Overview

Distribution

Yellow anacondas occur in southern South America, including Paraguay, southern Brazil, northeastern Argentina, and Bolivia.

Biogeographic Regions: neotropical (Native )

  • Burton, M. 1967. Reptiles (Class Reptilia). Pp. 320 in R Murphy, ed. The Larousse Encyclopedia of Animal Life, Vol. 1, 1 Edition. New York: McGRAW-HILL BOOK COMPANY.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: South-America
Distribution: Bolivia, Paraguay, Uruguay, W Brazil (Mato Grosso, Mato Grosso do Sul, Rio Grande do Sul, Paraná [HR 27: 216], São Paulo), NE Argentina (Chaco, Corrientes, Entre Rios, Formosa, Misiones, Santa Fé).  
Type locality: Paraguay River and its tributaries
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Although yellow anacondas are much smaller than green anacondas (Eunectes murinus, the world's largest snakes) they do reach lengths of up to 4.6 meters (typical adult range 3 to 4 m). Yellow anacondas have yellowish-green scales with brown or blackish bands and overlapping spots that wrap around the entire body. This provides camouflage in murky water or in forest vegetation. Females grow longer than males and generally weigh more as well. Male yellow anacondas can reach up to 3.7 m in length while a female can reach a length of 4.6 m.

Range mass: 40 (high) kg.

Average mass: 30 kg.

Range length: 2.4 to 4.6 m.

Average length: 3.7 m.

Other Physical Features: heterothermic

Sexual Dimorphism: female larger

  • Mattison, C. 1986. Snakes Of The World. New York: Facts On File Publications.
  • Owen, W. 2004. Snakes:Reptiles. Pp. 397 in J Flew, L Humphries, eds. The Encyclopedia of Animals, Vol. 1, 1 Edition. Los Angeles: Unioversity of California Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Yellow anacondas can be found in swamps and marshlands with slow-moving rivers or streams. They can also be observed in forests searching for large game, such as brocket deer or peccaries. During droughts they can be found using caves for shelter and along river banks in holes that retain water. During the rainy months, yellow anacondas can be found in flooded, treeless areas, where they hunt for aquatic species such as fish or caimans (Caiman).

Habitat Regions: tropical ; terrestrial ; freshwater

Terrestrial Biomes: rainforest

Aquatic Biomes: rivers and streams

Wetlands: marsh ; swamp

Other Habitat Features: riparian ; caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Yellow anacondas are generalist carnivorous, preying mainly on animals found in wetland and riparian areas throughout their range. Their diet consists of birds, bird eggs, small mammals, turtles, lizards, occasional fish or fish carrion, and caimans. Wading birds may be their most common prey in some areas. They can reach sizes sufficient to take larger prey, such as brocket deer, peccaries, or capybaras. Yellow anacondas are considered ambush hunters and constrictors. They lay in wait in the water or in vegetation and strike at prey that pass. When prey are grabbed, they begin to wrap their body around the prey and begin constriction. With each exhalation of the prey, the constrictor can squeeze tighter, eventually causing asphyxiation. They may also pull the prey under water during constriction. Yellow anacondas then swallow prey head first by unhinging their jaws, as do other snakes. Along with their incredible jaw flexibility, yellow anacondas have more than a 100 recurved teeth that help to hold and swallow prey. Their digestive system is relatively slow and yellow anacondas may eat only every few days or months, depending on the size of their last prey item. Like other snakes, yellow anacondas can survive long periods without prey. In the wild most predation occurs from June to November, during the relatively dry periods when wetlands areas have shrunk.

Animal Foods: birds; mammals; reptiles; fish; eggs; carrion

Primary Diet: carnivore (Eats terrestrial vertebrates)

  • Linley, M. 1993. Snakes. New York: Thomson Learning.
  • Parker, H. 1963. Snakes of The Wolrd: Their Ways and Means of Living. New York: Dover Publications.
  • Strussmann, C. 1997. Feeding habits of the yellow anacond. Eunectes notaeus Cope,1862, in the Brazilian Pantanal, 5/1: 35-52.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Adult yellow anacondas are keystone species; they are one of the top predators in the ecosystems they inhabit. Yellow anacondas influence the number of prey animals, which influences the populations of other prey animals and predators. Ticks from the family Ixodidae are found on yellow anacondas. However, yellow anacondas produce an odor that deters ticks from attaching themselves.

Ecosystem Impact: keystone species

Commensal/Parasitic Species:

  • ticks (Ixodidae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult yellow anacondas have no natural predators. Humans are their main predators and they are hunted for their skin, for the zoo and pet trade, persecuted out of fear, and their habitats are destroyed. Predators of juvenile yellow anacondas include crab-eating foxes (Cerdocyon thous), tegu lizards (Tupinambis merianae), caimans (Caiman crocodilus), and larger anacondas (Eunectes).  In order to avoid predation, young anacondas are camouflaged, as their dark-spotted patterns hides them in the vegetation.

Known Predators:

  • caimans (Caiman crocodilus)
  • humans (Homo sapiens)
  • tegu lizards (Tupinambis merianae)
  • crab-eating foxes (Cerdocyon thous)
  • anacondas (Eunectes)

Anti-predator Adaptations: cryptic

  • 1971. Anaconda. Pp. 45 in M Burton, ed. The World Encyclopedia of Animals, Vol. 1, 1 Edition. New York: World Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Yellow anacondas are solitary animals, except in breeding season. Females attract mates through pheromones. Male anacondas will follow this pheromone trail and, once the potential mates encounter one another, they communicate by rubbing one another and proceed with courtship. All anacondas (Eunectes) have heat-sensing pits located along their mouths. These pits are used to find prey by detecting body heat given off by warm blooded animals. Like most snakes, yellow anacondas do not hear well, although they can pick up vibrations through their jaws. Yellow anacondas, like most snakes, rely heavily on their fork-like tongues and chemosensation to navigate their environment and help find prey. The tongue is flicked in and out of the mouth to taste the air, chemicals collected by the tip of the tongue are deposited in the vomeronasal organ on the top of the mouth.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; infrared/heat ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Females, after a 6 month gestation period, give birth to fully-developed live young. These young are immediately able to live on their own. Yellow anacondas seem to have indeterminate growth.

Development - Life Cycle: indeterminate growth

  • Leen, N. 1978. Snakes. New York: Holt, Rinehart and Winston.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Most mortality in yellow anacondas occurs as young, when they are smaller and vulnerable to predation. Once they reach adult sizes, yellow anacondas have few natural predators. The typical lifespan for yellow anacondas in the wild is from 15 to 20 years. In captivity yellow anacondas can live up to 23 years. Humans greatly influence the lifespan of yellow anacondas in the wild, as poaching has decreased the number of yellow anacondas to a dangerously unstable level.

Range lifespan

Status: captivity:
23 (high) years.

Typical lifespan

Status: wild:
15 to 20 years.

  • Simon, S. 1992. Snakes. 1992: HarperCollins Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.6 years (captivity) Observations: They live about 15-20 years in zoos (http://www.zoo.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

For the most part, yellow anacondas are sequentially monogamous. Males become attracted to females when she produces pheromones released into the air. Males then follows the scent to the female and begin courtship. This courtship normally will take place in water and may last for quite some time. Yellow anacondas have been known to form breeding balls, consisting of one female and multiple males. These breeding balls have been known to stay together for up to a month. In the breeding ball, males compete for mating access to the female. Normally the largest male will win successfully outcompete other males. Larger males may successfully breed with more females as a result.

Mating System: polygynous ; polygynandrous (promiscuous)

Yellow anacondas breed between April and May every year. Females incubate eggs in their bodies and give birth to already hatched young. The gestation period is 6 months, after which the female gives birth to from 4 to 82 young at a size of about 60 cm in length. After giving birth, female anacondas leave her young to defend for themselves. Young anacondas reach sexual maturity at 3 to 4 years old.

Breeding interval: Yellow anacondas breed once yearly.

Breeding season: Breeding occurs in April and May.

Range number of offspring: 4 to 82.

Average number of offspring: 40.

Average gestation period: 6 months.

Range time to independence: 0 (low) days.

Average time to independence: 0 days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization ; ovoviviparous

Females provide significant resources to their young during incubation, but the young are independent at birth and there is no further parental care.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Grzimek, B., Z. Vogel, H. Wendt. 1971. Boids. Pp. 378 in H Hediger, ed. Grizimek's Animal Life Encyclopedia, Vol. 1, 1 Edition. New York: Van Nostrand Reinhold Company.
  • Mattison, C. 1995. Boidae (Boas ande phythons). Pp. 200 in C Mattison, ed. The Encyclopedia of Snakes, Vol. 1, 1 Edition. New York: Facts on File.
  • Mattison, C. 2007. The New Encyclopedia of Snakes. New Jersey: Princeton University Press.
  • Schmidt, K., R. Inger. 1982. Boas and Pythons (Family Boidae). Pp. 233-241 in The Audubon Society Encyclopedia of Animal Life, Vol. 1, 1 Edition. New York: Crown Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eunectes notaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACCCGCTGACTATTCTCAACAAACCACAAAGACATCGGCACCCTGTACCTCCTATTTGGCGCCTGATCAGGACTAATCGGGGCCTGCCTAAGCATCCTCATACGAATAGAACTAACCCAGCCCGGAACCCTATTTGGCAGC---GACCAAATCTTTAACGTGCTAGTAACAGCTCATGCATTCATCATAATCTTTTTTATAGTAATACCAATTATAATAGGCGGATTTGGAAACTGATTAATCCCATTAATAATCGGGGCCCCAGATATAGCATTCCCACGTATAAATAACATAAGTTTTTGACTACTACCACCAGCACTATTACTACTGCTGTCATCTTCATACGTAGAAGCTGGTGCCGGCACCGGCTGAACTGTATATCCACCACTTTCAAGCAATATAGTCCACTCAGGGCCATCCGTCGATCTAGCAATTTTCTCACTACATTTGGCCGGTGCCTCATCAATCCTAGGGGCAATCAACTTCATCACTACATGTATCAACATGAAACCGGCCTCCATACCAATATTCAATATCCCACTGTTTGTATGGTCCGTCATAATTACAGCAATCATACTTCTACTTGCCCTCCCAGTATTAGCAGCAGCAATCACTATACTATTAACAGACCGAAACTTAAACACCTCATTCTTTGACCCTTGCGGCGGGGGAGATCCAATCCTATTCCAACATCTCTTTTGATTCTTCGGACACCCAGAGGTATACATTTTAATTCTACCAGGATTCGGCATTATTTCTAGCATCATCACCTTCTACACCGGAAAAAAAAACACATTCGGATACACAAGTATAATCTGAGCAATAATGTCCATCGCCATTCTCGGGTTTGTTGTGTGAGCACATCACATATTTACTGTAGGCCTAGATATCGACAGTCGAGCATACTTTACGGCCGCAACCATAATTATCGCCGTCCCAACCGGGATTAAAGTATTCGGATGGCTGGCTACACTAACCGGCGGC---CAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eunectes notaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Yellow anacondas are on the IUCN Red List as threatened due to poaching. It is illegal to hunt yellow anacondas in most of South America. This law has helped population numbers to increase, but pet trading and zoos still threaten their survival.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Yellow anacondas are large and aggressive snakes that can inflict damage on humans if approached or threatened. They may even pose a predation risk to small children, but attacks on humans by yellow anacondas are exceptionally rare.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow anacondas are hunted for their skin to make merchandise such as purses, shoes, and belts. Yellow anacondas are also taken for the pet trade. However, anacondas are unpredictable and dangerous and few people take on the challenge of keeping an anaconda as a pet. Yellow anacondas are kept by zoos, where they are a popular attraction. People are intrigued by these species and also terrified by them.

Positive Impacts: pet trade ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eunectes notaeus

Eunectes notaeus (common names: yellow anaconda, Paraguayan anaconda[2]) is a nonvenomous boa species endemic to South America. No subspecies are currently recognized.[3]

Etymology[edit]

The generic name Eunectes derives from Greek and means “good swimmer”; the Neo-Latin specific name notaeus derives from Greek νωταίος/nōtaios (poetic form of Greek νωτιαίος/nōtiaios), here meaning “dorsal”. In distinguishing his new species Eunectes notaeus from Eunectes murinus, Edward Drinker Cope stated, “Dorsal scales are larger and in fewer rows."[4]

Description[edit]

Adults are not as large as the green anaconda, E. murinus, but nevertheless grow to an average of 3.3 to 4.4 m (10.8 to 14.4 ft) in total length. They commonly weigh 25 to 35 kg (55 to 77 lb), though large specimens can weigh 40 to 55 kg (88 to 121 lb) or even more.[5][6] The maximum size can certainly be larger, although confusion with its larger cousin may complicate matters. Female yellow anacondas have reportedly been measured up to 4.6 m (15.1 ft).[2][7] males are larger than females.

The color pattern consists of a yellow, golden-tan or greenish-yellow ground color overlaid with a series of black or dark brown saddles, blotches, spots and streaks.[2]

Habitat[edit]

This species prefers mostly aquatic habitats, including swamps, marshes, and brush-covered banks of slow-moving rivers and streams. They can be also observed in forests searching for large game, such as brocket deer, or peccaries.

Feeding[edit]

These snakes were studied in regularly flooded areas in the Pantanal region of southwestern Brazil. The data collected were directly observed from predatory instances, analysis and examination of gut and waste contents, and affirmations by local residents and other researchers. These studies indicate the species is a generalist feeder. The prey list analyzed and other evidence suggest E. notaeus employs both "ambush predation" and "wide-foraging" strategies. The snakes forage predominately in open, flooded habitats, in relatively shallow water; most predation instances occur from June to November, when flooded areas have noticeably dried out, with wading birds being the most common prey. They have also been known to prey on fish, turtles, small-sized caimans, lizards, birds' eggs, small mammals and fish carrion. The prey to predator weight ratio is often much higher than those known for other types of Boidae.[8]

Reproduction[edit]

For the most part, yellow anacondas are sequentially monogamous. Males become attracted to females when she produces pheromones released into the air. Males then follow the scent to the female and courtship begins. This courtship will normally take place in water and may last for quite some time. They have been known to form breeding balls consisting of one female and several males. These breeding balls have been known to stay together for up to a month. In the breeding ball, males compete for mating access to the female. Normally the largest male will win successfully out compete other males. Larger males may successfully breed with more females as a result. Mating system is polygynous, or polygynandrous (promiscuous ).

They breed only once yearly. Breeding usually occurs from April to May. About 4-82 offspring are lay at once. Females, after 6 months gestation period, give birth to fully developed live young. These young are immediately able to live on their own. They have indeterminate growth. Female reach sexual maturity from 3–4 years after birth. Males from 3–4 years also. Females provide significant resources to their young during incubation, but young are independent at birth and there is no further parental care.

Typical lifespan of yellow anacondas in the wild is 15–20 years. In captivity, it becomes much longer, about 23 years maximum.

Communication and perception[edit]

Yellow anacondas are solitary animals, except in breeding season. When courtship, they communicate by rubbing one another and proceed with courtship. As anacondas have heat sensing pits located along their mouths, pits used to find prey by detecting heat of the prey. They pick vibrations through their jaws.

Captivity[edit]

As captives, they have a reputation for being unpredictable.[2]In the US, the yellow anaconda is one of the four banned snakes. Yellow anacondas can only be sold in California.

See also[edit]

References[edit]

  1. ^ McDiarmid RW, Campbell JA, Touré T. 1999. Snake Species of the World: A Taxonomic and Geographic Reference, vol. 1. Herpetologists' League. ISBN 1-893777-00-6 (series). ISBN 1-893777-01-4 (volume).
  2. ^ a b c d Mehrtens JM. 1987. Living Snakes of the World in Color. New York: Sterling Publishers. ISBN 0-8069-6460-X.
  3. ^ "Eunectes notaeus". Integrated Taxonomic Information System. Retrieved 3 July 2008. 
  4. ^ Cope, E.D. (1862). Synopsis of the species of Holcosus and Ameiva, with diagnoses of new West Indian and South American Colubridae. Proceedings of the Academy of Natural Sciences Philadelphia 14 [1862]: 60–82.Archive, PDF.
  5. ^ What Is a Yellow Anaconda? Wisegeek.com. Retrieved on 2012-08-22.
  6. ^ Mendez M, Waller T, Micucci P, Alvarenga E, and Morales JC (2007). Genetic population structure of the yellow anaconda (Eunectes notaeus) in Northern Argentina: management implications. In: Biology of the Boas and Pythons, Robert W. Henderson and Robert Powell (eds) pp. 405–415. Eagle Mountain Publishing, LC ISBN 0972015434.
  7. ^ Owen, W. 2004. Snakes: Reptiles. p. 397 in J Flew, L Humphries (eds.) The Encyclopedia of Animals, Vol. 1. Los Angeles: University of California Press.
  8. ^ Strussmann, C (June 1997). "Feeding habits of the yellow anaconda, Eunectes notaeus Cope, 1862, in the Brazilian Pantanal". Biociencias 5 (1): 35–52. Retrieved 2008-10-06. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!