Overview

Distribution

Rat snakes are found from New England south through Florida and west through the eastern halves of Texas and Nebraska and north again to southern Wisconsin (Staszko and Walls 1994). Elaphe obsoleta obsoleta (Black Rat Snake) is the most widely distributed common rat snake with a range from New England south through Georgia and west across the northern parts of Alabama, Mississippi, and Louisiana, and north through Oklahoma to southern Wisconsin. There is also an isolated population in southern Canada and northern New York. E. o. quadrivittata (Yellow Rat Snake) is found along the coast of the Carolinas south through Georgia and Florida. E. o. rossalleni (Everglades Rat Snake) has an isolated population in southern Florida, hence, where the Everglades are located. E. o. spiloides (Gray Rat Snake) ranges from southern Georgia and northern Florida west through Mississippi and north to southern Kentucky. E. o. lindheimerii (Texas Rat Snake) can be found in southern Oklahoma, Texas, and Louisiana (Conant and Collins 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species ranges widely in the east of the United States, extending into southern Canada. Its range extends from southern New England and southern Ontario west to southeastern Minnesota, and south to southern Texas, the entire Gulf Coast, and southern Florida (Conant and Collins 1991). As defined by Burbrink (2001), the range of Pantherophis obsoletus is as follows: west of the Mississippi River from southern Louisiana along the Gulf Coast to southern Texas, west to central Texas on the Edwards Plateau, and through Oklahoma, central and eastern Kansas, southeastern Nebraska, and southeastern Iowa to extreme southeastern Minnesota. However, this taxonomy/distribution has not been adopted in this database.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: As defined by Burbrink (2001), the range of E. obsoleta is as follows: west of the Mississippi River from southern Louisiana along the Gulf Coast to southern Texas, west to central Texas on the Edwards Plateau, and through Oklahoma, central and eastern Kansas, southeastern Nebraska, and southeastern Iowa to extreme southeastern Minnesota.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Rat snakes are found from New England south through Florida and west through the eastern halves of Texas and Nebraska and north again to southern Wisconsin (Staszko and Walls 1994). Elaphe obsoleta obsoleta (Black Rat Snake) is the most widely distributed common rat snake with a range from New England south through Georgia and west across the northern parts of Alabama, Mississippi, and Louisiana, and north through Oklahoma to southern Wisconsin. There is also an isolated population in southern Canada and northern New York. E. o. quadrivittata (Yellow Rat Snake) is found along the coast of the Carolinas south through Georgia and Florida. E. o. rossalleni (Everglades Rat Snake) has an isolated population in southern Florida, hence, where the Everglades are located. E. o. spiloides (Gray Rat Snake) ranges from southern Georgia and northern Florida west through Mississippi and north to southern Kentucky. E. o. lindheimerii (Texas Rat Snake) can be found in southern Oklahoma, Texas, and Louisiana (Conant and Collins 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: North-America
Distribution: C/E USA (SE Nebraska, E Kansas, Oklahoma, E Texas, SE Minnesota, S/E Iowa, Missouri, Arkansas, Louisiana, Mississippi, Florida, Georgia, Alabama, South Carolina, North Carolina, Kentucky, Virginia, West Virginia, Indiana, Ohio, Maryland, Delaware, New Jersey, New York, Connecticut, Massachusetts, S Michigan, W Vermont, Pennsylvania), S Canada  
Type locality: “on the Missouri River from the vicinity of Isle au Vache [Cow Island] to Council Bluff” (Say, 1823); restricted to the vicinity of Cow Island, Leavenworth County, Kansas (Dowling, 1952).  obsoleta (fide BURBRINK 2001): west of the Mississippi River from S Louisiana along the Gulf Coast to S Texas, west to C Texas on the Edward’s Plateau, and through Oklahoma, C and E Kansas, SE Nebraska, SE Iowa, and extreme SE Minnesota. Compare to P. alleghaniensis
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The common rat snake is medium-sized, averaging 42-72 inches (106.7-183 cm) in length (Conant and Collins 1998). At the widest point of the snake's body, the average diameter is 1.5 inches (3.8 cm) (Staszko and Walls 1994). Covered with keeled scales, common rat snakes have a powerful slender body with a wedge-shaped head (Mattison 1990). At the middle of the snake's body, there are 29 or fewer scale rows. In most rat snakes, there are 8 supralabials, and over 220 ventral scales, with 70 to 100 subcaudals (Staszko and Walls 1994). The anal plate (scale) of the common rat snake is divided. These snakes come in a variety of subspecies, each of which will be briefly described here.

The black rat snake, as the name states, is completely black except for their white chin. Hatchlings of the black rat snake have a pale grey background with black blotches along its back. As the snake matures, the color becomes darker until the snake reaches its adult phase. (Conant and Collins 1998)

The yellow rat snake has four well-defined longitudinal stripes extending down the length of its back. The base color varies from dull to bright yellow. The tongue, of the yellow rat snake, is black. Hatchlings are similar to those of the black rat snake, however, as the hatchlings mature, the dark spots fade as the yellow coloration and longitudinal stripes become more prominent. (Conant and Collins 1998)

The Everglades rat snake has a bright orange ground color. In some specimens, the color may appear more orange-yellow. This rat snake has grayish longitudinal stripes, which are not well defined and are often hard to see. The tongue is red. Juvenile Everglades rat snake are a pinkish color. (Conant and Collins 1998)

The gray rat snake keeps the blotched juvenile pattern its entire life. The blotches will vary between dark gray and brown. Juvenile black and yellow rat snakes are often mistaken as juvenile gray rat snakes. (Conant and Collins 1998)

The Texas rat snake is similar to the gray rat snake, however the blotches are usually less defined. The head of the Texas rat snake is often black. The juveniles of this subspecies have a much darker gray ground color. (Conant and Collins 1998)

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians Eastern/Central North America. New York: Houghton Mifflin Company.
  • Mattison, C. 1990. A-Z of Snake Keeping. New York: Sterling Publishing Co., Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The common rat snake is medium-sized, averaging 42-72 inches (106.7-183 cm) in length (Conant and Collins 1998). At the widest point of the snake's body, the average diameter is 1.5 inches (3.8 cm) (Staszko and Walls 1994). Rat snakes are covered with keeled scales. They have a powerful slender body with a wedge-shaped head (Mattison 1990). These snakes come in a variety of subspecies. The black rat snake is the one most commonly found in Michigan.

The black rat snake, as the name states, is completely black except for their white chin. Hatchlings of the black rat snake have a pale grey background with black blotches along its back. As the snake matures, the color becomes darker until the snake reaches its adult phase. (Conant and Collins 1998)

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians Eastern/Central North America. New York: Houghton Mifflin Company.
  • Mattison, C. 1990. A-Z of Snake Keeping. New York: Sterling Publishing Co., Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Pantherophis obsoletus
Catalog Number: USNM 84295
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1931
Locality: Lower Matecumbe Key, Monroe, Florida, United States, North America
  • Holotype: Brady, M. K. 1932. Proc. Biol. Soc. Washington. 45: 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Pantherophis obsoletus
Catalog Number: USNM 8798
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Augusta, Richmond, Georgia, United States, North America
  • Syntype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 386.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Pantherophis obsoletus
Catalog Number: USNM 1563
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Anderson, South Carolina, United States, North America
  • Holotype: Baird, S. F. & Girard, C. 1853. Smithsonian Miscellaneous Collections. 2 (5): 76.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Pantherophis obsoletus
Catalog Number: USNM 248870
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Whitfield, Georgia, United States, North America
  • Syntype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 386.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Common rat snakes live in a variety of habitats because each subspecies prefers a slightly different habitat. Some of these habitats overlap with one another. Common rat snakes are excellent climbers and will spend a lot of time in trees. Black rat snakes live at all elevations, from sea level to altitudes in the Appalachian Mountains. The black rat snakes lives in habitats ranging from a rocky hillside of mountains to flat farmland. The yellow rat snake is well established, living in oak hammocks, cut-over woods, fields, and around barns and abandoned houses. However, yellow rat snakes prefer a life in river swamps of the South, where they live high in cypress and other trees. Gray rat snakes replace the black rat snake in southern habitats suitable for black rat snakes. The Texas rat snake's habitat ranges from bayou and swampy areas to woods and stream valleys to rocky canyons. The Everglades rat snake makes its home in the Kissimmee Prairie and the Florida Everglades. In this habitat they can be found in trees and shrubs along the waterways, in the sawgrass, and on open prairies. (Conant and Collins 1998)

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitats include hardwood forest and woodland, wooded canyons, swamps, rocky timbered upland, wooded areas of streams and rivers, farmland near woods, old fields, barnyards, and rural buildings in wooded areas. This snake often occurs where wooded and open habitats (such as fields or farmland) are intermixed. It often climbs trees, especially rough-barked species or those with vines (Mullin and Cooper 2002), and it may sometimes enter water. Hibernation sites are in deep crevices or underground. Individuals exhibit very high fidelity to hibernacula (Prior et al. 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common rat snakes live in a variety of habitats because each subspecies prefers a slightly different habitat. Some of these habitats overlap with one another. Common rat snakes are excellent climbers and will spend a lot of time in trees. Black rat snakes live at all elevations, from sea level to altitudes in the Appalachian Mountains. The black rat snakes lives in habitats ranging from a rocky hillside of mountains to flat farmland. The yellow rat snake is well established, living in oak hammocks, cut-over woods, fields, and around barns and abandoned houses. However, yellow rat snakes prefer a life in river swamps of the South, where they live high in cypress and other trees. Gray rat snakes replace the black rat snake in southern habitats suitable for black rat snakes. The Texas rat snake's habitat ranges from bayou and swampy areas to woods and stream valleys to rocky canyons. The Everglades rat snake makes its home in the Kissimmee Prairie and the Florida Everglades. In this habitat they can be found in trees and shrubs along the waterways, in the sawgrass, and on open prairies. (Conant and Collins 1998)

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Rat snakes are primarily known as rodent eaters, however, other food preferences do exist. As juveniles, rat snakes will eat small lizards, baby mice, and an occasional small frog. Adult rat snakes have a diet mainly consisting of mice and rats, but will also include chipmunks, moles, and other small rodents. Adults will also eat bird eggs and young birds that do not put up a strong fight. Rat snakes kill their prey by constriction. (Rossi 1992)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Rat snakes are primarily known as rodent eaters, however, other food preferences do exist. As juveniles, rat snakes will eat small lizards, baby mice, and an occasional small frog. Adult rat snakes have a diet mainly consisting of mice and rats, but will also include chipmunks, moles, and other small rodents. Adults will also eat bird eggs and young birds that do not put up a strong fight. Rat snakes kill their prey by constriction. (Rossi 1992)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Elaphe obsoleta preys on:
Aix sponsa
Otus asio
Passer domesticus
Egretta thula

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Average lifespan

Status: captivity:
33.9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.9 years (captivity) Observations: These animals have been reported to live up to 33.9 years in captivity (http://www.pondturtle.com/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Like most snakes, rat snakes are egg layers. Between March and May, snakes will begin to emerge from the winter's hibernation. After a few weeks, the common rat snakes will begin to seek out a mate, typically in late April, May, and early June (Rossi 1992). Males tend to wait for the females to pass through their territory, and by using pheromones, will communicate and initiate the mating process with the female (Rossi 1992). The male snake will approach the female, line up with her and attempt to wrap his tail around hers with their vents nearly touching. Some males will grasp the female, with his mouth, to hold her in place and prevent her from trying to move away. The male will then erect his hemipene and insert it into the female's cloaca while several small spines anchor the hemipene firmly (Staszko and Walls 1994). Mating can last only a few minutes or it can span the time of a few hours. Five weeks later, the female will lay around 12 to 20 eggs (Mattison 1990). The female will lay her eggs in a hidden area, under hollow logs or leaves, or in abandoned burrows. The eggs will hatch 65 to 70 days later. The hatchlings of common rat snakes are vigorous eaters and will double their size rather quickly. If conditions are good, females will sometimes produce two clutches of eggs a year. (Mattison 1990)

Range number of offspring: 12 to 20.

Average age at sexual or reproductive maturity (male)

Sex: male:
1460 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1460 days.

  • Mattison, C. 1990. A-Z of Snake Keeping. New York: Sterling Publishing Co., Inc..
  • Rossi, J. 1992. Snakes of the United States and Canada Keeping Them Healthy in Captivity Volume I Eastern Area. Malabar, Florida: Krieger Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Like most snakes, rat snakes are egg layers. Between March and May, snakes will begin to emerge from the winter's hibernation. After a few weeks, the common rat snakes will begin to seek out a mate, typically in late April, May, and early June. Males tend to wait for the females to pass through their territory. They communicate using pheromones.

Five weeks after mating, the female will lay around 12 to 20 eggs. The female will lay her eggs in a hidden area, under hollow logs or leaves, or in abandoned burrows. The eggs will hatch 65 to 70 days later.

The hatchlings of common rat snakes are vigorous eaters and will double their size rather quickly. If conditions are good, females will sometimes produce two clutches of eggs a year.

Range number of offspring: 12 to 20.

  • Mattison, C. 1990. A-Z of Snake Keeping. New York: Sterling Publishing Co., Inc..
  • Rossi, J. 1992. Snakes of the United States and Canada Keeping Them Healthy in Captivity Volume I Eastern Area. Malabar, Florida: Krieger Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Elaphe obsoleta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pantherophis obsoletus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCGGTACAGGATGAACCGTTTACCCCCCACTGTCAGGAAATCTAGTACACTCAGGCCCATCAGTGGATCTAGCAATCTTCTCCTTACACCTAGCAGGCGCCTCCTCCATCCTGGGGGCAATCAACTTCATTACAACATGTATTAATATAAAACCTAAATCTATACCAATATTTAACATCCCTTTGTTTGTCTGATCAGTACTTATCACCGCCATTATACTACTATTAGCCCTACCAGTACTAGCAGCAGCAATTACTATACTTTTAACTGATCGAAATCTAAATACCTCTTTCTTTGATCCTTGTGGAGGAGGGGACCCTGTACTATTCCAACACCTATTTTGATTCTTCGGTCATCCAGAAGTGTACATTCTTATTCTACCAGGATTCGGCATTGTATCGAGTATTATTACATTCTATACTGGAAAAAAAAATACATTTGGATACACAAGCATAATTTGGGCAATAATATCTATTGCAATCTTAGGCTTTGTGGTTTGAGCACATCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pantherophis obsoletus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The subspecies Elaphe obsoleta obsoleta is listed as special concern in the state of Michigan. Their habitat is slowly being reduced due to land development and the cutting of trees. However, they continue to maintain a healthy population in many areas. Due to people's lack of knowledge and fear of snakes, rat snakes continue to be the victim of human persecution. (Harding 1997)

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The subspecies Elaphe_obsoleta_obsoleta is listed as special concern in the state of Michigan. Their habitat is slowly being reduced due to land development and the cutting of trees. However, they continue to maintain a healthy population in many areas. Due to people's lack of knowledge and fear of snakes, rat snakes continue to be the victim of human persecution. (Harding 1997)

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences (subpopulations). The adult population size is unknown but presumably exceeds 100,000. This snake is fairly common in many areas. The extent of occurrence, area of occupancy, number of subpopulations, and population size are probably relatively stable or declining at a rate of less than 10% over 10 years or three generations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known. This snake thrives on partial deforestation. Locally, some populations have declined as a result of extensive deforestation and various forms of intensive development.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Many occurrences are in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Rat snakes are very useful around barns and in the farming community. These snakes should be welcome on farms because they help control the pest population (rodents). (Harding 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Rat snakes are very useful around barns and in the farming community. These snakes should be welcome on farms because they help control the pest population (rodents). (Harding 1997)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western rat snake

The western rat snake (Pantherophis obsoletus), also commonly known as the Texas ratsnake,[3] black rat snake, pilot black snake, or simply black snake.[4] is a nonvenomous species of Colubridae found in central North America. No subspecies are currently recognized.[5]

Geographic range[edit]

The Rat snakes is found from New England south through Florida and west through the eastern half of Texas and Nebraska and north again to southern Wisconsin. The black rat snake is the most widely distributed common rat snake with a range from New England south through Georgia and west across the northern parts of Alabama, Mississippi, and Louisiana, and north through Oklahoma to southern Wisconsin. There is also an isolated population in southern Canada and northern New York. The yellow rat snake is found along the coast of the Carolinas south through Georgia and Florida. The Everglades rat snake has an isolated population in southern Florida's Everglades. The gray rat snake ranges from southern Georgia and northern Florida west through Mississippi and north to southern Kentucky. The Texas rat snake can be found in southern Oklahoma, Texas, and Louisiana. Common rat snakes live in a variety of habitats with each subspecies preferring a slightly different one. Some of these habitats overlap with one another. Common rat snakes are excellent climbers and spend a lot of time in trees. Black rat snakes live at elevations from sea level to high altitudes in the Appalachian Mountains. Black rat snakes live in habitats ranging from a rocky hillside to flat farmland.[6]

Preferred habitat[edit]

It prefers heavily wooded areas and is known for having excellent climbing ability, including the ability to climb the trunk of large mature trees without the aid of branches. This snake is a competent swimmer. During winter it hibernates in dens, often with copperheads and timber rattlesnakes. This association gave rise to one of its common names, pilot black snake, and the superstition that this nonvenomous species led the venomous ones to the den.

Description[edit]

Adults can become quite large, with a reported typical length of 106.5–183 cm (3 ft 6 in–6 ft 0 in).[7][8] They are the largest snake found in Canada. The record total length is 256.5 cm (8 ft 5 in),[9] making it (officially) the longest snake in North America.[8] Unofficially, indigo snakes (Drymarchon couperi) are known to exceed them, and one wild-caught pine snake (Pituophis melanoleucus), with a portion of its tail missing, measured 111 inches (2.8 m).[citation needed] The body mass of this rat snake is commonly 0.5 to 2.2 kg (1.1 to 4.9 lb) in large adults.[10][11]

Juveniles are strongly patterned with brown blotches on a gray background (like miniature fox snakes, Pantherophis gloydi and Pantherophis vulpinus). Darkening occurs rapidly as they grow. Adults are glossy black above with white lips, chin, and throat. Sometimes traces of the "obsolete" juvenile pattern are still discernible in the skin between the scales, especially when stretched after a heavy meal.[12][13]

Common names[edit]

Other common names include: Alleghany black snake, black chicken snake, black coluber, chicken snake, mountain black snake, mountain pilot snake, pilot, rat snake, rusty black snake, scaly black snake, cow snake, schwartze Schlange, sleepy John, and white-throated racer.[14]

Black rat snake showing "kinked" threatened posture.

Behavior[edit]

When not fully grown, rat snakes are subject to predation by many animals, including other snakes. Once they attain maturity, they are readily preyed on by humans, as well as mammalian carnivores (including the American mink, which weighs no more than an adult rat snake) and large birds of prey (especially red-tailed hawks).[15] When startled, they may freeze and wrinkle themselves into a series of kinks. If they feel further threatened, they may flee quickly or vibrate their tails in dead leaves (a form of mimicry, which makes them sound like rattlesnakes). They are also capable of producing a foul-smelling musk, which they will release onto predators if picked up. They spread the musk with their tails in hopes of deterring the threat.[16] When cornered or provoked, black snakes are known to stand their ground and can become aggressive. Counterattacks on large birds of prey, often committed by large snakes in excess of 150 cm (59 in) in length, have resulted in violent prolonged struggles. Utilizing its infamous agility and the great strength of its muscular coils, the black rat snake is sometimes able to overwhelm and kill formidable avian predators such as Red-tailed Hawks, Great Horned Owls and Red-shouldered Hawks, though in many cases the bird is able to kill the snake and both combatants may even die.[17][18]

Feeding[edit]

This species is a constrictor, meaning it suffocates its prey, coiling around small animals and tightening its grip until they can no longer draw breath, before eating them. Though they will often consume mice, voles, and rats, western rat snakes are far from specialists at this kind of prey and will readily consume any small vertebrate they can catch. Other prey opportunistically eaten by this species can include other snakes (including both those of their own and other species), frogs, lizards, chipmunks, squirrels, juvenile rabbits, juvenile opossums, songbirds, and bird eggs.[12] One snake was observed to consume an entire clutch of mallard eggs.[15] Cavity-nesting bird species are seemingly especially prevalent in this snake's diet. The rat snake has been noted as perhaps the top predator at purple martin colonies as a single large snake will readily consume a number of eggs, hatchlings, and adults each summer. Several rat snake repelling methods have been offered to those putting up martin houses, but most are mixed in success.[19]

Reproduction[edit]

Mating while climbing a tree

Mating takes place in late May and early June. The male snake wraps its tail around the female with their vents nearly touching. The male then everts one of its sex organs, a hemipenis, into the female sex organ, cloaca. The mating lasts a few minutes to a few hours. After five weeks, the female lays about 12 to 20 eggs, which are 36–60 mm (1.4-2 in.) long by 20–26.5 mm (0.8–1.1 in.) wide. The eggs hatch about 65 to 70 days later in late August to early October.[20] The hatchlings are 28–41 cm (11–16 in.) in total length,[14] and they look like miniature fox snakes.[12]

Taxonomy[edit]

This species has previously been placed (and is still placed by many) in the genus Elaphe, as Elaphe obsoleta. However, Utiger et al. found that Elaphe is broadly construed as paraphyletic, and placed this species in the genus Pantherophis.[21] In addition, because Pantherophis is masculine, the specific epithet becomes the masculine obsoletus.[22] The split of Pantherophis from Elaphe has been further confirmed by additional phylogenetic studies.[23][24]

In 2001, Burbrink suggested this species be divided into three species based on geographic patterns of mitochondrial DNA diversity. He assigned new common names and resurrected old scientific names, resulting in the following combinations: eastern ratsnake (Elaphe alleghaniensis, now Pantherophis alleghaniensis), central ratsnake (Elaphe spiloides, now Pantherophis spiloides), and Gray Rat Snake (E. obsoleta). However, these three species are not morphologically distinct and overlap in all examined morphological characters.[25] More recent investigations have indicated P. alleghaniensis and P. spiloides interbreed freely in Ontario.[26]

In 2008, Collins and Taggart[27] resurrected the genus Scotophis for Burbrink's three taxa, i.e., (Scotophis alleghaniensis), (Scotophis spiloides) and (Scotophis obsoletus) in response to the findings of Burbrink and Lawson, 2007.[23] The justification for this nomenclatural change has been removed by more recent research.[24]

References[edit]

  1. ^ "Elaphe obsoleta". Natural Heritage Information Centre. Ontario Ministry of Natural Resources. Retrieved October 19, 2010. 
  2. ^ The Reptile Database. www.reptile-database.org.
  3. ^ Pantherophis obsoletus, The Reptile Database
  4. ^ Wright AH, Wright AA. (1957). Handbook of Snakes of the United States and Canada. Comstock Publishing Associates. Ithaca, New York. (7th printing, 1985). ISBN 0-8014-0463-0.
  5. ^ "Elaphe obsoleta". Integrated Taxonomic Information System. Retrieved 29 November 2006. 
  6. ^ US National Zoo. "Black Rat Snake". Retrieved 09-04-2014.  Check date values in: |accessdate= (help)
  7. ^ Eastern Ratsnake, Herps of Texas
  8. ^ a b Species profile: Minnesota DNR. Dnr.state.mn.us. Retrieved on 2012-12-19.
  9. ^ Conant, R., and W. Bridges. (1939). What Snake Is That? A Field Guide to the Snakes of the United States East of the Rocky Mountains. D. Appleton-Century. New York. Frontispiece map + viii + pp. 1-26 + Plates A-C, 1-32 + pp. 27-163. (Elaphe obsoleta obsoleta, pp. 56-58 + Plate 8, Figure 23.)
  10. ^ Pantherophis obsoletus obsoletus (Say, 1823). Reptilia.forumpro.fr. Retrieved on 2012-12-19.
  11. ^ Black Rat Snake Info. Qrg.northwestern.edu. Retrieved on 2012-12-19.
  12. ^ a b c Schmidt, K.P., and Davis, D.D. (1941). Field Book of Snakes of the United States and Canada. G.P. Putnam's Sons. New York. xiii + 365 pp. (Elaphe obsoleta obsoleta, pp. 148-150, Figure 40. + Plate 16, Center, on p.336.)
  13. ^ Conant, R. (1975). A Field Guide to Reptiles and Amphibians of Eastern and Central North America. Houghton Mifflin. Boston. xviii + 429 pp. ISBN 0-395-19977-8 (paperback). (Elaphe obsoleta obsoleta, pp. 193-194 + Plate 28 + Map 149.)
  14. ^ a b Wright, A.H., and Wright, A.A. (1957). Handbook of Snakes of the United States and Canada. Comstock. Ithaca and London. 1105 pp. (in 2 volumes) (Elaphe obsoleta obsoleta, pp. 230-234, Figure 72. + Map 24. on p. 235.)
  15. ^ a b Eastern Ratsnake. Pantherophis alleghaniensis. Natural Heritage Endangered Program. mass.gov
  16. ^ Fact Sheet at Smithsonian National Zoological Park Website. Nationalzoo.si.edu. Retrieved on 2012-12-19.
  17. ^ Bent, A. C. 1937. Life Histories of North American Birds of Prey. Part 1. Smithsonian Institution U.S. National Museum Bulletin, no. 167.
  18. ^ Bent, A. C. 1938. Life Histories of North American Birds of Prey. Part 2. Smithsonian Institution U.S. National Museum Bulletin, no. 170.
  19. ^ Rat Snakes. Purplemartin.org. Retrieved on 2012-12-19.
  20. ^ Black snake profile at Smithsonian National Zoological Park website. Nationalzoo.si.edu. Retrieved on 2012-12-19.
  21. ^ Utiger, U., Helfenberger, N.; Schätti, B.; Schmidt, C.; Ruf, M. and Ziswiler, V. (2002). "Molecular Systematics and Phylogeny of Old and New World ratsnakes, Elaphe Auct., and related genera (Reptilia, Squamata, Colubridae)". Russian Journal of Herpetology 9 (2): 105–124. 
  22. ^ Elaphe obsoleta at The Center for North American Herpetology. Accessed 20 June 2008.
  23. ^ a b Burbrink, F. T. and Lawson, R. (2007). "How and when did Old World ratsnakes disperse into the New World?". Molecular Phylogenetics and Evolution 43 (1): 173–189. doi:10.1016/j.ympev.2006.09.009. PMID 17113316. 
  24. ^ a b Pyron, R. A. and Burbrink, F. T. (2009). "Neogene diversification and taxonomic stability in the snake tribe Lampropeltini (Serpentes: Colubridae)". Molecular Phylogenetics and Evolution 52 (2): 524–529. doi:10.1016/j.ympev.2009.02.008. PMID 19236930. 
  25. ^ Burbrink, F.T. (2001). "Systematics of the Eastern Ratsnake complex (Elaphe obsoleta). Herpetological Monographs" 15. pp. 1–53. JSTOR 1467037. 
  26. ^ Gibbs, H. L., Corey, S. J.; Blouin-Demers, G.; Prior, K. A. and Weatherhead, P. J. (2006). "Hybridization between mtDNA-defined phylogeographic lineages of black ratsnakes (Pantherophis spp.)". Molecular Ecology 15 (12): 3755–3767. doi:10.1111/j.1365-294X.2006.03056.x. PMID 17032272. 
  27. ^ Collins, J. T. and Taggart, T. W. (2008). "An alternative classification of the New World Rat Snakes (genus Pantherophis [Reptilia: Squamata: Colubridae])". Journal of Kansas Herpetology 26: 16–18. 

Further reading[edit]

  • Say, T. In James, E. (1823). Account of an Expedition from Pittsburgh to the Rocky Mountains, Performed in the Years 1819 and '20, by Order of the Hon. J.C. Calhoun, Sec'y of War: Under the Command of Major Stephen H. Long. From the Notes of Major Long, Mr. T. Say, and other Gentlemen of the Exploring Party. Vol. I. Philadelphia: H.C. Carey and I. Lea. 503 pp. (Coluber obsoletus, p. 140).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Elaphe obsoleta lindheimeri

The Texas rat snake (Elaphe obsoleta lindheimeri) is a subspecies of rat snake, a nonvenomous colubrid found in the United States, primarily within the state of Texas, but its range extends into Louisiana, Arkansas and Oklahoma.[1] It intergrades with other subspecies of Elaphe obsoleta, so exact range boundaries are impossible to distinguish.[2] The epithet lindheimeri is to honor the German-American naturalist Ferdinand Jacob Lindheimer, who collected the first specimen in New Braunfels, Texas.[3]

Description[edit]

The Texas rat snake is a fairly large snake, capable of attaining lengths past six feet.[2] They vary greatly in color and patterning throughout their range, but they are typically yellow or tan in color, with brown to olive-green, irregular blotching from head to tail. Specimens from the southern area of their range tend to have more yellow, while those from the northern range tend to be darker. One way to distinguish them from other rat snakes is they are the only ones with a solid grey head. Some specimens have red or orange speckling. The belly is typically a solid gray or white in color. The several naturally occurring color variations include albinos, high orange or hypomelanistic, and a few specimens which display leucism which have become regularly captive-bred and are popular in the pet trade.

Diet[edit]

The Texas rat snake has a voracious appetite, consuming large numbers of rodents and birds, and sometimes lizards and frogs which they subdue with constriction. They are generalists, found in a wide range of habitats from swamps, to forests to grasslands, even in urban areas. They are agile climbers, able to reach bird nests with relative ease.[2] They are often found around farmland, and will sometimes consume fledgeling chickens and eggs, which leads them to be erroneously called the chicken snake. They are known for their attitude, and will typically bite if handled, though their bite is harmless.[2]

Taxonomy[edit]

Many sources continue to refer to the Texas rat snake by its scientific name, Elaphe obsoleta lindheimeri, though all North American rat snake species were suggested for reclassification to the genus Pantherophis. A further revision of Pantherophis obsoletus has recommended the elimination of the various subspecies entirely, considering them all to be merely locality variations. However, the ICZN has rejected the renaming, and thus Elaphe remains the genus name.

Gallery[edit]

References[edit]

  1. ^ "Hibbits, Troy, "Elaphe obsoleta lindheimeri (Texas Rat Snake)," Kingsnake.com (accessed May 7, 2010).
  2. ^ a b c d "Elaphe obsoleta," Herpes of Texas (accessed May 7, 2010).
  3. ^ Ferdinand Jacob Lindheimer
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Burbrink et al. (2000) and Burbrink (2001) examined genetic and morphological variation in Elaphe obsoleta and determined that the nominal subspecies do not represent evolutionary lineages and should no longer be recognized. Further, these authors identified three clades within E. obsoleta, corresponding to populations (1) west of the Mississippi River (western clade), (2) east of the Mississippi River and west of the Appalachian Mountains and Apalachicola River (central clade), and (3) east of the Appalachians and the Apalachicola River (eastern clade). Burbrink (2000) recognized the three clades as distinct species: E. obsoleta (western clade), E. spiloides (central clade), and E. alleghaniensis (eastern clade). In mapping the distribution of the species, Burbrink indicated a very large area of "taxonomic uncertainty" extending from New England to northern Georgia. In this region the distribution of E. alleghaniensis was deemed "somewhat questionable with regard to hybridization with members of Elaphe spiloides." Although Burbrink concluded that the molecular data show that E. alleghaniensis and E. spiloides represent independently evolving units with separate evolutionary histories and thus should be recognized as different species under the evolutionary species concept, contact zones were not critically examined, so the nature and dimensions of clade boundaries, and the precise distributions of alleghaniensis and spiloides along the length of the Appalachians, remain uncertain. Jensen et al. (2008, Amphibians and Reptiles of Georgia) mentioned Burbrink's proposed split but did not adopt it.

Molecular data indicate that Elaphe obsoleta lindheimeri, E. o. quadrivittata, and E. o. rossalleni are not distinct evolutionary lineages (Burbrink et al. 2000). The checklists by Crother et al. (2003) and Crother (2008) did not accept lindheimeri, quadrivittata, or rossalleni as valid taxa.

Elaphe bairdi, confirmed as a valid species by Burbrink (2001), was included in Elaphe obsoleta by some authors in older literature.

Utiger et al. (2002) examined mtDNA variation in New World and Old World "Elaphe" and determined that North American rat snakes currently included in the genus Elaphe form a monophyletic limeage that is distinct from Old World snakes that also have been regarded as Elaphe. They resurrected the genus Pantherophis for the rat snakes north of Mexico, including the following species: Pantherophis obsoletus (and P. alleghaniensis and P. spiloides, if one recognizes those taxa as species), P. guttatus, P. emoryi, P. vulpinus, P. gloydi, and P. bairdi. Based on mtDNA and nuclear DNA data, Burbrink and Lawson (2007) determined that New World Elaphe are not closely related to Old World Elaphe. Here we follow these studies and Crother (2008) and transfer New World Elaphe to the genus Pantherophis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!