Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is endemic to the United States. Its range extends from the Upper Peninsula of Michigan through Wisconsin, southern Minnesota, and Iowa to eastern Nebraska (possibly extreme northeastern Kansas), South Dakota, and northwestern Missouri and through northern and western Illinois to northwestern Indiana (Vogt 1981, Powell 1990, Oldfield and Moriarty 1994, Harding 1997, Phillips et al. 1999, Minton 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Western fox snakes are found from the central part of Michigan's upper peninsula west into South Dakota, Missouri, and Indiana.

Biogeographic Regions: nearctic (Native )

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians Eastern/Central North America. New York, NY: Houghton Mifflin Company.
  • Michigan Natural Features Inventory, 2004. "Eastern fox snake" (On-line). Michigan Natural Features Inventory. Accessed November 03, 2006 at web4.msue.msu.edu/mnfi/abstracts/zoology/Elaphe_vulpina_gloydi.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Western fox snakes (Pantherophis vulpinus) are found in farmlands, prairies, stream valleys, woods, and dune habitats from the central upper peninsula of Michigan, through Wisconsin, Minnesota, Illinois, Iowa, and into northwestern Indiana, Missouri, Nebraska, and South Dakota.

Biogeographic Regions: nearctic (Native )

  • Conant, R., J. Collins. 1998. Reptiles and Amphibians Eastern/Central North America. New York, NY: Houghton Mifflin Company.
  • Michigan Natural Features Inventory, 2004. "Eastern fox snake" (On-line). Michigan Natural Features Inventory. Accessed November 03, 2006 at web4.msue.msu.edu/mnfi/abstracts/zoology/Elaphe_vulpina_gloydi.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: North-America
Distribution: USA (SE South Dakota, E Nebraska, SE Minnesota, Iowa, N Missouri, Wisconsin, Illinois, NW Indiana, E Michigan, N Ohio),  SW Canada  
Type locality: USA: Wisconsin, Racine County, Racine (Baird & Girard, 1853)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Under the taxonmic concept of Crother et al. (2011), the range includes two apparently disjunct regions: northern Wisconsin and the Upper Peninsula of Michigan southward to east-central Missouri, southern Illinois, and central Indiana (Vogt 1981, Powell 1990, Oldfield and Moriarty 1994, Harding 1997, Phillips et al. 1999, Minton 2001); and the Great Lakes basin in southern Ontario, the southeastern part of the lower peninsula of Michigan, and northern Ohio; north to near Saginaw Bay (Michigan) and Georgian Bay (Ontario); eastward along northern Lake Erie to Long Point Bay (Ontario) and along southern Lake Erie to Erie County, Ohio; the range includes Pelee Island and some smaller Lake Erie islands; isolated records from near Buffalo, New York, and the western end of Lake Ontario (Ontario) have not been confirmed; a record from Massachusetts probably reflects erroneous data (Conant 1938, 1940, 1951; Powell 1990; Harding 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Western fox snakes are usually between 91 and 137 cm long. The published record is 179 cm. They are blotched snake, with light brown to black spots. The head varies from brown to reddish. The reddish head is often mistaken as a copperhead and often spells the end of that snake. The belly is yellow and checkered with black. The scales are weakly keeled. The young look distinctively different. The dark spots are rich brown usually edged with black or dark brown. The head has a dark transverse line anterior to eyes and a dark line from eye to angle of jaw. The lines on the head fade away with age. Western fox snakes have an average of 41 blotches.

Range length: 91 to 179 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Western fox snakes are usually between 91 and 137 cm long. The published record is 179 cm. They are blotched snake, with light brown to black spots. The head varies from brown to reddish. The reddish head is often mistaken as a copperhead and often spells the end of that snake. The belly is yellow and checkered with black. The scales are weakly keeled. The young look distinctively different. The dark spots are rich brown usually edged with black or dark brown. The head has a dark transverse line anterior to eyes and a dark line from eye to angle of jaw. The lines on the head fade away with age. Western fox snakes have an average of 41 blotches.

Range length: 91 to 179 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 179 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

P. ramspotti has an average dorsal body blotch count anterior to the cloaca of 42.8, whereas P. vulpinus has an average of 36.8 dorsal body blotches (Crother et al. 2011). The two species differ in mtDNA characteristics.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Pantherophis vulpinus
Catalog Number: USNM 1570
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Grosse Isle, Wayne, Michigan, United States, North America
  • Paratype: Conant, R. 1940. Herpetologica. 2 (1): 10.; Baird, S. F. & Girard, C. 1853. Smithsonian Miscellaneous Collections. 2 (5): 75.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neotype for Pantherophis vulpinus
Catalog Number: USNM 9969
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Racine, Wisconsin, United States, North America
  • Neotype: Conant, R. 1940. Herpetologica. 2 (1): 10.; Baird, S. F. & Girard, C. 1853. Smithsonian Miscellaneous Collections. 2 (5): 75.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Comments: Western portion of range: Habitats include dry and moist areas of farmland, prairie, pastures, open woodland (hardwoods, pines), forest edge, logged forest and old woodlots, woods near streams, stream valleys, pine barrens, oak savanna, and sandy oak scrub (Vogt 1981, Oldfield and Moriarty 1994, Harding 1997, Phillips et al. 1999, Minton 2001). This snake may spend much time in burrows and usually is found on the ground; it may hibernate in crevices, burrows, or old wells, sometimes underwater (Vogt 1981). Eggs are laid in old stumps, humus, or under logs and other objects on the ground (Vogt 1981).

Eastern portion of range: This snake inhabits shoreline marshes and vegetated dunes and beaches of the Great Lakes; it sometimes ranges into adjacent farm fields, pastures, and woodlots; it occupies rocky areas and open woodlands on Lake Erie islands; it rarely climbs into trees or shrubs, and it readily crosses bodies of water; hibernation occurs in mammal burrows, old buildings, or similar shelters (Harding 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitats include dry and moist areas of farmland, prairie, pastures, open woodland (hardwoods, pines), forest edge, logged forest and old woodlots, woods near streams, stream valleys, pine barrens, oak savanna, and sandy oak scrub (Vogt 1981, Oldfield and Moriarty 1994, Harding 1997, Phillips et al. 1999, Minton 2001). This snake may spend much time in burrows and usually is found on the ground; it may hibernate in crevices, burrows, or old wells, sometimes underwater (Vogt 1981). Eggs are laid in old stumps, humus, or under logs and other objects on the ground (Vogt 1981).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western fox snakes are found in grasslands, prairies, dune areas, farm fields, pastures, and woodlots. They are typically found fairly close to water. Like all snakes, they can be found basking near the edge of marshes or in grassland clearings.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western fox snakes are found in grasslands, prairies, dune areas, farm fields, pastures, and woodlots. They are typically found fairly close to water. Like all snakes, they can be found basking near the edge of marshes or in grassland clearings.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: marsh

Other Habitat Features: agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats small mammals, frogs, birds, and bird eggs (Vogt 1981) Young also eat lizards, snakes, and invertebrates (Minton 1972).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Western fox snakes eat small mammals and occasional birds. They eat Microtus pennsylvanicus, Peromyscus, eggs, fledgling birds, and newborn Sylvilagus. Western fox snakes kill their prey by constriction.

Animal Foods: birds; mammals

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Western fox snakes eat small mammals and occasional birds. They eat meadow voles, deer mice, eggs, fledgling birds, and newborn rabbits. Western fox snakes kill their prey by constriction.

Animal Foods: birds; mammals

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 - 1,000,000 individuals

Comments: Adult population size is unknown but presumably exceeds 10,000 and undoubtedly is much larger than that. This snake is locally common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Generally active from about April to October. Mostly diurnal but also active at night during rains. (Vogt 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
17 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of 6-29 eggs, late June to early August. Eggs hatch late August to October.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western fox snakes mate from April to July. The female lays her eggs anywhere from late June to early August. She usually lays from 6 to 29 firm leathery eggs that are from 3.8 to 5 cm long. The young hatch from late August to October and are 25.5 to 33 cm long.

Breeding interval: Western fox snakes breed once each year.

Breeding season: Western fox snakes mate from April to July.

Range number of offspring: 6 to 29.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western fox snakes mate from April to July. The female lays her eggs anywhere from late June to early August. She usually lays from 6 to 29 firm leathery eggs that are from 3.8 to 5 cm long. The young hatch from late August to October and are 25.5 to 33 cm long.

Breeding interval: Western fox snakes breed once each year.

Breeding season: Western fox snakes mate from April to July.

Range number of offspring: 6 to 29.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Elaphe vulpina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Pantherophis vulpinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCGGTACAGGATGAACCGTATATCCCCCGCTGTCGGGAAATCTAGTACACTCAGGCCCATCAGTAGACCTAGCAATCTTCTCCTTACATCTAGCAGGCGCCTCCTCCATCCTGGGGGCAATTAACTTCATTACAACATGTATTAATATAAAACCTAAATCCATACCAATATTTAATATTCCCCTATTTGTTTGATCCGTACTTATTACTGCCATTATACTACTATTAGCCCTACCTGTCTTAGCAGCAGCAATCACCATACTTTTAACTGATCGAAATCTAAATACCTCCTTCTTCGATCCCTGTGGGGGAGGAGACCCCGTACTATTTCAACATCTATTTTGATTCTTCGGTCACCCAGAAGTATATATCCTAATTCTACCAGGATTCGGCATTGTCTCTAGCATCATTACATTCTATACTGGAAAAAAGAACACATTTGGATACACAAGCATAATCTGAGCAATAATATCCATTGCAATTTTAGGCTTTGTGGTTTGAGCACATCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pantherophis vulpinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, tolerance of a degree of habitat modification, presumed large population, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western fox snakes are often mistaken for rattlesnakes. As a result they are often indiscriminately killed. In fact, they are harmless and beneficial. Western fox snake populations also suffer from habitat destruction, illegal collecting, and being hit by cars. Currently populations of western fox snakes are considered stable.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western fox snakes are often mistaken for rattlesnakes. As a result they are often indiscriminately killed. In fact, they are harmless and beneficial. Western fox snake populations also suffer from habitat destruction, illegal collecting, and being hit by cars. Currently populations of western fox snakes are considered stable.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupnacy, number of subpopulations, and population size probably have been relatively stable ove the past 10 years or 3 generations.

Global Long Term Trend: Relatively stable to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations). The adult population size is unknown but presumably exceeds 10,000 and undoubtedly is much larger than that. This snake is locally common. The extent of occurrence, area of occupancy, number of subpopulations, and population size are probably relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: No major threats are known. This snake thrives on partial deforestation and where farming is not too extensively intensive.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known. This snake thrives on partial deforestation and where farming is not too extensively intensive.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Many occurrences are in protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Western fox snakes are harmless snakes, there are no negative effects of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Western fox snakes help keep pest populations down. They often inhabit agricultural lands and prey on rabbits and rodents.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Western fox snakes are harmless snakes, there are no negative effects of this species on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Western fox snakes help keep pest populations down. They often inhabit agricultural lands and prey on rabbits and rodents.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pantherophis vulpina

Pantherophis vulpinus, commonly known as the western foxsnake[1] or western fox snake, is a species of nonvenomous colubrid snake, which is endemic to North America.

Description[edit]

Closeup of head.

Adult western foxsnakes are 3 to 6 feet (0.91 to 1.83 m) in total length (including tail), and have a short, flattened snout. Dorsally, they are usually light golden brown with dark brown spots, and they have a yellow checkerboard pattern on the belly.

Like most North American snakes, foxsnakes are not venomous. Foxsnakes earned their name because the musk they give off when threatened smells similar to a fox.[2]

Geographic range[edit]

Pantherophis vulpinus is found in the upper midwestern United States, from Wisconsin west to South Dakota and south to Illinois and Indiana.

The geographic range of the closely related eastern foxsnake (Pantherophis gloydi) skirts the Great Lakes in Michigan, Ohio, and Ontario. The two species do not overlap, and there is no intergrade zone.

Habitat[edit]

Varied, including open woodland, prairie, farmland, pastures, and marshlands.

Behavior[edit]

These strong, agile snakes are also excellent climbers but are more often found on the ground. Foxsnakes are diurnal, but may hunt at night during the hot summer months. Like all snakes, foxsnakes are cold-blooded and cannot adjust their own body temperature; so these snakes often hide in burrows or under logs or rocks to stay safe from extremely hot or cold weather. In winter, they hibernate underground, where they can avoid freezing temperatures.

These docile, harmless snakes use several defensive behaviors against predators. They may shake their tails in dry leaves, sounding like rattlesnakes.[3] They can also give off a stinky musk from glands near their tail, which makes them less appetizing to other animals. As a last resort, these snakes may hiss loudly and strike at the threat.

Diet[edit]

Like all snakes, foxsnakes are strict carnivores. Their primary diet consists of mice and other small rodents, but they will take any prey small enough to swallow whole, including young rabbits, frogs, fledglingbirds, and eggs. As constrictors, they subdue their prey by squeezing it between their coils.

Life history[edit]

Foxsnakes mate in April and May. Males wrestle with one another for the right to mate with females. In June, July, or August, the female will bury a clutch of 7 to 27 eggs under a log or in debris on the forest floor. These hatch after an approximately 60 day incubation period. Young foxsnakes are usually much lighter in color than adults.

They are often a welcome sight around farmland, where they consume a large number of rodents that can otherwise be harmful to crops, or transmit parasites to captive animal stocks. Though, they are opportunistic feeders, and will sometimes also eat fledgling chickens or eggs, which sometimes leads them to be erroneously called the chicken snake.

Conservation status[edit]

The western foxsnake is not listed on the IUCN Red List of Threatened and Endangered Species or CITES. While this snake is common within its range, many states have protected it, primarily to prevent over-collection for the pet trade.

References[edit]

  1. ^ Crother BI (editor). 2008. Scientific and Standard English Names of Amphibians and Reptiles of North America North of Mexico. Society for the Study of Amphibians and Reptiles Herpetological Circular 37. 84 pp.PDF at SSAR. Accessed 4 July 2011.
  2. ^ Morris PA. 1948. Boy's Book of Snakes, How to Recognize and Understand Them. A volume of the Humanizing Science Series, edited by Jaques Cattell. New York: Ronald Press. viii + 185 pp. (Elaphe vulpina vulpina, pp. 90-91, 180).
  3. ^ Schmidt KP, Davis DD. 1941. Field Book of Snakes of the United States and Canada. New York: G.P. Putnam's Sons. 365 pp. (Elaphe vulpina vulpina, pp. 153-155, Figure 42 + Plates 5, 17).

Further reading[edit]

  • Baird SF, Girard CF. 1853. Catalogue of North American Reptiles in the Museum of the Smithsonian Institution. Part I.—Serpents. Washington, District of Columbia: Smithsonian Institution. xvi + 172 pp. (Scotophis vulpinus, new species, pp. 75–76).
  • Behler JL, King FW. 1979 (1994). National Audubon Society Field Guide to North American Reptiles and Amphibians. New York: Knopf. 743 pp. ISBN 0-394-50824-6. (Elaphe vulpina, pp. 608–609).
  • Boulenger GA. 1894. Catalogue of the Snakes in the British Museum (Natural History). Volume II., Containing the Conclusion of the Colubridæ Aglyphæ. London: Trustees of the British Museum (Natural History). (Taylor and Francis, printers). xi + 382 pp. + Plates I-XX. (Coluber vulpinus, p. 49).
  • Conant R. 1975. A Field Guide to Reptiles and Amphibians of Eastern and Central North America, Second Edition. Boston: Houghton Mifflin. xviii + 429 pp. + Plates 1-48. ISBN 0-395-19979-4 (hardcover), ISBN 0-395-19977-8 (paperback). (Elaphe vulpina vulpina, pp. 191–193, Figure 44 + Plate 28 + Map 148).
  • Conant R, Bridges W. 1939. What Snake is That?: A Field Guide to the Snakes of the United States East of the Rocky Mountains. New York and London: D. Appleton-Century. Frontispiece map + 163 pp. + Plates A-C, 1-32. (Elaphe vulpina, pp. 62–63 + Plate 9, Figure 26).
  • Harding JH. 1997. Amphibians and Reptiles of the Great Lakes Region. Ann Arbor: University of Michigan Press. 400 pp. ISBN 0472066285.
  • Wright AH, Wright AA. 1957. Handbook of Snakes of the United States and Canada. Ithaca and London: Comstock. 1,105 pp. (in 2 volumes). (Elaphe vulpina vulpina, pp. 262–266, Figure 81 + Map 23 on p. 223).
  • Zim HS, Smith HM. 1956. Reptiles and Amphibians: A Guide to Familiar American Species: A Golden Nature Guide. New York: Simon and Schuster. 160 pp. (Elaphe vulpina, pp. 92–93, 156).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Utiger et al. (2002) examined mtDNA variation in New World and Old World "Elaphe" and determined that North American rat snakes currently included in the genus Elaphe form a monophyletic limeage that is distinct from Old World snakes that also have been regarded as Elaphe. They resurrected the genus Pantherophis for the rat snakes north of Mexico, including the following species: Pantherophis obsoletus (and P. alleghaniensis and P. spiloides, if one recognizes those taxa as species), P. guttatus, P. emoryi, P. vulpinus, P. gloydi, and P. bairdi. Based on mtDNA and nuclear DNA data, Burbrink and Lawson (2007) determined that New World Elaphe are not closely related to Old World Elaphe. Here we follow these studies and Crother (2008) and transfer New World Elaphe to the genus Pantherophis.

Based on a phylogenetic analysis of mtDNA data, Crother et al. (2011) determined that populations of Pantherophis vulpinus west of the Mississippi River should be recognized as a distinct species (Pantherophis ramscotti), whereas populations of P. vulpinus east of the Mississippi River represent a single species (P. vulpinus). The authors concluded that nominal P. gloydi of the eastern Great Lakes basin should be regarded as conspecific with P. vulpinus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!