Overview

Distribution

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) The range extends from southern New Jersey, Maryland, and Kentucky southward to southeastern Louisiana, southern Mississippi, southern Alabama, and southern Florida (Conant and Collins 1991, Burbrink 2002). Introduced on Grand Cayman Island and Grand Bahama Island (Buckner and Franz, 1994, Herpetol. Rev. 25:166) and elsewhere in the Caribbean region (e.g., may be established on St. Thomas, U.S. Virgin Islands; Perry et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

This species is endemic to eastern and southeastern United States. Its range extends from southern New Jersey, Maryland, and Kentucky southward to southeastern Louisiana, southern Mississippi, southern Alabama, and southern Florida (Conant and Collins 1991, Burbrink 2002). Introduced on Grand Cayman Island and Grand Bahama Island (Buckner and Franz, 1994, Herpetological Review 25: 166) and elsewhere in the Caribbean region (e.g., may be established on St. Thomas, U.S. Virgin Islands; Perry et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Corn snakes may be found in the eastern United States from southern New Jersey south through Florida, west into Louisiana and parts of Kentucky. However, corn snakes are most abundant in Florida and the southeastern U.S.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: USA (Arkansas, Mississippi, Alabama, South Carolina, North Carolina, Kentucky, Virginia, Maryland, Delaware, New Jersey, Florida, Texas, Louisiana, Georgia), Cayman I, US Virgin Islands, Anguilla, Antigua, St.-Bartélmy (POWELL & HENDERSON 2003)  
Type locality: “Carolina” (Linnaeus, 1766); restricted to USA: South Carolina, Charleston County, vicinity of Charleston (Dowling, 1952)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Corn snakes are slender with a length of 61-182 cm. They are usually orange or brownish-yellow, with large, black-edged red blotches down the middle of the back. On the belly there are alternating rows of black and white marks, resembling a checkerboard pattern. Considerable variation occurs in the coloration and patterns of individual snakes, depending on the age of the snake and the region of the country in which it is found. Hatchlings lack much of the bright coloration found on adults. Corn snakes are not venomous.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 900 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 183 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Pantherophis guttatus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Female;
Preparation: Ethanol
Year Collected: 1878
Locality: Arlington, Duval, Florida, United States, North America
  • Syntype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 387.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Pantherophis guttatus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Palatka, Putnam, Florida, United States, North America
  • Syntype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 387.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Pantherophis guttatus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1885
Locality: Key West, Monroe, Florida, United States, North America
  • Holotype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 388, plate 36, figures 3a-f.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is mostly semi-fossorial, inhabiting in a wide variety of environments, from dry to humid, including pine forest, grass flatwoods, grasslands, open rock areas, and tropical hammocks.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Corn snakes may be found in wooded groves, rocky hillsides, meadowlands, woodlots, barns, and abandoned buildings.

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat includes pine woodlands, brushy fields, open hardwood forests, mangrove thickets, barnyards, abandoned buildings, areas near springs, old trash dumps, and caves (near entrance) (Ernst and Ernst 2003). Terrestrial and arboreal. On Grand Cayman Island, this snake is associated with shrubbery and imported trees from Miami, Florida.

Clutches have been found at the edge of an abandoned sawdust pile (Ashton and Ashton 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Corn snakes do not usually feed every day. They generally feed every few days or so. Young hatchlings tend to feed on lizards and tree frogs, while adult feed on larger prey, such as mice, rats, birds, and bats. They are constrictors, meaning they will use their coils to suffocate their food before eating it. First a corn snake will bite the prey in order to obtain a firm grip, then it quickly wraps one or more coils of its body around the victim. The snake squeezes tightly until it suffocates the prey. Then it swallows the food whole, usually head first. However, corn snakes have also been observed swallowing small prey alive.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly rodents; also bats, birds and their eggs, lizards, snakes, frogs, and insects (Green and Pauley 1987). Diet on Grand Cayman Island includes Anolis conspersus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Adult population size is unknown but presumably exceeds 10,000 and probably exceeds 100,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active from March-September in north (Collins 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The life span of the snakes is up to 23 years in captivity, but is generally much less in the wild.

Range lifespan

Status: captivity:
23 (high) years.

Average lifespan

Status: captivity:
32.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.3 years (captivity) Observations: These animals have been reported to live up to 32.3 years in captivity (http://www.pondturtle.com/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The breeding season of corn snakes is from March to May. The snakes are oviparous, depositing a clutch of 10 to 30 eggs in late May to July. Eggs are laid in rotting stumps, piles of decaying vegetation or other similar locations where there is sufficient heat and humidity to incubate them. The eggs are not cared for by the adult snakes. Once laid, the gestation period of the eggs is 60-65 days at approximately 82 degrees F. The eggs then hatch sometime in July through September. Hatchlings are 25-38 cm long and mature in 18-36 months.

Average number of offspring: 12.

Average age at sexual or reproductive maturity (male)

Sex: male:
600 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
600 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is 3-25 (average often is around 10-12). Eggs hatch in about 8-10 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pantherophis guttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC3752-07|AM236349|Pantherophis guttatus| ACTCGTTGATTATTCTCAACAAACCACAAAGACATTGGAACCCTATACCTTCTATTTGGCGCATGATCAGGATTAATCGGGGCCTGCCTA---AGCATCCTAATACGAATAGAACTCACCCAACCAGGGTCACTACTAGGCAGT---GACCAGATTTTTAACGTCTTAGTTACAGCCCACGCGTTTATCATAATTTTCTTTATAGTAATACCAATTATGATCGGGGGATTTGGCAACTGACTAATTCCACTAATA---ATCGGAGCCCCCGATATAGCCTTTCCACGTATAAATAATATAAGCTTCTGGCTCCTACCCCCGGCACTACTTCTTCTACTATCTTCCTCCTATGTTGAAGCTGGGGCTGGCACAGGGTGGACCGTCTACCCCCCACTATCAGGAAACCTAGTACATTCAGGCCCATCAGTAGACTTA---GCAATCTTCTCCTTACACCTGGCAGGCGCCTCATCCATCCTGGGGGCAATCAACTTTATTACAACATGTATTAACATAAAACCTAAATCTATACCAATATTTAACATTCCATTATTTGTCTGATCCGTGCTTATCACCGCCATTATACTACTATTGGCCCTACCTGTATTAGCAGCA---GCTATCACCATACTTTTAACTGATCGAAATCTAAATACTTCTTTCTTTGACCCCTGCGGAGGAGGGGACCCAGTACTATTTCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTATATATTCTAATCTTACCGGGGTTTGGCATCGTTTCAAGTATTATTACATTCTATACTGGAAAAAAA---AACACATTTGGATACACAAGTATGATTTGAGCAATAATATCCATTGCAATCTTAGGCTTTGTGGTTTGAGCACATCACATATTTACTGTGGGCCTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pantherophis guttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Justification
Listed as Least Concern in view of the large extent of occurrence, area of occupancy, number of subpopulations, and population size, and because the species probably is not declining fast enough to warrant listing in any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Corn snakes are often mistaken for copperheads and sometimes killed because of this. Also, because of their docile temperament, they are often kept as pets. Sometimes they are captured in the wild to be sold as pets. However, there are many snake breeders, so wild capturing does not pose a serious threat to this species.  Corn snakes are not an endangered species. However, they are listed by the state of Florida as a Species of Special Concern because they face habitat loss and destruction in the lower Florida Keys.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations). Adult population size is unknown but presumably exceeds 10,000 and probably exceeds 100,000. Extent of occurrence, area of occupancy, number of subpopulations, and population size probably are relatively stable or declining at a rate of less than 10% over 10 years or three generations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupancy, number of subpopulations, and population size probably are relatively stable or declining at a rate of less than 10% over 10 years or three generations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
No major threats are known. Habitat destruction is a local threat in some areas, but this species tolerates a fair amount of low intensity habitat alteration.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No major threats are known. Habitat destruction is a local threat in some areas, but this species tolerates a fair amount of low intensity habitat alteration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Many occurrences are in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Corn snakes help to control rodent populations that may otherwise spread disease. They are also widely popular as pets. They are the most frequently bred snake species for pet purposes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Corn snake

The corn snake (Pantherophis guttatus guttatus), or red rat snake, is a North American species of rat snake that subdues its small prey by constriction. The name "corn snake" is a holdover from the days when southern farmers stored harvested ears of corn in a wood frame or log building called a crib. Rats and mice came to the corn crib to feed on the corn, and corn snakes came to feed on the rodents.[1] The Oxford English Dictionary cites this usage as far back as 1676.

Corn snakes are found throughout the southeastern and central United States. Their docile nature, reluctance to bite, moderate adult size 3.9–6.0 feet (1.2–1.8 m), attractive pattern, and comparatively simple care make them popular pet snakes. In the wild, they usually live around 6–8 years, but in captivity can live to be up to 23 years old.[2]

Contents

Taxonomy

There are two subspecies of Pantherophis guttatus:

  • The corn snake, also known as the rat snake of the out back (Pantherophis guttatus guttatus) lives in the southeastern United States, and is distinguished by having brownish-orange skin with orange/red saddles, the saddles having black borders, and usually a black and white underbelly. However, in captivity, they can be other colours such as black and white.
  • The Great Plains rat snake or Emory's rat snake (Pantherophis guttatus emoryi) is found in the United States from Nebraska to Texas, and into northern Mexico.

It has been suggested that Pantherophis guttatus be split into three species: Pantherophis guttatus, Pantherophis emoryi (corresponding with the subspecies Pantherophis guttatus emoryi) and Pantherophis slowinskii (occurring in western Louisiana and adjacent Texas).[3]

Pantherophis guttatus was previously placed in the genus Elaphe, but Elaphe was found to be paraphyletic by Utiger et al., leading to placement of this species in the genus Pantherophis.[4] The placement of Pantherophis guttatus and several related species in Pantherophis rather than Elaphe has been "confirmed" by further phylogenetic studies.[5][6] Nevertheless, even before Utiger et al.'s publication, the paraphyly of Elaphe was already widely known for decades, but no taxonomist before Utiger et al. has formally proposed resurrecting Pantherophis as the generic name for the North American species of Elaphe, primarily because the two genera cannot be distinguished from each other morphologically. Indeed, of the dozen or so old generic names Utiger et al. have resurrected from the synonymy of Elaphe in their attempt to reduce paraphyly, none of them can be distinguished from Elaphe morphologically and Utiger et al. did not provide any diagnostic characters for any of the genera they resurrected. Utiger et. al. therefore provided no new information, and they made many distinctions without any difference. They split Elaphe for no other reason than the same old cladistic intolerance of paraphyletic taxa. Recognizing Pantherophis contributes nothing to scientific progress because it is a distinction without a difference. Many reference materials still contain the old name Elaphe guttata.[7] The old name remains valid, and no one is required to following Utiger et al.'s taxonomic proposal, even if other cladists follow their lead because of their shared intolerance of paraphyletic taxa.

Natural habitat

Wild corn snakes prefer habitats such as overgrown fields, forest openings, trees, palmetto flatwoods and abandoned or seldom-used buildings and farms, from sea level to as high as 6,000 feet. Typically, these snakes remain on the ground, but can ascend trees, cliffs and other elevated surfaces.[8] They can be found in the southeastern United States ranging from New Jersey to the Florida Keys and as far west as Texas.

In colder regions, snakes hibernate during winter. However, in the more temperate climate along the coast they shelter in rock crevices and logs during cold weather, and come out on warm days to soak up the heat of the sun, a process known as brumation. During cold weather, snakes are less active and therefore hunt less.

Reproduction

Corn snakes are relatively easy to breed. First they have to go through a cooling (also known as brumation) period that takes usually 60–90 days long. This is to get them ready for breeding and to tell them that its time to reproduce. Corns brumate at around 10 to 16 °C (50 to 61 °F) in a place where they can not get disturbed and not worry about predators. When its summer they go out to warm up to their regular temperature.

Baby corn snakes hatching from their eggs

Corn snakes usually breed shortly after the winter cooling. The male courts the female primarily with tactile and chemical cues, then everts one of his hemipenes, inserts it into the female, and ejaculates his sperm. If the female is ovulating, the eggs will be fertilized, and she will begin sequestering nutrients into the eggs, then secreting a shell.

Egg-laying occurs slightly more than a month after mating, with 12–24 eggs deposited into a warm, moist, hidden location. Once laid the adult snake abandons the eggs and does not return to them. The eggs are oblong with a leathery, flexible shell. Approximately 10 weeks after laying, the young snakes use a specialized scale called an egg tooth to slice slits in the egg shell, from which they emerge at about 5 inches in length. Then grow about to 2-3 feet.

Variations

After many generations of selective breeding, domesticated corn snakes are found in a wide variety of different colors and patterns. These result from recombining the dominant and recessive genes that code for proteins involved in chromatophore development, maintenance, or function. New variations, or morphs, become available every year as breeders gain a better understanding of the genetics involved.

Color morphs

  • Normal or wildtype corn snakes are orange with black lines around red colored saddle markings going down their back with black and white checkered bellies. Regional diversity is found in wild caught corn snakes, the most popular being the Miami and Okeetee phases. These are the most commonly seen corn snakes.
  • Miami Phase (originates in the Florida wildtype) These are usually smaller corn snakes with some specimens having highly contrasting light silver to gray ground color with orange saddle markings surrounded in black. Selective breeding has lightened the ground color and darkened the saddle marks. The “Miami” name, coined by Rich Zuchowski, now is considered an appearance trait. Many Miami corn snakes are difficult to start feeding as hatchlings, as they prefer lizards. Miami corn snakes, unlike other varieties, will often readily accept anoles as food for life. This can simplify feeding for residents of Florida, but care should be taken to avoid introducing parasites from wild caught food.
  • Okeetee corn snakes . These snakes are characterized by deep red dorsal saddle marks surrounded by very black borders. The ground color varies with bright orange being popular amongst breeders. As with the Miami phase, selective breeding has changed the term “Okeetee” to an appearance rather than a locality. Some on the market originate solely from selectively breeding corn snakes from the Okeetee Hunt Club.
  • Candycane (selectively bred amelanistic) These are amelanistic corn snakes bred toward the ideal of red saddle marks on a white background. Some were produced using light creamsicle (emory/albino corn hybrids x corn) bred with Miami phase corn snakes. Most candy canes develop orange coloration around the neck region as they mature and many labeled as candycanes later develop significant amounts of yellow or orange in the ground color. The contrast they have as hatchlings often fades with maturity.
  • Reverse Okeetee (selectively bred amelanistic) an amelanistic Okeetee corn snake which has the normal black rings around the saddle marks replaced with wide white rings. Ideal specimens are high contrast snakes with light orange to yellow background and dark orange/red saddles. Note: Albino Okeetees are not locale-specific okeetees—they are selectively bred amelanistics
  • Fluorescent orange (selectively bred amelanistic) develop white borders around bright red saddle marks as adults on an orange background.
  • Sunglow (selectively bred amelanistic) another designer amelanistic corn that lacks the usual white speckling that often appears in most albinos, and selected for exceptionally bright ground color. The orange background surrounds dark orange saddle marks.
  • Bloodred (selectively bred “Diffused”) corn snakes carry a recessive trait (known as diffused) that eliminates the ventral checkered patterns. These originated from a somewhat unicolor Jacksonville and Gainesville, Florida strain of corn snake. Through selective breeding, an almost solid ground color has been produced. Hatchlings have a visible pattern that can fade as they mature into a solid orange red to ash red colored snake. The earlier bloodreds tend to have large clutches of smaller than average eggs that produce hard to feed offspring, though out-crossing with amelanistic and anerythristic corn snake hatchlings tend to be larger with fewer feeding problems.
  • Crimson (hypomelanistic + Miami) are very light high contrast snakes with a light background and dark red/orange saddle marks.
  • Anerythristic (anerythristic A, Sometimes called black albino) are the complement to amelanism. The inherited recessive mutation of lacking erythrin (red, yellow, and orange) pigments produces a snake that is mostly black, gray and brown. When mature, many type A anerythristic corn snakes develop yellow on their neck regions. In 1984 a Type B anerythristic corn snake was caught in the wild; it is the ancestor of anerythristics missing the yellow neck regions. Similar snakes include: stonewashed-copper or light brown saddle marks; charcoal (aka muted anerythristic, Pine Island anerythristic); type B anerythristic, very low contrast with shades of gray on white and black background.
    Anerythristic A corn snake
  • Charcoal These snakes (sometimes known as anerythristic type ‘B’) can lack the yellow color pigment usually found in all corn snakes. They are a more muted contrast compared to Anerythristics.
  • Caramel corn snakes are another Rich Zuchowski engineered corn snake. The background is varying shades of yellow to yellow-brown. Dorsal saddle marks vary from caramel yellow to brown, and chocolate brown.
  • Lavender corn snakes contain a light pink background with darker purple gray markings and burgundy eyes or lavender gray saddle marks on an orangish background. Variation with this same genetic strain are arguably called mocha, cocoa, and chocolate.
  • Cinder reduced red pigment which becomes more like an anerythristic as they become adults.
  • Kastanie This gene was first discovered in Germany. Kastanies hatch out looking nearly anerythristic but gain some color as they mature, to eventually take on a chestnut coloration.
  • Hypomelanistic or rosy corn snakes carry a recessive trait that reduces the dark pigments causing the reds, whites, and oranges to become more vivid. Their eyes remain dark. These snakes range in appearance between amelanistic corn snakes to normals with greatly reduced melanin.
  • Ultra Ultra is a hypomelanistic-like gene that is an allele to the amelanistic gene. Ultra corn snakes have light grey lines in place of black. The Ultra gene is derived from the grey rat snake. All Ultras and Ultramels have some amount of grey rat snake in them.
  • Ultramel is an intermediate appearance between ultra and amel which is the result of being heterozygous for ultra and amel at the albino locus.
  • Dilute is another melanin-reducing gene.
  • Sunkissed is a hypo-like gene which was first found in Kathy Love’s colony.
  • Lava is an extreme hypo-like gene which was discovered by Joe Pierce and named by Jeff Mohr.
  • Stargazing is not a color morph, but a chronic deficiency in balance. It is caused by a simple-recessive genetic defect and is considered deleterious.[9]

Pattern morphs

Amelanistic Stripe corn snake
  • Motley a snake with a clear belly and an “inverted” spotting pattern. May also appear as stripes or dashes.
  • Stripe this morph also has a clear belly and a striping pattern. Unlike the motley the stripes will not connect, but may sometimes break up and take on a “cubed” appearance. Cubes and spots on a striped corn are the same as the saddle color on a similar normal corn, unlike motley snakes. Stripe is both allelic and recessive to motley, so breeding a striped corn and a (homozygous) motley corn will result in all motley corn snakes, and breeding these (heterozygous) motley corn offspring will result in ¾ motley and ¼ striped corn snakes.
  • Diffusion diffuses the patterning on the sides and eliminates the belly pattern. It is one component of the bloodred morph.
  • Sunkissed while considered a hypo-like gene, sunkissed also has other effects such as rounded saddles and unusual head patterns.
  • Aztec, zigzag and banded are selectively bred multigenetic morphs (that is not dependent on a single gene).

Compound morphs

There are tens of thousands of possible compound morphs. Some of the most popular are listed.

  • Snow (Amelanistic + Anerythristic) As hatchlings this color variation is composed of white and pink blotches. These predominantly white snakes tend to have yellow neck and throat regions when mature. Light blotches and background colors have subtle shades of beige, ivory, pink, green, or yellow.
  • Blizzard (Amelanistic + Anerythristic B) corn snakes resulted from a type B anerythristic corn caught in 1984. Blizzards are a totally white snake with very little to no visible pattern.
  • Ghost (Hypomelanistic + Anerythristic A) corn snakes are a hypomelanistic anerythristic (type A) snakes. They exhibit varying shades of grays, browns, and blacks on a lighter background. These often create pastel colors in lavenders, pinks, oranges, and browns.
  • Phantom These are a combination of charcoal and Hypomelanistic.
  • Pewter (Charcoal + Diffused) are silvery lavender with very slight blotches as adults.
  • Butter (Amelanistic + Caramel) A two-tone yellow corn snake with bits of white between markings.
  • Amber (Hypomelanistic + Caramel) corn snakes are a hypomelanistic caramel snake with amber markings on a brownish background.
“Opal” phase corn snake
  • Gold Dust (Ultramel + Caramel) Gold Dust corn snakes often have a more golden yellow than butters mixed with the grey lines rather than white.
  • Plasma (Diffused + Lavander) Hatch out in varying shade of purple.
  • Opal (Amelanistic + Lavender) look like blizzard corn snakes once mature with pink to purple highlights.
  • Ultramel (Ultra + Amelanistic)an appearance of a Ultra Hypo.

Hybrids

Hybrids between corn snakes and any other snake within Pantherophis, Lampropeltis, or Pituophis so far have been proven to be completely fertile.

  • Jungle corn snakes are hybrids using the corn snake and California Kingsnake (Lampropeltis getula californiae). These show extreme pattern variations taking markings from both parents.. Although they are hybrids of different genera, they are not sterile.
  • Tri Color Jungle Corns are a hybrid involving Querétaro Kingsnake and Cornsnake parents. The colour is similar to that of an Amelanistic Cornsnake.
  • Creamsicle Cornsnake is a hybrid involving an albino Emory's Rat snake (Pantherophis emoryi) and Cornsnake parents. There is another hybrid involving a non-albino Emory's Rat snake, known as Rootbeer.
  • Turbo Corn snakes are hybrids between a corn snake and any Pituophis species.
  • Corn snakes hybridized with milk snakes go by a variety of names, depending on the subspecies of milk snake it is. For example, a Honduran Milk Snake X Corn snake is called a Cornduran, a Sinaloan Milk Snake X Corn snake is called a Sinacorn, a Pueblan Milk Snake X Corn Snake is called a puebla corn.
  • Imperial Pueblan is 75% Pueblan Milk Snake and 25% Banana California King(Banana is a dominant trait)
  • Brook Korn is a hybrid between the Brook's king snake and a corn snake. Like the jungle corn, the hybrids show extreme pattern variations

References

  1. ^ http://www.flmnh.ufl.edu/herpetology/fl-guide/pantherophisguttatus.htm
  2. ^ Corn Snake Fact sheet
  3. ^ Burbrink, F. T., 2002. Phylogeographic analysis of the corn snake (Elaphe guttata) complex as inferred from maximum likelihood and Bayesian analyses. Molecular Phylogenetics and Evolution 25: 465-476.
  4. ^ Utiger, U., N. Helfenberger, B. Schätti, C. Schmidt, M. Ruf, and V. Ziswiler, 2002. Molecular Systematics and Phylogeny of Old and New World ratsnakes, Elaphe Auct., and related genera (Reptilia, Squamata, Colubridae). Russian Journal of Herpetology 9(2): 105-124.
  5. ^ Burbrink, F. T. and R. Lawson, 2007. How and when did Old World ratsnakes disperse into the New World? Molecular Phylogenetics and Evolution 43: 173-189.
  6. ^ Pyron, R. A. and F. T. Burbrink, 2009. Neogene diversification and taxonomic stability in the snake tribe Lampropeltini (Serpentes: Colubridae) Molecular Phylogenetics and Evolution 52: 524-529.
  7. ^ Bartlett, Patricia; Bartlett, R. D. (2006-05-26), Corn Snakes and Other Rat Snakes, Complete Pet Owner's Manual (2nd ed.), Hauppauge NY: Barron's Educational Series, ISBN 0-7641-3407-8 
  8. ^ Peterson Field Guide - Western Reptiles and Amphibians - 3rd Edition
  9. ^ CCCorns - Corn Snake Star Gazer Information Page
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Burbrink (2002) used cytochrome b sequences to examine phylogenetic relationships among E. guttata populations (one specimen from each of 53 locations throughout most of the range). He found no support for recognition of the nominal subspecies intermontanus and meahllmorum as distinct taxa; these appear to be junior synonyms of E. guttata emoryi. Burbrink identified three partitions of E. guttata: an eastern partition (east of the Mississippi River) corresponding to E. guttata guttata, a western partition corresponding to E. guttata emoryi (including E. g. intermontanus and E. g. meahllmorum), and a central partition in western Louisiana and eastern Texas. The central partition, in pine and pine-hardwood habitat west of the Mississippi River, clustered closer to the eastern partition than to the western partition. Burbrink recognized the three partitions as species using evolutionary species criteria: (1) Elaphe guttata (red corn snake) (eastern partition ), (2) Elaphe emoryi (Great Plains rat snake) (western partition), and (3) Elaphe slowinskii (Slowinski's corn snake) (central partition). One specimen (Hidalgo County, Texas) of the central partition (based on cytochrome b characteristics) was located outside the presumed geographic area and habitat identified for other members of that partition. Crother et al. (2003) adopted these changes but used the following names: red cornsnake, Great Plains ratsnake, and Slowinski's cornsnake. Ernst and Ernst (2003) recognized E. emoryi and E. guttata as distinct species, but their manuscript evidently was completed before Burbrink's paper was published; they did not comment on E. slowinskii.

Utiger et al. (2002) examined mtDNA variation in New World and Old World "Elaphe" and determined that North American rat snakes currently included in the genus Elaphe form a monophyletic limeage that is distinct from Old World snakes that also have been regarded as Elaphe. They resurrected the genus Pantherophis for the rat snakes north of Mexico, including the following species: Pantherophis obsoletus (and P. alleghaniensis and P. spiloides, if one recognizes those taxa as species), P. guttatus, P. emoryi, P. vulpinus, P. gloydi, and P. bairdi. Based on mtDNA and nuclear DNA data, Burbrink and Lawson (2007) determined that New World Elaphe are not closely related to Old World Elaphe. Here we follow these studies and Crother (2008) and transfer New World Elaphe to the genus Pantherophis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!