Overview

Brief Summary

Biology

Adults feed mainly on fish but may also eat amphibians, reptiles and small mammals (2). Very little else is known about the natural history of this species in the wild, but females do appear to build mound-nests constructed from scraped-up plant debris mixed with mud (3). In captivity, these crocodiles breed during the wet season (April to May), laying between 20 - 50 eggs which are then guarded until they hatch (4). After incubation, the female will assist her young as they break out of their eggs and then carry the hatchlings to the water in her jaws (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The Siamese crocodile is a small, freshwater crocodilian (a group that also includes alligators, caimans and the gharial), with a relatively broad, smooth snout and an elevated bony crest behind each eye (3). It is one of the most endangered crocodiles in the wild, although it is extensively bred in captivity (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Crocodylus siamensis historically occurred over much of mainland Southeast Asia as well as parts of Indonesia. Its current distribution is greatly diminished and fragmented. Extant populations are in Cambodia, Indonesia, Lao PDR, Thailand and Viet Nam. In Viet Nam, wild populations are possibly extirpated, the first range nation where this has occurred, although a reintroduction programme has been implemented in one site (see below). Most locations occur between 50 and 200 m elevation but localities in Cambodia at Veal Ven Marsh (560 m; Daltry et al. 2003) and the upper Tatai River (730 m; B. Simpson pers. comm.) are higher. Summaries of national distribution are as follows.

Cambodia: Field surveys conducted since 2000; confirmed C. siamensis localities are from 35 sites in 21 river systems of 11 provinces, mainly in remote parts of southwest and northeast Cambodia (Daltry and Chheang 2000; Daltry et al. 2003; Platt et al. 2004, 2006; Simpson and Han 2004; Simpson et al. 2006a; Timmins 2007; Bezuijen et al. 2009). The largest remnant populations are in the Srepok, Sekong, Sre Ambel/Kampong Saom, Pursat, Koi, Kep, Tatai and Areng Rivers and Veal Veng Marsh.

Indonesia: Mesangat Lake in the Mahakam River system, East Kalimantan Province (Borneo), supports the only known extant population outside mainland Southeast Asia (Cox et al. 1993, Cox 2004, Ross et al. 1998; Kurniati et al. 2005). Research in 2010-2011 by N. Behler confirmed the persistence of this population. Unconfirmed local reports of C. siamensis are from Central Kalimantan Province (Ross et al. 1998). Museum specimens indicate the species historically occurred in Java (Ross 1990, 1992) but given the severe loss of wetland habitats there, it is unlikely any populations remain.

Lao PDR: Field surveys conducted between 2003 and 2008; confirmed C. siamensis localities are from nine river systems in five provinces, but extant populations are known from only seven river systems in four provinces (Bezuijen et al. in press). Surveys confirmed previous reports (Salter 1993, Sawathvong 1994) that many local populations are now extirpated. Extant populations are in the Xe Champhone, Xe Banghiang, Xe Bangfai and Xe Xangxoy river systems (Savannakhet Province), Xe Pian-Xe Khampho river systems (Attapu Province), Xe Don River (Salavan Province) and Phou Khaokhouay National Protected Area (Bolikhamxay Province) (Bezuijen et al. in press). Most wetlands in Lao PDR remain unsurveyed for crocodiles and it seems likely that other C. siamensis localities will be documented.

Malaysia: A single reference to a ‘fresh-water crocodile’ in northern Peninsular Malaysia (Robinson and Annandale 1904 cited by Smith 1919) was considered by Smith (1919) to be ‘probably referable to this species’. There are no known records from Sarawak or Sabah (Sebastian 1993). There is no other information to suggest that C. siamensis occurred in Malaysia.

Myanmar: One record of crocodiles and eggs, from the Mekong River (Garnier 1885 - see Garnier 1996); no other known records, although most wetlands in Myanmar remain unsurveyed for crocodiles (Thorbjarnarson et al. 2006). The section of the Mekong in Myanmar (~200 km long) is currently under restricted access and off-limits to international surveys. Google satellite imagery indicates that much of it retains riverine forest and low human densities: it is possible that some crocodiles may persist (Bezuijen et al. in press).

Thailand: Historically common and widely distributed (Smith 1919, Platt et al. 2002); extant populations are in a small number of scattered localities in central and western Thailand (Kreetiyutanont 1993, Ratanakorn et al. 1994, Platt et al. 2002, Temsiripong 2003). Confirmed sites include Pang Sida and Kaengkrachan National Parks (Platt et al. 2002, Temsiripong 2003).

Viet Nam: Historically present in southern Viet Nam (Cuc 1994, Cao and Jenkins 1998); wild populations possibly extirpated. Surveys over the past two decades have failed to detect crocodiles in sites they were reported to occur (Platt and Tri 2000, Stuart et al. 2002) except one site, Ha Lam Lake (Phu Yen Province), where at least two individuals were present in 2005 (Nguyen et al. 2005). A single reintroduced population is at Cat Tien National Park (Polet 2006, Murphy et al. 2004), where breeding occurs (J. Thorbjarnarson in litt. July 2009, Pahl 2012).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Asia
Distribution: Cambodia, Indonesia (including Borneo and possibly Java), Laos,  Malaysia, Thailand, Vietnam, Brunei, Myanmar (= Burma).  
Type locality: "Siam" (=Thailand).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Southeast Asia, Malay Peninsula

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Previously found throughout South East Asia but now extinct, or nearly extinct, from most countries except Cambodia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Crocodylus siamensis occurs in a wide range of lowland freshwater habitats, including slow-moving rivers and streams, lakes, seasonal oxbow lakes, marshes and swamps (Smith 1931; Daltry et al. 2003; Platt et al. 2002, 2006; Bezuijen et al. in press). During the wet season, individuals disperse across flooded landscapes (one radio-tracked individual in Cambodia moved up to 25 km before returning to a dry season site; Simpson et al. 2006b). The species has been recorded up to 600 m elevation (Daltry et al. 2003).


Crocodylus siamensis is a medium-sized species, with most individuals attaining a total length of less than 3.5 m (Smith 1919). Nesting ecology is poorly documented and fewer than a few dozen wild nests have been located to date. Wild nests recorded in Cambodia, Lao PDR and Thailand were mounds located on floating vegetation mats or on the banks of lakes or rivers (Platt et al. 2006, Simpson et al. 2006a, Starr et al. 2010, Bezuijen et al. in press). Nesting occurs in the late dry season and and wet season. Clutch size observed in wild nests ranged from 11-26 eggs (Simpson and Han 2004, Starr et al. 2010, Bezuijen et al. in press). Captive C. siamensis produce clutches of 6-50 eggs (Youngprapakorn et al. 1971, Platt et al. 2011). Hatchlings emerge in the wet season after 70-80 days incubation (Brazaitis and Watanbe 1983, Platt et al. 2011, Bezuijen et al. in press). Fidelity to nesting sites has been recorded (Simpson et al. 2006a).

Similar to many other crocodilians, C. siamensis feeds on a wide variety of prey such as invertebrates, frogs, reptiles, birds and mammals, including carrion (Daltry et al. 2003, Bezuijen 2010).

Other scientific studies of C. siamensis have included information on phylogeography and population genetics (Gratten 2003), seasonal sperm cycles (Kitiyanant et al. 1994) and the antimicrobial properties of its blood (Merchant et al. 2006). Hybridization of captive C. siamensis with C. rhombifer and C. porosus occurs (Chavananikul et al. 1994, Thang 1994), and the chromosome number of C. siamensis and hybrids, as well as DNA methods to distinguish them, has been identified (Youngprapakorn 1991, Fitzsimmons et al. 2002, Srikulnath et al. 2012).

..

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Siamese crocodile occurs along rainforest rivers and in adjacent swamps or lagoons (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 21.9 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Crocodylus siamensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTATTTTCCACTAACCACAAAGATATCGGCACCTTATATTTTATTTTCGGCGCCTGAGCTGGAATAGTAGGCACAGCCATAAGCCTATTAATTCGGACAGAGCTCAGCCAGCCTGGTCCATTCATAGGGGAT---GACCAAATTTATAATGTCATTGTCACAGCACATGCCTTTATCATAATTTTCTTTATAGTTATACCGATCATGATCGGCGGATTTGGAAATTGGCTACTCCCACTAATAATCGGAGCACCCGACATAGCATTTCCACGCATAAACAACATAAGCTTCTGACTGCTACCCCCATCATTTACCCTACTTCTCTCCTCAGCCTTTATTGAAACTGGAGCTGGCACCGGATGAACAGTCTACCCGCCCCTAGCTGGAAACCTAGCCCACGCCGGACCATCAGTAGACTTGACCATCTTCTCCCTCCACCTTGCTGGAGTATCATCCATTCTTGGAGCAATTAACTTTATTACCACGGCCATTAATATGAAACCCCCAGCAATATCACAACAACAGACGCCTCTTTTCGTATGGTCTATTCTAGTTACAGCCGTTCTCCTACTGCTCTCACTACCAGTCCTAGCTGCAGGAATTACCATATTACTCACTGATCGAAACCTGAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTATACCAACACCTTTTCTGATTCTTTGGCCACCCAGAAGTATACATCCTCATCCTACCAGGGTTTGGAATAATCTCCCATGTAATCACCTTCTACTCAAGTAAAAAAGAACCATTTGGCTACATAGGAATAGTCTGAGCCATGATATCAATCGGCTTTCTCGGATTCATCGTCTGAGCCCACCACATATTTACAGTAGGAATAGACGTTGACACCCGAGCATACTTCACATCCGCCACAATAATTATCGCCATCCCCACCGGCGTAAAAGTGTTCAGCTGATTAGCCACTATTTACGGAGGA---GTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Crocodylus siamensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd

Version
3.1

Year Assessed
2012

Assessor/s
Bezuijen, M., Simpson, B., Behler, N., Daltry, J. & Tempsiripong, Y.

Reviewer/s
Manolis, C. & Stuebing, R.

Contributor/s

Justification

Crocodylus siamensis is among the most threatened crocodilians. In 1992 it was reported as virtually extinct in the wild (Thorbjarnarson 1992) and in 1996 was accorded the IUCN Red List status of ‘Critically Endangered' (Baillie and Groombridge 1996). This status remains unchanged. Field surveys, nearly all conducted since 2000, have confirmed that extant populations persist, but that all are severely diminished and fragmented. Over the past decade new information on the ecology of the species has been documented, although C. siamensis remains one of the least known crocodilians. Commercial hunting for the skin trade and collection of live animals to stock crocodile farms, in the mid- and late-twentieth century respectively, are considered to be the principal causes for its decline. Current threats include illegal collection of eggs, juveniles and adults, habitat loss, incidental capture with fishing gear, and the inherent vulnerability of remnant populations due to their small size.

This species qualifies as Critically Endangered. Global populations have been severely reduced, almost certainly by over 80% in the past 75 years / three generations (assuming a generation time of 25 years), principally due to hunting. All remnant subpopulations are small and fragmented. Most current threats, including illegal collection and habitat loss or degradation, are ongoing, suggesting that without conservation interventions, extant populations will continue to decline.

History
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/14/1976
Lead Region: Foreign (Region 10) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Crocodylus siamensis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Critically Endangered (CR - A1ac) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

No global population estimate is available for C. siamensis and national population estimates are available for only one range state, Cambodia. Between 100 and 300 wild adults may remain in Cambodia, based on footprints and other evidence (Simpson and Han 2006a, Simpson and Bezuijen 2010 and references therein). Lao PDR may support a similar number of adults (Bezuijen et al. in press). The largest known population at any single site is 55-60 individuals, in Cambodia (Starr et al. 2010), but in both nations most known sites support only one or several individuals. In Thailand, one to several individuals persist in a small number of scattered localities, and nests are sometimes documented (Platt et al. 2002, J. Thorbjarnarson in litt. cited in Bezuijen et al. in press). In Viet Nam, the species may have been extirpated from the wild but a reintroduced population based on 60 individuals released between 2001-2004 at Cat Tien National Park had an estimated population of 100-150 individuals in 2010-2011. A maximum of 80 non-hatchlings was observed and 10-15 adults estimated (Pahl 2012). At Mesangat Lake in East Kalimantan, Indonesia, mark-recapture surveys in 2010-2011 indicated that fewer than 30 individuals may be present, although nearby areas remain unsurveyed (N. Behler unpubl. data).

Wild nests and successful recruitment (i.e. presence of hatchlings) have been documented in all range states, but in low numbers. In Cambodia, nesting has been recorded at 10 localities in eight provinces since 2001, but the number of nest sites is declining and only one to three nests are documented annually (Simpson et al. 2006a). Veal Veng Marsh and the Areng River, both in the Cardamom Mountains, hold the largest wild populations, and each produces one to three nests annually (J.C. Daltry unpubl. data). In Lao PDR, nesting has been documented at eight localities but successful recruitment was confirmed at only five sites (Bezuijen et al. in press). Of four clutches examined in Lao PDR, three were infertile (Bezuijen et al. in press), indicating low female fertility and/or the absence of males. In Thailand, fewer than five wild nests and few hatchlings have been recorded over the past five years, suggesting low clutch fertility (J. Thorbjarnarson in litt. cited by Bezuijen et al. in press; Y. Temsiripong unpubl. data). In Viet Nam, hatchlings observed at Cat Tien National Park in 2010-2011 confirm that breeding persists there (Pahl 2012). At Lake Mesangat in Indonesia, juvenile crocodiles have been observed and one nest has been located (N. Behler unpubl. data).

On the basis of these limited data, the global wild population of C. siamensis may comprise fewer than 1,000 mature individuals.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Commercial hunting in the mid-twentieth century for the skin trade is considered to be the principal cause for the historical decline of C. siamensis. Current and ongoing threats in virtually all range states include the illegal collection of eggs and crocodiles, habitat loss and degradation, and incidental capture/drowning in fishing gear. In Cambodia, most river systems with extant C. siamensis are targeted for large-scale hydroelectric dams. Construction of some of these dams has already begun and has resulted in the loss of breeding habitat and increased collection and killing of crocodiles (J.C. Daltry unpubl. data). Illegal capture of wild crocodiles to supply local crocodile farms continues in Cambodia. In Viet Nam, over 19 crocodiles were apparently poached at Cat Tien National Park between 2001 and 2012, mainly for local consumption (Murphy et al. 2004, Pahl 2012).

Potential threats in some or all range states include climate change, the potential hybridization of wild populations due to inter-breeding with escaped hybrids, and the risk of genetic depression due to severely low numbers (Jelden et al. 2005, 2008; Bezuijen et al. in press). Viet Nam appears to be the first range state where wild C. siamensis has been extirpated; in 2006, the last known site to support wild C. siamensis (Ha Lam Lake in Phu Yen Province; Nguyen et al. 2005) was flooded for construction of a hydroelectric dam. At Mesangat Lake in Indonesia, key threats to C. siamensis are the incidental capture of crocodiles in fishing gear and disturbance due to electro-fishing activities (N. Behler unpubl. data).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Siamese crocodiles are under threat from human disturbance and habitat occupation, which is forcing remaining populations to the edges of their former range (4). The conversion of rainforest habitat to agricultural use along with aggressive hunting for crocodile skins, have contributed to the decline of this species of crocodile (4). In Cambodia, which is the species' last remaining stronghold, incursion into pristine habitat is now occurring through aid development programs, and the hunting of adult females for crocodile farm stock is reported to be widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Most conservation efforts for C. siamensis were initiated in the past decade and are relatively recent. More conservation work for the species has been conducted in Cambodia than any other range state, including extensive status surveys and a long-term programme by the Government of Cambodia’s Forestry Administration and Fauna & Flora International. This programme has achieved the monitoring and protection of breeding sites, training of ranger patrols, and community-based conservation initiatives (Daltry et al. 2006, Simpson and Ratanapich 2007, Simpson et al. 2006a). Veal Veng Marsh, the Areng River, and the Sre Ambel/ Kampong Saom River are the focus of enforcement patrols and community-based conservation management, which have demonstrated success in reducing poaching since 2001 (Daltry et al. 2006, Simpson and Ratanapich 2007, Simpson et al. 2006a, Oum et al. 2010). Additional community sanctuaries are planned in northeast Cambodia and a national re-introduction program will be launched in 2012 (Daltry and Starr 2010, Siamese Crocodile Task Force in prep.).

Elsewhere, status surveys were conducted in Lao PDR between 2003 and 2008, conservation priorities were identified (Bezuijen et al. in press) and a management plan to protect breeding sites was prepared for one province (Cox and Somvongsa 2008). Community workshops were held in 2006 and 2007 to document local knowledge of crocodiles (Bezuijen et al. 2006, Mollot et al. 2007). Most C. siamensis localities in Lao PDR are outside the national protected area system and conservation will rely on community-based approaches. In Thailand, a re-introduction programme was initiated by the Royal Thai Forest Service and Crocodile Management Association of Thailand, with 20 crocodiles released in Pang Sida National Park in 2005 and 2006 (Temsiripong 2001, 2007). Few crocodiles were detected during subsequent monitoring (Temsiripong 2007) and further releases are being considered. Severe flooding in Thailand in 2011 hindered the implementation of some re-introduction plans (Y. Temsiripong pers. obs.). In Viet Nam, 60 captive individuals were released in Cat Tien National Park between 2001 and 2004 (Polet 2006) and the population has been irregularly monitored since then. The most recent surveys (2010-2011) confirmed that the population has increased in size, but that crocodiles continue to be hunted by local residents (Pahl 2012). In Indonesia, Mesangat Lake is owned by an oil palm company, and in 2010 the company entered into a partnership with a local foundation, Yayasan Ulin, to jointly manage habitats at the lake (R. Stuebing in litt.).

The large captive populations of C. siamensis held on farms (see Use and Trade) represent a potential source for re-introduction programs, and farms in Thailand and Viet Nam have donated C. siamensis for this purpose. Genetically pure C. siamensis have been found in captive holdings in Cambodia (Starr et al. 2009), Thailand (Srikulnath et al. 2012) and Viet Nam (Fitzsimmons et al. 2002).

At the invitation of range states, the IUCN SSC Crocodile Specialist Group has conducted reviews and recommendations for the trade and management of captive C. siamensis and other crocodilians, in Cambodia (Jelden et al. 2005), Indonesia (Webb and Jenkins 1991a), Thailand (Webb and Jenkins 1991b) and Viet Nam (Jelden et al. 2008).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Until recently, very little data existed on Siamese crocodile numbers and distribution, a factor which led to the species being reported as virtually extinct in the wild in 1992 (4). Since then a large amount of research has been conducted and this has shown a slightly more encouraging picture, although the status is still hard to judge. Siamese crocodiles appear to be mainly found in Cambodia where updated estimates suggest a population of no greater than 5000 individuals (2), though it may be considerably less (4). However, the species is extensively maintained and bred in captivity, in both Thailand and Cambodia, where it is farmed for the commercial value of its skins (2). The species is considered relatively inoffensive to humans, making restocking programmes a distinct possibility provided sufficient habitat is maintained and protected. Local people have been reported to protect crocodiles, which they view to be sacred (2). Programs are already underway in Thailand (2) and, although the future of the Siamese crocodile remains in the balance, there is more optimism than a decade ago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Siamese crocodile

Siamese crocodile (Crocodylus siamensis) is a freshwater crocodile native to Indonesia (Borneo and possibly Java), Brunei, East Malaysia, Laos, Cambodia, Burma, Thailand, and Vietnam. The species is critically endangered and already extirpated from many regions. Its other common names include: Siamese freshwater crocodile, Singapore small-grain, cocodrilo de Siam, crocodile du Siam, buaja, buaya kodok, jara kaenumchued, and soft-belly.[2]

Characteristics[edit]

The Siamese crocodile is a small, freshwater crocodilian, with a relatively broad, smooth snout and an elevated, bony crest behind each eye. Overall, it is an olive-green colour, with some variation to dark-green.[3] Young specimens measure 1.2–1.5 m (3.9–4.9 ft) and weigh 6–12 kg (13–26 lb), growing up to 2.1 m (6.9 ft) and a weight of 40–70 kg (88–154 lb) as an adult.[4][5][6] The largest female specimens can measure 3.2 m (10 ft) and weight 150 kg (330 lb)[7] Large male specimens can reach 4 m (13 ft) and 350 kg (770 lb) in weight.[8] Most adults do not exceed 3 m (10 ft) in length, although hybrids in captivity can grow much larger.

Siamese Crocodile-Biblical Zoo

Distribution and habitat[edit]

The historic range of the Siamese crocodile included most of Southeast Asia. This species is now extinct in the wild or nearly extinct from most countries except Cambodia.[2] Formerly it was found in Cambodia, Indonesia (Borneo and possibly Java), Laos, Malaysia, Thailand, Vietnam, Brunei, and Burma.[9]

Siamese crocodiles occur in a wide range of freshwater habitats, including slow-moving rivers and streams, lakes, seasonal oxbow lakes, marshes and swamplands.[10]

Biology and behaviour[edit]

Siamese crocodile sleeping with its mouth open to release heat

Despite conservation concerns, many aspects of C. siamensis life history in the wild remain unknown, particularly regarding its reproductive biology.[10]

Adults feed mainly on fish, but also eat amphibians, reptiles and small mammals.[2]

Very little is known about the natural history of this species in the wild, but females do appear to build mound-nests constructed from scraped-up plant debris mixed with mud.[3] In captivity, these crocodiles breed during the wet season (April to May), laying between 20 and 50 eggs, which are then guarded until they hatch.[11] After incubation, the female will assist her young as they break out of their eggs and then carry the hatchlings to the water in her jaws.[12]

Pure, unhybridised examples of this species are generally unaggressive towards humans, and unprovoked attacks are unknown.[13]

Conservation status and threats[edit]

This crocodile is classified as critically endangered on the IUCN Red List,[14] and is listed on Appendix I of CITES.

It is one of the most endangered crocodiles in the wild, although it is extensively bred in captivity.[11]

Threats[edit]

Siamese crocodiles are under threat from human disturbance and habitat occupation, which is forcing remaining populations to the edges of their former range.[11] Extinct from 99% of its original range, the Siamese crocodile is considered one of the least studied and most critically endangered crocodilians in the world.[10] Although few wild populations remain, more than 700,000 C. siamensis are held on commercial crocodile farms in Southeast Asia.[10]

In 1992, it was believed to be extremely close to or fully extinct in the wild until in 2000 National Geographic's resident herpetologist Dr. Brady Barr, caught one while filming in Cambodia. Since then, a number of surveys have confirmed the presence of a tiny population in Thailand (possibly numbering as few as two individuals, discounting recent reintroductions), a small population in Vietnam (possibly less than 100 individuals), and more sizeable populations in Burma, Laos and Cambodia. In March 2005, conservationists found a nest containing juvenile Siamese crocodiles in the southern Lao province of Savannakhet. There are no recent records from Malaysia or Brunei. A significant population of the crocodiles is known to be living in East Kalimantan, Indonesia.

Habitat degradation[edit]

Factors causing loss of habitat include: conversion of wetlands for agriculture, chemical fertilisers use, use of pesticides in rice production, and an increase in the population of cattle.[15] The effects of warfare stemming from the conflicts in Vietnam, Laos, and Cambodia during the Vietnam War (from land mines to aerial bombardment) have also been factored.

Many river systems, including those in protected areas, have hydroelectric power dams approved or proposed, which are likely to cause the loss of about half of the remaining breeding colonies within the next ten years.[10] One cause for habitat degradation via hydrological changes, for the Siamese crocodile, is the implementation of dams on the upper Mekong River and its major tributaries.[16] Potential impacts of dam construction include wetland loss and altered flooding cycle with a dry season flow 50% greater than under natural conditions.[17]

Exploitation and fragmentation[edit]

Illegal capture of wild crocodiles for supply to farms is an ongoing threat, as well as incidental capture/drowning in fishing nets and traps.[10] C. siamensis currently has extremely low and fragmented remaining populations with little proven reproduction in the wild.

Siamese crocodiles have historically been captured for skins and to stock commercial crocodile farms. In 1945, skin hunting for commercial farms was banned by the French colonial administration of Cambodia.[18] In the late 1940s, populations spurred the development of farms and harvesting wild crocodiles for stocking these farms.[19] Protection was abolished by the Khmer Rouge (1975–79) but later reinstated under Article 18 of the Fishery Law of 1987, which "forbids the catching, selling, and transportation of...[wild] crocodiles..."[18]

Crocodile farming now has a huge economic impact in the provinces surrounding Tonle Sap, where 396 farms held over 20,000 crocodiles in 1998.[18] Also, many crocodiles were exported from Cambodia since the mid-1980s to stock commercial farms in Thailand, Vietnam, and China.[20]

Despite legal protection, a profitable market exists for the capture and sale of crocodiles to farms since the early 1980s.[20] This chronic overharvesting has led to the decline of the wild Siamese crocodile.

Conservation and management[edit]

The current situation of C. siamensis represents a significant improvement from the status reported in the 1992 Action Plan (effectively extinct in the wild), but poses major new challenges for quantitative survey and effective conservation action if the species is to survive. While the species remains critically endangered, there is a sufficient residual wild population, dispersed among many areas and countries, to provide a basis for recovery. If the pressures which have caused the virtual disappearance of this species in Thailand, Malaysia and Indonesia can be controlled or reversed, then the species is likely to survive.

The Siamese crocodile is relatively unthreatening to people (compared to C. porosus), and the possibility of people and crocodiles coexisting in natural settings seems possible. The powerful economic force of the commercial industry based on C. siamensis also needs to be mobilised and channelled for conservation advantage. Considerable effort and action is still required, but the species has a reasonable chance of survival if the necessary actions can be implemented.

Yayasan Ulin (The Ironwood Foundation) is running a small project to conserve an important wetland habitat in the area of East Kalimantan which is known to contain the crocodiles.[21] Most of them, though, live in Cambodia, where isolated, small groups are present in several remote areas of the Cardamom Mountains, in the southwest of the country, and also in the Vireakchey National Park, in the northeast of the country.

Fauna and Flora International is running a programme in the district of Thmo Bang, Koh Kong province, where villagers are financially encouraged to safeguard known crocodile nests. The Araeng River is considered to have the healthiest population of Siamese crocodiles in the world, although this may soon change after the completion of a massive dam in the river. Fauna and Flora international, in collaboration with several Cambodian government departments, is planning on capturing as many crocodiles as possible from this river and reintroducing them in another, ecologically suitable area, before the completion of the dam and the subsequent flooding of the whole area effectively renders their current habitat unsuitable. During the heavy monsoon period of June–November, Siamese crocodiles take advantage of the increase in water levels to move out of the river and onto large lakes and other local bodies of water, returning to their original habitat once water levels start receding back to their usual levels. A smaller population also is thought to exist in the Ta Tay River, and in the district of Thmo Bang.

Poaching is a severe threat to the remaining wild population in the area, with the value of small specimens reaching hundreds of dollars in the black market, where they are normally taken into crocodile farms and mixed with other, larger species.[22] The total wild population is unknown, since most groups are in isolated areas where access is extremely complicated. A number of captively held individuals are the result of hybridization with the saltwater crocodile, but several thousand "pure" individuals do exist in captivity, and are regularly bred at crocodile farms, especially in Thailand.

Bang Sida National Park in Thailand, near Cambodia, has a project to reintroduce Siamese crocodile into the wild. A number of young crocodiles have been released into a small and remote river in the park, not accessible to visitors.

The Phnom Tamao Wildlife Rescue Centre in Cambodia conducted DNA analysis of 69 crocodiles in 2009, and found 35 of them were purebred C. siamensis. Conservationists from Fauna and Flora International and Wildlife Alliance plan to use these to launch a conservation breeding program in partnership with the Cambodian Forestry Administration.

The Wildlife Conservation Society (WCS) is working with the government of Lao PDR on a new programme to save this critically endangered crocodile and its wetland habitat. In August, 2011, a press release announced the successful hatching of a clutch of 20 Siamese crocodiles. These eggs were then incubated at the Laos Zoo. This project represents a new effort by WCS to conserve the biodiversity and habitat of Laos’ Savannakhet Province, promotes conservation of biodiversity for the whole landscape, and relies on community involvement from local residents.[23]

Priority projects[edit]

High priority projects include:[24]

  • Status surveys and development of crocodile management and conservation programmes in Cambodia and Lao PDR: These two countries appear to be the remaining stronghold of the species. Identifying key areas and populations, and obtaining quantitative estimates of population size as a precursor to initiating conservation programs is needed.
  • Implementation of protection of habitat and restocking in Thailand: Thailand has the best-organized protected-areas system, the largest source of farm-raised crocodiles for restocking, and the most-developed crocodile management programme in the region. Although the species has virtually disappeared from the wild, re-establishment of viable populations in protected areas is feasible.
  • Protection of crocodile populations in Vietnam: A combination of habitat protection and captive breeding could prevent the complete loss of the species in Vietnam. Surveys, identification of suitable localities and the implementation of a conservation programme coordinated with the captive breeding efforts of Vietnamese institutions is needed.
  • Investigation of the taxonomy of the freshwater crocodiles in Southeast Asia and the Indo-Malaysian Archipelago: The relationships among the freshwater crocodiles in the Indo-Malaysian Archipelago are poorly understood. Clarification of these relationships is of scientific interest and has important implications for conservation.

Other projects include:

  • Coordination of captive breeding, trade and conservation in the South east Asian region: Several countries in the region are already deeply involved in captive breeding programs for commercial use. Integration of this activity with necessary conservation actions for the wild populations (including funding surveys and conservation) could be a powerful force for conservation. A long term aim could be the re-establishment of viable wild populations and their sustainable use by ranching.
  • Maintain a stock of pure C. siamensis in crocodile farms: The bulk of the captives worldwide are maintained in several farms in Thailand where extensive interbreeding with C. porosus has taken place. Hybrids are preferred for their superior commercial qualities, but the hybridisation threatens the genetic integrity of the most threatened species of crocodilians. Farms should be encouraged to segregate genetically pure Siamese crocodiles for conservation, in addition to the hybrids they are promoting for hide production.
  • Survey and protection of Siamese crocodiles in Indonesia: Verification of the presence of C. siamensis in Kalimantan and Java is a first step to developing protection for the species within the context of the developing crocodile management strategy in Indonesia.

In Pop Culture[edit]

A Siamese crocodile stars as the titular monster in the 1978 Thailand film Crocodile.

References[edit]

  1. ^ Bezuijen, M., Simpson, B., Behler, N., Daltry, J. & Tempsiripong, Y. (2012). "Crocodylus siamensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 20 May 2014.  Listed as Critically Endangered (CR A2cd v3.1)
  2. ^ a b c Crocodilian Species List: (January 2009). "Crocodylus siamensis". 
  3. ^ a b Steel, Rodney (1989). Crocodiles. London. 
  4. ^ Experimental inoculation of broad-nosed caimans (Caiman latirostris) and Siamese crocodiles (Crocodylus siamensis) with Mycoplasma alligatoris
  5. ^ Adjuntament de Barcelona - Crocodile
  6. ^ Renegade reptiles by Tom Lee
  7. ^ [1]
  8. ^ [2]
  9. ^ Britton, A. "Crocodylus Siamensis (Schneider, 1801)". Retrieved 2011-11-29. 
  10. ^ a b c d e f Simpson, Boyd; Bezuijen (2010). "Siamese Crocodile Crocodylus Siamensis". Crocodiles. Third Edition. Retrieved 2011-11-29. 
  11. ^ a b c Ross, R.P. "Crocodiles: Status Survey and Conservation Action Plan. Second Edition.". Retrieved 2011-11-29. 
  12. ^ Alderton, D. (1991). Crocodiles and Alligators of the World. Blandford, London. 
  13. ^ Cox, M.J. van Dijk, P.P, Nabhitabhata, J and Thirakhupt, K. (2009) A photographic guide to Snakes and other reptiles of Thailand and South-East Asia. Asia Books Co. Ltd. Bangkok
  14. ^ IUCN Red List (November 2011). "Crocodylus Siamensis". IUCN. Retrieved 2011-11-29. 
  15. ^ Phiapalath, Phaivanh; Voladet, Hicks. "Wetland Priority Sites in Lao PDR - the top five priority sites". IUCN (Climate Change Impact and Vulnerability Assessment for the Wetlands of the Lower Mekong Basin for Adaptation Planning). Retrieved 2011-11-29. 
  16. ^ Hogan, Z.S.; Moyle, May, Vander Zanden, Baird (2004). "The imperiled giants of the Mekong". American Scientist 92: 228–237. doi:10.1511/2004.3.228. 
  17. ^ Lamberts, D (2001). "Tonle Sap fisheries: A Case Study on Floodplain Gillnet Fisheries in Siem Reap Cambodia.". RAP Publication (Bangkok: FAO REgional Office for Asia and the Pacific). 
  18. ^ a b c Thuok; Tana (1994). "Country report on crocodile conservation in Cambodia.". Crocodiles: Proceedings of the 12th meeting of the Crocodile Specialist Group. IUCN Publications: 3–15. 
  19. ^ Kimura, W (1969). Crocodiles in Cambodia, Research Report No. 3 Atawgawa Tropical Garden and Alligator Farm. 
  20. ^ a b Thorbjarnarson, J (2001). herpetology trip report: Cambodia. Report to Wildlife Conservation Society. 
  21. ^ http://www.speciesconservation.org/projects/Siamese-Crocodile/309
  22. ^ Associated Press:Endangered crocodiles hatched in Cambodia
  23. ^ "WCS Helps Hatch Rare Siamese Crocodiles in Lao PDR". Retrieved 2011-12-01. 
  24. ^ Ross, James. "Crocodiles: Status Survey and conservation Action Plan. Second Edition. IUCN/SSC Crocodile Specilalist Group". Retrieved 2011-11-29. 

Other Sources[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!