Overview

Distribution

Global Range: Native to southeastern Asia, Indonesia, and the Phillipines. Established in Hawaii (Oahu) (McKeown 1996). Apparently established in Florida (e.g., Gainesville, Butterfield and Hauge 2000; also Fort Myers and Florida Keys, Krysko et al. 2005). Established also on some Caribbean islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Tokay Geckoes are found from northeast India to the Indo-Australian Archipelago.

Biogeographic Regions: palearctic (Native ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Asia Caribbean North-America
Distribution: Bangladesh, India, Nepal, Myanmar (= Burma), Thailand, Cambodia, Laos, Vietnam, Malaysia, S China (incl. Hong Kong, Guangxi, Taiwan), Philippine Islands (Palawan, Calamian Islands, Panay, Luzon, Mindoro, Bohol, Masbate),  Indonesia (Borneo, Sumatra, Java, Sulawesi, Lombok, Flores, Timor, Aru, Komodo),  Sulu Archipelago USA (introduced to Florida and Hawaii [fide McKeown]), introuduced to Martinique (Caribbean)  azhari: Bangladesh  
Type locality: “Indiis” (in error); “Java” (designated by MERTENS 1955)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tokay Geckoes are one of the largest geckoes alive today with a length of around 35 cm. The body of a Gekko gecko is cylindrical, squat, and somewhat flattened on the upper side. The limbs are well-defined and uniformly developed. The head is large and set off from the neck, and they have large, prominent eyes with vertically-slit pupils. The eyelids of these animals are fused together and transparent. They also have remains of a rudimentary third eye on the top of their head, which is believed to coordinate their activity to light conditions.

The ears can be seen on the outside of the gecko as small holes on both sides of the head. It is possible to see straight through the head of these geckoes through their ears. Tokay Geckoes have a hearing range from about 300 Hertz to 10,000 Hertz.

They have soft, granular skin that feels velvety to the touch. The coloration of a Tokay Gecko is very important to its lifestyle. The skin is usually gray with several brownish-red to bright red spots and flecks but it has the ability to lighten or darken the coloring of its skin. They usually do so in order to blend in or to be less noticeable to other animals.

In the Gekko gecko, there are obvious male and female differences. The male is more brightly colored than the female and generally, the male is slightly larger than the female. A conspicuous difference between the sexes is the small amount of swelling at the base of the tail of the male, due to the presence of the two hemipenes. Also, the males have visible preanal and femoral pores and postanal tubercules.

Something that is very helpful to the Gekko gecko is their toes that have fine setae on them, allowing them to cling to vertical and over-hanging surfaces and move at fast speeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

GECKO-INSPIRED SURGICAL ADHESIVE

Inspired by the patterns of millions of nanoscale setae on the tokay gecko’s toes, bioengineer Jeffrey M. Karp has received patents and awards for the biodegradable, biocompatible, elastic tissue adhesive. Since 2008, Karp Lab of Harvard-MIT Science and Technology and BWH has been perfecting this noninvasive alternative to stitches and sutures for closing and sealing wounds and incisions. Also, this surgical tape will be able to release drugs to help tissues heal. For years many other scientists have mimiced the gecko toe hairs to make gecko tape and robots that can climb. One polymer scientist using carbon nanotubes remarked, “A gecko’s foot is like a perfect Post-it.”
  • 1. WWW.KARPLAB.NET
  • 2. Proceedings of the National Academy of Sciences, "A Biodegradable, Biocompatible, Gecko-inspired Tissue Adhesive,"
  • December 2007
  • 3. "Stickybot," by Sangbae Kim, Biomimetic Robotics Lab, MIT.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Christina Nicolson

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Gekko gecko
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Mangsi Isl, No Further Locality Data, Mangsee Islands, Philippines
  • Holotype: Girard, C. 1858. United States Exploring Expedition during the years 1838, 1839, 1840, 1841, 1842. Herpetology. 290, Plate 16, Figures 9-16.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

The Tokay Gecko lives in tropical rain forests, on cliffs and trees, and as pets amongst human habitation. They are arboreal (tree-dwelling and cliff-dwelling).

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Hawaii: large trees such as banyan, fig, and coconut palm; ocassionally in houses, especially in attics (McKeown 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tokay Geckoes are insectivorous. In captivity, they usually feed on springtails, mealworms, cockroaches, crickets, grasshoppers, pink mice, and locusts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
10.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23.5 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During breeding season, which lasts about 4-5 months, males copulate frequently with females, often grasping them with their mouths during copulation. During the breeding period, females lay eggs about every month. In order to attract a mate, a male has a call that can be heard over a wide area. This loud "to-kay" sound is repeated multiple times. The male approaches the female from the rear, and they move side to side while he holds her in place with his teeth, biting her in the neck region. The female looks for a laying- site, and when she finds the right one, she affixes the hard-shelled eggs (oval-shaped; anywhere from 3 mm to 45 mm) to a solid foundation where they are guarded by both parents until they hatch. In captivity, Tokay Geckoes are prone to eating their own eggs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feet self-clean: Tokay gecko
 

The feet of gecko self-clean due to energetic equilibrium--its foot has less physical attraction to dust than most surfaces.

   
  "A tokay gecko can cling to virtually any surface and support its body mass with a single toe by using the millions of keratinous setae on its toe pads. Each seta branches into hundreds of 200-nm spatulae that make intimate contact with a variety of surface profiles. We showed previously that the combined surface area of billions of spatulae maximizes van der Waals interactions to generate large adhesive and shear forces. Geckos are not known to groom their feet yet retain their stickiness for months between molts. How geckos manage to keep their feet clean while walking about with sticky toes has remained a puzzle until now. Although self-cleaning by water droplets occurs in plant and animal surfaces, no adhesive has been shown to self-clean. In the present study, we demonstrate that gecko setae are a self-cleaning adhesive. Geckos with dirty feet recovered their ability to cling to vertical surfaces after only a few steps. Self-cleaning occurred in arrays of setae isolated from the gecko. Contact mechanical models suggest that self-cleaning occurs by an energetic disequilibrium between the adhesive forces attracting a dirt particle to the substrate and those attracting the same particle to one or more spatulae. We propose that the property of self-cleaning is intrinsic to the setal nanostructure and therefore should be replicable in synthetic adhesive materials in the future."(Hansen 2005:385)
  Learn more about this functional adaptation.
  • Hansen WR; Autumn K. 2005. Evidence for self-cleaning in gecko setae. 102(2): 385-389.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Focusing mechanism enhances vision: Tokay gecko
 

The eyes of a Tokay gecko allow it to see well even when its pupil is reduced to pinprick size due to tiny holes that focus light on the same area of the retina.

   
  "The strange eye of a Tokay gecko can see only in black and white. The gecko hunts mainly by night, so has no great need for colour vision. Photographed in bright light the gecko's vertical pupil has closed down to a narrow slit to prevent the high light intensity damaging its sensitive retina, but a series of small holes remains open. It is thought that light passes through these holes to be focused on the same area of the retina, allowing the gecko to see well even when it's dim." (Foy and Oxford Scientific Films 1982:11)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gekko gecko

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC1754-06|NC_007627|Gekko gecko| GCACGCTGGTTTTTCTCGACCAATCATAAAGATATTGGCACCCTATACTTCCTATTTGGTCTCTGAGCAGGTATGGTGGGCGCAGCACTT---AGCCTCCTTATCCGTGCTGAACTAGGTCAACCAGGGGCACTCCTTGGAAAC---GACCAACTGTATAATGTAATCGTAACAGCACATGCATTTGTAATAATCTTCTTCATAGTGATACCCGTTATAATTGGGGGGTTTGGCAATTGGTTAATCCCTTTAATA---ATTGGCGCACCGGACATAGCCTTTCCACGCATAAACAATATAAGTTTCTGACTACTCCCTCCATCACTATTTCTCCTTCTGGCCTCCGCGAGTGTGGAGGCTGGGGCGGGGACAGGATGGACTGTATACCCCCCACTAGCAGCTAATCTAGCACATGCAGGCGCATCTGTCGACCTG---GCCATCTTCTCCTTACACCTAGCTGGAATCTCTTCCATCTTAGGGGCCATCAATTTTATCACCACCTGCATTAATATAAAAACCCCAAGCATAACCCAATACACGACACCCCTGTTTGTATGGTCAGTTCTAATTACTGCCGTGCTACTTCTCCTAGCACTACCAGTGCTTGCCGCC---GGCATCACCATATTGTTGACCGATCGTAATCTTAACACATCATTCTTTGACCCCGCCGGGGGCGGGGACCCCGTACTATATCAACACCTGTTCTGATTCTTTGGTCATCCAGAAGTATATATTCTAATCTTACCAGGATTCGGAATTATTTCTCACGTTATCGCCTATTACTCAGGTAAAAAG---GAACCCTTTGGCTACATGGGCATGGTTTGAGCAATAATATCTATTGGCTTCCTAGGCTTTATCGTGTGAGCACATCATATATTTACAGTAGGCATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gekko gecko

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

There is no special status for Tokay Geckoes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These animals have an unpleasant disposition and can inflict severe bites when handled.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tokay Geckoes eat pests such as cockroaches and locusts. They are sold as pets.

In parts of southeast Asia, Tokay Geckoes are regarded as harbingers of luck, good fortune, and fertility.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tokay gecko

The Tokay Gecko (Gekko gecko) is a nocturnal arboreal gecko, ranging from northeast India, to Nepal and Bangladesh, throughout Southeast Asia, Philippines to Indonesia and western New Guinea. Its native habitat is rainforest trees and cliffs, and it also frequently adapts to rural human habitations, roaming walls and ceilings at night in search of insect prey. Increasing urbanization is reducing its range. In the late 1980s and early 1990s it was introduced into Hawaii, Florida, Texas, Belize, and several Caribbean islands, where it can be considered an invasive species.

The Tokay Gecko is known as a Tuko or Toko in the Philippines, Tokkae in Malaysia, Tokek in Indonesian/Javanese, tắc kè in Vietnamese and ตุ๊กแก [túkkɛː] in Thai, for its characteristic vocalizations.


Contents

Physical characteristics

Adult male and juvenile G. gecko. Note the brownish, regenerated tail on the adult (top)

The Tokay Gecko is the second largest Gecko species, attaining lengths of about 11–20 inches for males, and 7–19 inches for females, with weights of only 150–400g. They are distinctive in appearance, with a bluish or grayish body, sporting spots ranging from light yellow to bright red. The male is more brightly colored than the female. They have large eyes with a vertical slit pupil. Eyes are brown to greenish brown and can be orange or yellow.

Males are very territorial, and will attack other male Tokays as well as other Gecko species, as well as anything else in their territory. They are solitary and only meet during the mating season. Females lay clutches of one or two hard shelled eggs which are guarded until they hatch. Tokay Geckos feed on insects and small vertebrates.[1]

The typical lifespan is 7–10 years, however in captivity some Tokays have been known to live over 18 years.[citation needed]

Call

Their mating call, a loud croak, is variously described as sounding like token, gekk-gekk or Poo-Kay where both the common and the scientific name (deriving from onomatopoeic names in Malay, Sundanese, Tagalog, Thai, or Javanese), as well as the family name Gekkonidae and the generic term gecko come from. The call is similar to the call made by Gekko smithii (Large Forest Gecko).

As pets

When the Tokay bites, they often won't let go for a few minutes or even up to an hour or more, and it is very difficult to remove without causing harm to the gecko. For this reason, it is considered to be best as an ornamental animal for experienced reptile owners.

Conservation

The Tokay Gecko or Toko is quickly becoming a threatened species in The Philippines because of indiscriminate hunting. Collecting, transporting and trading geckos without a license can be punishable by up to twelve years in jail and a fine of up to 1,000,000 pesos under Republic Act 9147 in addition to other applicable international laws. However, the trade runs unchecked due to the sheer number of illegal traders and reports of lucrative deals. Chinese buyers and other foreign nationals are rumored to pay thousands of dollars for large specimens, reportedly because of their alleged medicinal value or as commodities in the illegal wildlife trade.[2] The Philippine government has issued a warning against using geckos to treat AIDS and impotence, saying the folkloric practice in parts of Asia may put patients at risk.[citation needed]

Subspecies

Two subspecies are currently recognized.[3]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!