Nile Valley. Currently restricted to Lake Nasser where a fairly substantial population exists. During pharaonic times the species was distributed throughout the Nile Valley (including the Fayoum Depression) and Delta, apparently even entering the Mediterranean, whence it was carried by the prevailing currents eastward to reach small rivers in Palestine (Flower 1933). By the end of the 18th century it had mostly disappeared from the Delta and by the late 1800s it became largely restricted to the Nile, south of Aswan (Anderson 1898). Flower (1933) reports a specimen collected in 1927 from the Delta, about 129 km north of Cairo, and another from Beni Suef in 1923. Even upstream of Aswan, the species had become scarce by the early 1900s, when Flower (1933) reported only a handful of records between 1900 and 1930. C. niloticus probably became locally extinct by the 1960s, Marx (1968) adding no further records from the country. No spec­imens are available from Egypt during that period. However, after the completion of the High Dam and the filling of Lake Nasser in the late 1960s, large areas of suitable habitats were created and slowly colonized. Today Lake Nasser probably represents one of the strong­holds of the species, at least at the regional level.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread throughout Africa south of the Sahara, includ­ing Madagascar; also the Nile Valley in Egypt. Became extinct from Palestine only in the last 100 years or so. Relict populations are also known from several isolated localities in the Sahara.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa
Distribution: Angola, Benin, Botswana, Burkina Faso, Burundi, Cameroon, Central African Republic, Chad, Congo, Egypt, Ethiopia, Equatorial Guinea, Gabon, Gambia, Ghana, Guinea, Guinea Bissau, Ivory Coast, Kenya, Liberia, Madagascar, Nosy Faly, Malawi, Mali, Mozambique, Namibia, Niger, Nigeria, Rwanda, Senegal, Sierra Leone, Somalia, South Africa, Sudan, Swaziland, Tanzania, Togo, Uganda, Zaire, Zambia, Zimbabwe.  pauciscutatus; Somalia (Shebelli and Juba rivers), Ethiopia, Kenya  suchus: Mauritania and other West African countries, Benin.  
Type locality: India and Egypt; restricted by Fuchs et al. (1974) to "Ägypten" (= Egypt).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Africa, Middle East

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Nile crocodile has a wide distribution throughout sub-Saharan Africa and is also found on Madagascar (1) (6). However, it has been eliminated from some former parts of its range, including the Mediterranean coast, Israel and Jordan (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits rivers, lakes, and swamps; infrequently or accidentally in brackish and marine waters (not in Egypt). Prefers areas with exposed sandy shores for basking.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Nile crocodile inhabits a wide range of aquatic habitats, including large freshwater lakes, rivers, freshwater swamps, coastal estuaries and mangrove swamps (2) (3) (6). Different age groups may use different habitat types, with sub-adults dispersing away from breeding areas on reaching a length of around 1.2 metres (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Crocodylus niloticus preys on:
Anura
Dytiscidae
Pandion haliaetus

Based on studies in:
Malawi (River)
Africa, Crocodile Creek, Lake Nyasa (Lake or pond)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

More or less aquatic, excellent swimmer. Mostly nocturnal, foraging at night in or near water, but basks on land for long hours, near water's edge, during the day. Territorial during the breeding season, and aggressively guard nests against intruders. The fairly advanced maternal care is quite unique in the Reptilia.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 43.8 years (captivity) Observations: Indirect calculations suggest these animals may live up to 60 years (Castanet 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crocodylus niloticus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0251-06|AJ810452|Crocodylus niloticus| AATCGTTGACTTTTTTCCACTAACCACAAAGATATCGGCACCTTGTATTTTATTTTCGGCGCCTGAGCCGGAATAGTAGGCACAGCCATA---AGCCTATTAATCCGAACGGAGCTCAGCCAGCCAGGCCCCTTCATAGGAGAT---GACCAAATTTACAATGTTATTGTTACAGCACATGCCTTTATCATAATTTTCTTTATAGTTATACCAATTATGATCGGAGGATTTGGAAATTGACTACTCCCATTAATA---ATTGGAGCACCCGACATAGCATTCCCTCGCATAAACAACATAAGCTTCTGATTGCTACCCCCATCATTTACCCTACTTCTCTTTTCCGCCTTTATTGAAACCGGGGCTGGCACCGGATGAACAGTCTACCCACCGCTAGCTGGAAACCTAGCCCACGCCGGACCATCAGTAGACCTC---ACTATTTTCTCCCTTCACCTTGCTGGGGTGTCATCCATCCTTGGAGCAATTAACTTTATCACCACGGCTATCAACATAAAACCACCAGCAATGTCACAACAACAAACGCCCCTCTTTGTGTGATCTGTTCTAGTTACAGCTGTCCTCCTACTGCTCTCACTACCCGTCCTAGCTGCA---GGAATTACTATACTACTAACTGACCGAAACTTGAACACCACTTTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTATACCAACACCTCTTCTGATTTTTCGGCCACCCAGAGGTATATATCCTTATCCTACCAGGGTTTGGAATAATCTCCCACGTAATTACCTTCTACTCAAGCAAAAAA---GAACCATTTGGCTATATAGGAATAGTCTGAGCCATAATGTCAATCGGCTTCCTTGGCTTCATTGTCTGAGCCCACCATATGTTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus niloticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 12
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Crocodile Specialist Group

Reviewer/s

Contributor/s

Justification
May be threatened in parts of its range.

History
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

In Egypt it is rather uncommon and localized. Total population size is probably smaller than one might think, made up largely of juveniles and immatures; the num­ber of breeding adults (sexual maturity reached at about 10 years of age) is probably considerably less than 5,000 animals. The species is subjected to considerable illegal collection pressure for the pet trade and for skins, and is increasingly being targeted by 'sports' hunting parties. Growing human activity in the Lake Nasser region and claims of attacks on humans, and other anthropogenic conflicts are likely to lead to significant reduction in the species' population in the coming years. In Egypt it is Vulnerable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Lower Risk/least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Crocodylus niloticus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). All populations are listed on either Appendix I or II of CITES (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Conflict with humans presents perhaps the greatest threat to the Nile crocodile. As large and potentially dangerous predators, people are often, understandably, intolerant of crocodiles, and deliberate destruction of nests and killing of adults is common (6). Crocodiles may also come into conflict with fishermen, damaging nets when trying to remove fish from them (10). In addition, the Nile crocodile is popular for its skins, used to make high-quality leather, and hide hunting between the 1940s and 1960s resulted in large population declines throughout its range (3) (6). Although now relatively secure and abundant in southern and eastern Africa, Nile crocodile populations may be greatly depleted in the central and western parts of its range (6), due partly to heavy hunting in the past, and partly to ongoing habitat loss. Other threats to the species include, for example, invasion of its habitat by non-native plants, such as Chromolaena odorata, which may be shading and crowding out Nile crocodile nesting sites in Greater St Lucia Wetland Park in South Africa, cooling eggs and possibly leading to an all-female population (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I [except the populations of Botswana, Egypt (subject to a zero quota for wild specimens traded for commercial purposes), Ethiopia, Kenya, Madagascar, Malawi, Mozambique, Namibia, South Africa, Uganda, the United Republic of Tanzania (subject to an annual export quota of no more than 1,600 wild specimens including hunting trophies, in addition to ranched specimens), Zambia and Zimbabwe, which are included in Appendix II].
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Ironically, exploitation for skins and meat has proved to be a valuable tool in Nile crocodile conservation, providing an incentive for people to protect the species and its habitat (6) (10). Although listed on Appendix I of the Convention on International Trade in Endangered Species (CITES), meaning most international trade in this species is banned, it has been downgraded to Appendix II in a number of countries (5), allowing a certain level of commercial utilisation and trade, mainly in the form of ranching (3) (6). In this system, eggs or hatchlings are taken from the wild and reared in captivity (6). As well as providing an incentive to protect the wild population, this practice may even help boost Nile crocodile numbers as it improves the survival rate of the young, a proportion of which may be returned to the wild (10). These sustainable-use initiatives are also thought to be responsible for the lack of illegal trade in this species (3). As a result of successful management in many areas, the Nile crocodile is still widely distributed and generally has healthy populations (3) (6). It also occurs in a number of protected areas, such as Lake Turkana National Park in Kenya (12) and Greater St Lucia Wetland Park in South Africa, where the population of Nile crocodiles is one of the largest in Africa (13). However, there is still a need for population surveys and ecological studies in many central and western African countries, as well as development and implementation of management programmes in these areas, and educational programmes to teach local people about the importance of this impressive reptile (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nile crocodile

The Nile crocodile or Common crocodile (Crocodylus niloticus) is an African crocodile which is common in Somalia, Ethiopia, Uganda, Kenya, Egypt, Tanzania, Zambia, Zimbabwe, Gabon, South Africa, Malawi, Sudan, Botswana, and Cameroon. Isolated populations also exist in Madagascar, Senegal.

Contents

Distribution and habitat

In antiquity, Nile crocodiles occurred in the Nile delta and the Zarqa River (Jordan), and they are recorded by Herodotus to have inhabited Lake Moeris. They are thought to have become extinct in the Seychelles in the early 19th century. It is known from fossil remains that they once inhabited Lake Edward.[2] The Nile crocodile's current range of distribution extends from the Senegal River, Lake Chad, Wadai and the Sudan to the Cunene and the Okavango Delta. In Madagascar, crocodiles occur in the western and southern parts from Sembirano to Port Dauphin. They have occasionally been spotted in Zanzibar and the Comoros.[2] Until recently, many permanent waters in the Sahara still housed relict populations.[3]

In East Africa, they are found mostly in rivers, lakes, marshes, and dams. They have been known to enter the sea in some areas, with one specimen having been seen 11 km off St Lucia Bay in 1917. In Madagascar, they have adapted to living in caves.[2]

Biology and appearance

View of a Nile crocodile from the side

Nile crocodiles have a dark bronze colouration above, with black spots on the back and a dirty purple on the belly. The flanks, which are yellowish green in colour, have dark patches arranged in oblique stripes. There is some variation relative to environment; specimens from swift flowing waters tend to be lighter in colour than those dwelling in lakes or swamps. They have green eyes.[2]

Like all crocodiles, they are quadrupeds with four short, splayed legs; long, powerful tails; a scaly hide with rows of ossified scutes running down their back and tail; and powerful jaws. They have nictitating membranes to protect their eyes and have lachrymal glands, and can cleanse their eyes with tears.

Nostrils, eyes, and ears are situated on the tops of their head, so the rest of the body can remain concealed underwater. Their coloration also helps them hide: Juveniles are grey, multicoloured, or brown; with darker cross-bands on their tail and body. As they mature they become darker and the cross-bands fade, especially those on the body. The underbelly is yellowish, and makes high-quality leather.

They normally crawl along on their bellies, but they can also "high walk" with their trunks raised above the ground. Smaller specimens can gallop, and even larger crocodiles are capable of surprising bursts of speeds, briefly reaching up to 12 to 14 km/h (7.5 to 8.5 mi/h). They can swim much faster by moving their body and tail in a sinuous fashion, and they can sustain this form of movement much longer at about 30 to 35 km/h (18 to 22 mi/h).

They have a three-chambered heart which is often mistaken as four-chambered due to an elongated cardiac septum, which is physiologically similar to the four chambered heart of a bird, which is especially efficient at oxygenating their blood. They normally dive for only a couple of minutes, but will stay underwater for up to 30 minutes if threatened, and if they remain inactive they can hold their breath for up to 2 hours. They have an ectothermic metabolism, so they can survive a long time between meals — though when they do eat, they can eat up to half their body weight at a time.

They have a rich vocal range, and good hearing. Their skin has a number of poorly understood integumentary sense organs (ISOs), that may react to changes in water pressure.

The bite force exerted by an adult Nile crocodile has been shown by Dr. Brady Barr to measure 5,000 lbf (22 kN). However, the muscles responsible for opening the mouth are exceptionally weak, allowing a man to easily hold them shut with a small amount of force.[4] Their mouths are filled with a total of 64 to 68 cone-shaped teeth. On each side of the mouth, there are 5 teeth in the front of the upper jaw (the premaxilla), 13 or 14 in the rest of the upper jaw (the maxilla), and 14 or 15 on either side of the lower jaw (the mandible). Hatchlings quickly lose a hardened piece of skin on the top of their mouth called the egg tooth, which they use to break through their egg's shell at birth.

Outside water crocodiles can meet competition from other dominant Savanna predators, notably felines such as lions and leopards. Occasionally, both will hunt and prey on each other, depending on size, if regular food becomes scarce.[5][6]

Size

Healthy mid-sized adult

The Nile crocodile is the largest crocodilian in Africa and is sometimes regarded as the second largest crocodilian after the saltwater crocodile. The male crocodile usually measure from 11.5 to 16 feet long (3.5 to 5 metres), but very old, mature ones can grow to 18 ft (5.5 m) or more.[7] Like all crocodiles they are sexually dimorphic, with the males up to 30% larger than the females, though the difference is even more in some species, like the saltwater crocodile. Mature female Nile crocodiles measure 8 to 13 ft (2.4 to 4.0 m)[8] Typical Nile crocodile weight is 225 kg (500 lb), though 730 kg (1,600 lb) is possible.[9] The largest accurately measured male was shot near Mwanza, Tanzania and measured 6.45 m (21.2 ft) and weighed approximately 1,090 kg (2,400 lb).[10]

Average Nile crocodile size (green) along with size of Gustave (grey) compared to a human

7-metre (23 ft) specimens and larger have been reported, but since gross overestimation of size is common these reports are suspect. The largest living specimen is purported to be a man-eater from Burundi named Gustave; he is believed to be more than 20 ft (6.1 m) long. Such giants are rare today; before the heavy hunting of the 1940s and 1950s, a larger population base and more extensive wetland habitats meant more giants.

There is some evidence that Nile crocodiles from cooler climates like the southern tip of Africa are smaller, and may reach lengths of only 4 m (13 ft). Dwarf Nile crocodiles also exist in Mali and in the Sahara desert, which reach only 2 to 3 m (6.5 to 10 ft) in length. Their reduced size is probably the result of the less than ideal environmental conditions, not genetics.[11]

Diet and eating behavior

The Nile crocodile possesses unique predation behavior characterized by the ability of preying both within its natural habitat (where it is the apex predator) and out of its normal range, which often results in unpredicted attacks on almost any other animal equal or smaller in size. In the water, where the only possible threat the Nile crocodile can meet are species of its own kind, as well as adult hippos, it is an agile and rapid hunter relying on both movement and pressure sensors to catch any prey unfortunate enough to present itself inside or near the waterfront.[12] Out of water, however, the Nile crocodile can only rely on its limbs (as it gallops on solid ground) to chase the prey.[13] Most hunting on land is done at night by lying in ambush near forest trails or roadsides, up to 50 m (170 feet) from the water edge.[14]

A drawing depicting the mythical relationship between plovers and crocodiles. No reliable observations exist of this purported symbiosis.

Young hatchlings generally feed on smaller prey, preferring insects and small aquatic invertebrates before taking on fish, amphibians and small reptiles. Juveniles and subadults take a wider variety of prey with additions such as birds and small to mid-sized mammals. Throughout its life, both young and mature crocodiles can feed on fish and other small vertebrates on separate occasions, when large food is absent, as a side diet. Adults are apex predators and prey upon various birds, reptiles and mammals in addition to prey consumed also by the young and juvenile specimens. Among the mammals, diet consists of gazelles, antelope, waterbuck, sitatunga, lechwe, wildebeest, zebra, warthog, young hippos, giraffe,[15] Cape buffalos,[15] young elephants, cheetah, and even big cats[16] such as leopards and lions. When given the chance, they are known to prey upon domestic animals like chickens, goats, sheep and cattle. Nile crocodiles also prey on humans frequently, far more often than other crocodilian species (although in parts of the Philippines and New Guinea saltwater crocodile attacks can also be common). This is due to the extensive use of Nile crocodile habitat by people who are unable to afford proper crocodile safety equipment.[citation needed] Although not common, crocodiles can also hunt in packs of five or more individuals while in the water, which can lead to the capture of much larger prey such as hippopotamus and even the Black Rhinoceros.[2]

Adult Nile crocodiles use their bodies and tail to herd groups of fish toward a bank, and eat them with quick sideways jerks of their heads. They also cooperate, blocking migrating fish by forming a semicircle across the river. The most dominant crocodile eats first. Their ability to lie concealed with most of their body underwater, combined with their speed over short distances, makes them effective opportunistic hunters of larger prey. They grab such prey in their powerful jaws, drag it into the water, and hold it underneath until it drowns. They will also scavenge kills, although they avoid rotting meat. Groups of Nile crocodiles may travel hundreds of metres from a waterway to feast on a carcass. Once their prey is dead, they rip off and swallow chunks of flesh. When groups of Nile crocodiles are sharing a kill, they use each other for leverage, biting down hard and then twisting their body to tear off large pieces of meat. This is called the death roll. They may also get the necessary leverage by lodging their prey under branches or stones, before rolling and ripping.

Herodotus claimed that Nile crocodiles have a symbiotic relationship with certain birds like the Egyptian plover, which enter the crocodile's mouth and pick leeches that have been feeding on the crocodile's blood, but there is no evidence of this interaction actually occurring in any crocodile species, and it is most likely mythical or allegorical fiction.[17]

Mating and breeding

A float of crocodiles at Disney's Animal Kingdom

For males, the onset of sexual maturity occurs when they are about 3 metres (10 ft) long while for females, it occurs when they reach 2 to 2.5 m (6.5 to 8 ft) in length. This takes about 10 years for either sex, under normal conditions.

During the mating season, males attract females by bellowing, slapping their snouts in the water, blowing water out of their noses, and making a variety of other noises. The larger males of a population tend to be more successful. Once a female has been attracted, the pair warble and rub the underside of their jaws together. Females lay their eggs about two months after mating.

Nesting is in November or December, which is the dry season in the north of Africa, and the rainy season in the south. Preferred nesting locations are sandy shores, dry stream beds, or riverbanks. The female then digs a hole a couple of metres from the bank and up to 500 mm (20 in) deep, and lays between 25 and 80 eggs. The number of eggs varies between different populations, but averages around 50. Multiple females may nest close together.

The eggs resemble hen eggs, but have a much thinner shell.

Unlike most other crocodilians, female Nile crocodiles will bury their eggs in sand rather than incubate them in rotting vegetation.[2] After burying the eggs, the female then guards them for the 3 month incubation period. The father-to-be will often stay nearby, and both parents will fiercely attack anything that approaches their eggs. The impending mother will only leave the nest if she needs to cool off (thermoregulation), by taking a quick dip or seeking out a patch of shade. Despite the attentive care of both parents, the nests are often raided by humans, monitor lizards, and other animals while the mother is temporarily absent.

The hatchlings start to make a high-pitched chirping noise before hatching, which is the signal for the mother to rip open the nest. Both the mother and father may pick up the eggs in their mouths, and roll them between their tongue and the upper palate of their mouth to help crack the shell, and release their offspring. Once they are hatched, the female may lead the hatchlings to water, or even carry them there, in her mouth.

Nile crocodile eggs

Nile crocodiles have Temperature-dependent sex determination (TSD), which means the sex of their hatchlings is determined not by genetics, but by the average temperature during the middle third of their incubation period. If the temperature inside the nest is below 31.7 °C (89.1 °F), or above 34.5 °C (94.1 °F), the offspring will be female. Males can only be born if the temperature is within that narrow 5-degree range.

Hatchlings are about 300 mm (12 in) long at birth, and grow that much each year. The new mother will protect her offspring for up to two years, and if there are multiple nests in the same area, the mothers may form a crèche. During this time, the mothers may pick up their offspring to protect them, either in their mouth or in her gular or throat pouch, to keep the babies safe. The mother will sometimes carry her young on her back to avoid them getting eaten by turtles or water snakes. At the end of the two years, the hatchlings will be about 1.2 m (4 ft) long, and will naturally depart the nest area, avoiding the territories of older and larger crocodiles.

Crocodile longevity is not well established, but larger species like the Nile crocodile live longer, and may have an average life span of 70–100 years.

Environmental status

From the 1940s to the 1960s, the Nile crocodile was hunted, primarily for high-quality leather, though also for meat and purported curative properties. The population was severely depleted, and the species faced extinction. National laws, and international trade regulations have resulted in a resurgence in many areas, and the species as a whole is no longer threatened with extinction. Crocodile 'protection programs' are artificial environments where crocodiles exist safely and without the threat of extermination from hunters.

There are an estimated 250,000 to 500,000 individuals in the wild. The Nile crocodile is also widely distributed, with strong, documented populations in many countries in east and southern Africa, including Somalia, Ethiopia, Kenya, Zambia and Zimbabwe. Successful sustainable-yield programs focused on ranching crocodiles for their skins have been successfully implemented in this area, and even countries with quotas are moving toward ranching. In 1993, 80,000 Nile crocodile skins were produced, the majority from ranches in Zimbabwe and South Africa.

The situation is more grim in central and west Africa, which make up about two-thirds of the Nile crocodile's habitat. The crocodile population in this area is much more sparse, and has not been adequately surveyed. While the natural population of Nile crocodiles in these areas may be lower due to a less-than-ideal environment and competition with sympatric slender-snouted and dwarf crocodiles, extirpation may be a serious threat in some of these areas. Additional factors are a loss of wetland habitats, and hunting in the 1970s. Additional ecological surveys and establishing management programs are necessary to resolve this.

The Nile crocodile is the top predator in its environment, and is responsible for checking the population of species like the barbel catfish, a predator that can overeat fish populations that other species, like birds, depend on. The Nile crocodile also consumes dead animals that would otherwise pollute the waters. The primary threat to Nile crocodiles, in turn, is humans. While illegal poaching is no longer a problem, they are threatened by pollution, hunting, and accidental entanglement in fishing nets.

Much of the hunting stems from their reputation as a man-eater, which is not entirely unjustified. Unlike other "man-eating" crocodiles, like the Saltwater Crocodile, the Nile crocodile lives in close proximity to human populations, so contact is more frequent. While there are no solid numbers, the Nile crocodile probably kills a couple of hundred people a year, which is more than all the other crocodiles combined.[18] Some estimates put the number of annual victims in the thousands.[10]

The IUCN Red List assesses the Nile crocodile as "Least Concern (LR/lc)".[1] The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) lists the Nile crocodile under Appendix I (threatened with extinction) in most of its range; and under Appendix II (not threatened, but trade must be controlled) in the remainder, which either allows ranching or sets an annual quota of skins taken from the wild.

Etymology

The binomial name Crocodylus niloticus is derived from the Greek kroko ("pebble"), deilos ("worm", or "man"), referring to its rough skin; and niloticus, meaning "from the Nile River". The Nile crocodile is called Timsah al-Nil in Arabic, Mamba in Swahili, Garwe in Shona, Ngwenya in Ndebele, Ngwena in Venda, Kwena in Sotho and Tswana.

See also

References

  1. ^ a b Crocodile Specialist Group (1996). "Crocodylus niloticus". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/46590. Retrieved 12 May 2006. 
  2. ^ a b c d e f Guggisberg, C.A.W. (1972). Crocodiles: Their Natural History, Folklore, and Conservation. p. 195. ISBN 0715352725. 
  3. ^ de Smet, Klaas (January 1998). "Status of the Nile crocodile in the Sahara desert". Hydrobiologia (SpringerLink) 391 (1-3): 81–86. doi:10.1023/A:1003592123079. http://www.springerlink.com/content/j2t203v572628126/. Retrieved 7 June 2010. "Another relict population [of Nile crocodiles], in the Tagant hills of Mauretania, was found to be probably extinct in 1996." 
  4. ^ National Geographic documentary; "Bite Force", Brady Barr.
  5. ^ "Videos on Hal Brindley .com: Leopard Vs. Crocodile. A Leopard attacks and kills a Crocodile in South Africa". Halbrindley.com. http://www.halbrindley.com/videos/pages/leopard.html. Retrieved 2010-03-16. 
  6. ^ "Crocodilian Species - Nile Crocodile (Crocodylus niloticus)". Flmnh.ufl.edu. http://www.flmnh.ufl.edu/cnhc/csp_cnil.htm. Retrieved 2010-03-16. 
  7. ^ Somma, Louis A. (June 19, 2002). Crocodylus niloticus Laurenti, 1768. USGS Nonindigenous Aquatic Species Database. Retrieved July 14, 2006 from the USGS.
  8. ^ "Nile crocodile: Definition from". Answers.com. http://www.answers.com/topic/nile-crocodile. Retrieved 2010-03-16. 
  9. ^ "Nile Crocodile". National Geographic. http://animals.nationalgeographic.com/animals/reptiles/nile-crocodile.html. Retrieved 2011-04-03. 
  10. ^ a b Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0851122359
  11. ^ "Desert-Adapted Crocs Found in Africa", National Geographic News, June 18, 2002
  12. ^ "Nile Crocodile: Photos, Video, E-card, Map - National Geographic Kids". Kids.nationalgeographic.com. 2002-10-17. http://kids.nationalgeographic.com/Animals/CreatureFeature/Nile-crocodile. Retrieved 2010-03-16. 
  13. ^ "Nile Crocodile - Crocodylus niloticus". Angelfire.com. http://www.angelfire.com/mo2/animals1/crocodile/nile.html. Retrieved 2010-03-16. 
  14. ^ Dinets, V.L. (2011). "On terrestrial hunting in crocodilians". Herpetological Bulletin 114 pp.: 15–18. 
  15. ^ a b [1]
  16. ^ [2]
  17. ^ http://crocodilian.blogspot.com/2009/09/crocodile-myths-1-curious-trochilus.html
  18. ^ "Crocodile Attack in Australia: An Analysis of Its Incidence and Review of the Pathology and Management of Crocodilian Attacks in General". Wemjournal.org. http://www.wemjournal.org/wmsonline/?request=get-document&issn=1080-6032&volume=016&issue=03&page=0143. Retrieved 2010-03-16. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!