Overview

Brief Summary

Biology

Males reach sexual maturity once they have attained a carapace length of around 30 cm (2). Rival males will fight during the breeding season and attempt to roll one another onto their backs. They initiate courtship by a head-bobbing display and smelling the female's hind legs. This is followed by energetic circling and butting of the female's carapace. Once mating has occurred, the female lays her clutch of 3–12 eggs in a nest dug into the ground (2). Eggs are laid at the end of the wet season, between February and April, and hatch after 10 months or more (4). Hatchlings emerge within a few weeks of one another at the onset of the next rains, in November or December (4).   Radiated tortoises graze on vegetation such as leaves and grasses, flowers, fruit and cacti (2). During much of the year dead leaves also make up a substantial part of their diet (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The radiated tortoise of Madagascar is one of the most attractive of all the tortoises. The high-domed, dark carapace is marked by brilliant yellow lines that radiate from the centre of each plate and create this tortoise's distinctive pattern (2). As individuals age, the dark pigment in the shell fades, producing a lighter coloured shell (4). The legs, feet and blunt-shaped head are also yellow in colour with the exception of a dark patch on the top of the head (2). Males can be distinguished by their longer tails and a notch in the under shell (plastron), below the tail (2). Juveniles are black and off-white when they hatch, but quickly develop the adult's striking colouration (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Astrochelys radiata only occur naturally in the extreme southern  and southwestern part of the island of Madagascar. A. radiata  have also been introduced to the nearby island of Reunion (LPZ 1999).

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Radiated Tortoises are found in the dry spiny forests of southern and southwestern Madagascar, from the area of Amboasary in the south across the Karimbola and Mahafaly plateaus north of Tuléar (where the habitat is highly fragmented and tortoises may be close to extinction) to Morombe. They are usually found in a narrow band within about 50 to 100 km from the coast (Glaw and Vences 1994, Leuteritz et al. 2005). Is sympatric with Pyxis arachnoides. The species' core range compries about 10,000 square km.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Indian-Ocean
Distribution: Madagascar (Antandroy Territory in the south between the Mandrare and Menarandra waterways). Endemic.  
Type locality: "Madagascar"; restricted by Bour 1978 to "Soalara (Baie de Saint-Augustin) sud-ouest de Madagascar".
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Endemic to Madagascar, the radiated tortoise is restricted to southern areas of the island (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Growing to a carapace length of up to 16 inches and weighing up to 35 pounds, A. radiata is considered to be one of the world's most beautiful tortoises. A. radiata has the basic "tortoise" body shape which consists of the high-domed carapace, a blunt head, and elephantine feet. The legs, feet, and head are yellow except for a variably sized black patch on top of the head. The

carapace of A. radiata is brilliantly marked with yellow lines radiating from the center of each dark plate of the shell, hence the name radiated tortoise. This "star" pattern is more finely detailed and intricate than the normal pattern of other star-patterned tortoise species, such as G. elegans of India. A. radiata is also larger than G. elegans, and the scutes of the carapace are smooth, and not raised up into a bumpy, pyramidal shape as is commonly seen in the latter species. There is slight sexual dimorphism. Compared to females, male A. radiata usually have longer tails and the notch in the plastron beneath the tail is more noticeable (Kirkpatrick 1992).

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

A. radiata prefer dry regions of brush, thorn (Diderae) forests and woodlands of southern Madagascar (LPZ 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Radiated Tortoise is found in low irregular rainfall areas with xerophytic spiny vegetation dominated by Didiereaceae and Ephorbia (Durrell et al. 1989). They can be found on the high plateaus inland and also on the sandy dunes close to the coast (Leuteritz et al. 2005).

Radiated Tortoises are herbivores feeding predominantly on grasses and in some areas on the alien invasive Opuntia. On occasion they are also known to ingest animal matter. During the rainy season wild tortoises drink from water that collects on rocks after it rains (Leuteritz 2003).

Adult female tortoises range in carapace length from 24.2 - 35.6 cm and males ranged in from 28.5 - 39.5 cm (Pedrono 2008). Males exhibit distinct secondary sexual characteristics by about 26 cm carapace length (Leuteritz 2002). Mature females produce up to three clutches per season with 1–5 eggs per clutch (Leuteritz and Ravolanaivo 2005), leading to an estimated average production of two clutches of four eggs each per breeding female; an estimated 82% of mature females breed in an average year (Randriamahazo et al. 2007). No solid data exists on longevity but estimated life span is believed to be up to 100 years (Randriamahazo et al. 2007). A detailed overview of natural history is presented by Pedrono (2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits the dry thorn forests and tropical woodlands of southern Madagascar (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A. radiata is an herbivore. Grazing makes up approximently 80-

90% of their diet. They feed during the day primarily on

grasses, fruit, and succulent plants. A favorite food in the

wild is the Opuntia cactus. In captivity A. radiata is known to eat sweet potatoes, carrots, apples, bananas, alfalfa sprouts,

and melons. According to some sources A. radiata seem to be

partial to red foods. They are known to graze regularly in

the same area, thus keeping the vegetation in that area closely

trimmed. They seem to prefer new growth rather than mature

growth because of the high protein, low fiber content (Behler and Iaderosa 1991).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Average lifespan

Status: captivity:
12.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32.8 years (captivity) Observations: Although the longevity record for this species is 32.8 years (http://www.pondturtle.com/), there is considerable anecdotal evidence that these animals are extremely long-lived, likely living more than a century. There are also anecdotal reports of one animal, called "Tui Malila", offered to the Tonga royal family by Captain Cook that might have lived 188 years. While these claims are unverified, it is likely that the maximum longevity of these animals is significantly underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Males first mate upon attaining lengths of about 12 inches; females may need to be a few inches longer. The male begins this fairly noisy procedure by bobbing his head and smelling the female's hind legs and cloaca. In some cases the male may lift the female up with the front edge of his shell to keep her from moving away. The male will then proceed to mount the female from the rear while striking the anal region of his plastron against the females carapace. Hissing and grunting by the male during mating is common. Females lay from 3 to 12 eggs in a pre-excavated hole 6 to 8 inches deep and then depart. Incubation is quite long in this species, lasting usually between 145 and 231 days. Juveniles are between 32 to 40 mm upon hatching. Unlike the yellow coloration of the adults, the juveniles are a white to an off-white shade. Juveniles attain the high-domed carapace soon after hatching (Kirkpatrick 1992).

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Astrochelys radiata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TATTGGCACCCTATACTTAATCTTCGGGGCCTGAGCAGGAATGGTAGGCACAGCATTAAGCCTATTAATCCGCGCAGAACTAAGCCAACCTGGGACACTCCTAGGAGACGATCAAATCTATAATGTTATTGTCACAGCCCATGCCTTTGTCATAATTTTCTTCATAGTTATACCAATCATAATTGGCGGCTTCGGAAACTGGCTCGTACCATTAATAATTGGGGCACCAGATATGGCATTCCCACGTATAAATAATATAAGCTTCTGACTTTTACCACCATCCTTACTCCTACTGCTAGCCTCATCAGGAGTTGAAGCAGGCGCAGGTACAGGCTGGACCGTGTACCCACCATTAGCTGGAAACTTAGCCCATGCTGGTGCCTCTGTAGACCTAACTATTTTTTCCTTACATCTGGCAGGTGTATCATCAATTCTCGGGGCAATCAACTTTATTACTACAGCAATAAATATAAAATCTCCAGCCATATCACAGTACCAAACACCCTTATTCGTGTGATCCGTACTTATTACAGCTGTTCTATTACTACTCTCACTACCAGTACTTGCTGCAGGTATCACTATACTACTTACAGATCGAAACCTAAATACAACCTTTTTCGACCCCTCAGGTGGAGGAGATCCAATTTTATATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Astrochelys radiata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Unfortunately, A. radiata is severely endangered due to loss of

habitat, being poached for food, and being over exploited in the

pet trade. A. radiata is listed in Appendix I of the Convention

on International Trade in Endangered Species (CITES) which

prohibits the import or export of the species under most

conditions. However, due to the poor economic conditions of

Madagascar, many of the laws are largely ignored. No estimates

of wild populations are available, but their numbers are declining, and many authorities see the potential for a rapid decline to extinction in the wild. In the North American stud book, 400 specimens are listed as participating in captive breeding programs such as the Species Survival Plan in zoos. Captive breeding of A. radiata has shown great promise (Behler and Iaderosa 1991).

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A4d; E

Version
3.1

Year Assessed
2008

Assessor/s
Leuteritz, T. & Rioux Paquette, S. (Madagascar Tortoise and Freshwater Turtle Red List Workshop)

Reviewer/s
Rhodin, A. & Mittermeier, R.A. (IUCN SSC Tortoise & Turtle Freshwater Turtle Red List Authority)

Contributor/s

Justification
Generation time is considered as 42 years; the assessment is carried out by considering documented impacts over a period encompassing less than two past generations (67 years) and anticipated impacts on the next generation (next 33 years) for a maximum assessment period of 100 years. Available information indicates that the species has disappeared entirely from about 40% of its past range through a combination of habitat loss and exploitation, and that remaining populations have been severely depleted by recent and ongoing exploitation predominantly for domestic consumption; an overall population reduction of 80% over two past and one future generation is a conservative estimate, thus qualifying as Critically Endangered under criterion A4d. Population modelling indicates collapse and extinction in a period of on average 45 years into the future, thus meeting Critically Endangered under criterion E. Habitat loss rates approach or exceed 80% over the three generation period, thus A4c may also be met.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU – A1acd+2cd, B1+2abc) on the IUCN Red List 2002 (1), and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Historically this species has been quite abundant, often being found along roadways and has served as symbol of Madagascar's south. This is not the case anymore. Tortoises are not found along major roadways but may be locally abundant in certain areas. According to O’Brien et al. (2003) the species is declining, with its range having contracted by one fifth over the last 25 years. Lewis (1995) reports density estimates based on line distance sampling of 262.2 to 1,076.7 tortoises/km², from which he extrapolated a conservative total population size of 1.6–4 million. Leuteritz et al. (2005) reported densities of 27–5,744 tortoises/km² with a total population estimate of 12 million. Rioux Paquette et al. (2006) undertook a microsatellite genetic analysis, which identified three distinct conservation units with relatively high assignments rates. The study supported the role of the Menarandra and Manambovo Rivers as major barriers to the dispersal for most Radiated Tortoises.

Population models were calculated at the 2005 Population and Habitat Viability Analysis (PHVA) workshop based on a number of variables including estimated population size and annual harvest intensity. Depending on the variables selected, the species was predicted to reach extinction at various times, with most estimates clustering around 45 years into the future (range 20-100+ years) (Randriamahazo et al. 2007).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats to the tortoise’s survival include collection and habitat loss (Durrell et al. 1989, Nussbaum and Raxworthy, 1998, O’Brien 2002, O’Brien et al. 2003). “Collection” can be subdivided into two further categories: collection for the international wildlife trade and collection for utilization by local people.

International collection has been documented with Asian smugglers collecting tortoises for the pet trade and for their livers (Behler 2002).

However, domestic utilization of this species is of greater concern. Within Madagascar, the Mahafaly and the Antandroy, whose land covers the range of the Radiated Tortoise do not utilize the tortoise. They have a taboo (teremed a 'fady') against eating or touching the tortoises (Nussbaum and Raxworthy 1998, Lingard et al. 2003). However, large quantities of Radiated Tortoises are gathered by people from other areas of Madagascar who recently moved into this region, or by Malagasy people who are passing through. O’Brien et al. (2003) estimated that up to 45,000 adult Radiated Tortoises are harvested each year. Anecdotal information indicates that annual harvest numbers have increased since then; estimates calculated at the 2005 PHVA workshop ranged from 22,000 to 241,000 tortoises collected annually. Tortoise meat is especially popular around Christmas and Easter (Lewis 1995). Declared protected areas are insufficiently patrolled and resourced to deter large-scale collection right inside these nominal strongholds.

Besides being used as food, the Malagasy often keep the tortoises as pets and in pens with chickens and ducks as a means of warding off poultry diseases (Durrell et al. 1989, Leuteritz et al. 2005).

Habitat loss includes deforestation for use as agricultural land, the grazing of livestock, and the burning of wood for charcoal (Nussbaum and Raxworthy 1998). Recent analyses by Conservation International (May 2007) of the state of the spiny forest biome, using aerial imagery, indicate that deforestation rates have significantly increased over the last five years (compared with the period 1990-2000) (H. Crowley pers. comm. to Leuteritz). The 2001 Conservation Assessment and Management Plan (CAMP) workshop estimated habitat loss at 21-50% during the period 1990-2000, and forecast a habitat loss rate of 51-80% for the period 2001-2010. Harper et al. (2007) documented a consistent annual forest loss rate of 1.2% for the spiny forest (primary Radiated Tortoise habitat) throughout the period 1970-2000, and measured an overall reduction from 29,782 to 21,322 sq km over this period, a 29% reduction in less than one tortoise generation.

Invasive plant species affecting habitat suitability were considered a significant threat at the 2001 CAMP workshop.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The island of Madagascar has suffered widespread habitat destruction as the land is cleared to make way for charcoal production and short-term unsustainable development (4). In addition to habitat loss, these striking tortoises are targeted by the international pet trade and are also captured for food in some areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Very little research has been done on this species and most of it only in the last ten years.

The species is protected nationally under Malagasy law (Decree 60126; October, 1960). Internationally, the Radiated Tortoise was listed as Category A of the African Conservation Convention of 1968, and, since 1975, it has been listed on Appendix I of CITES, which affords species the highest level of protection (Durrell et al. 1989, Hilton-Taylor 2000).

Four protected areas and three additional sites (Lac Tsimanampetsotsa National Park 43,200 ha, Beza-Mahafaly Special Reserve 67,568 ha, Cap Sainte Marie Special Reserve 1,750 ha, Andohahela National Park 76,020 ha, and Berenty Private Reserve 250 ha, Site of Biological Interest – (1) Hatokaliotsy 21,850 ha and (2) PK3 north of Tulear 12,500 ha) fall within the range of this species. A captive breeding centre (Village de Tortues de Mangily) was established in Ifaty.

In August 2005, an international meeting of the Population and Habitat Viability Assessment (PHVA) group produced an alarming prediction that without immediate and significant intervention, viable populations of Radiated Tortoises will likely be extirpated from the wild within one tortoise generation, that is, 45 years (Randriamahazo et al. 2007). It was suggested that a systematic monitoring program be established. This will have to involve the training of local people so that the programme can be viable. This and other recommended conservation measures are detailed in the PHVA workshop report (Randriamahazo et al. 2007). In addition, monitoring of exploitation trends at the wholesale and consumer parts of the trade chain (surveys of markets, traders and restaurants in Madagascar; monitoring international pet trade) is important.

Additionally, ensuring adequate coverage of Radiated Tortoise populations as Madagascar expands its protected area network is essential. Research on habitat usage, specifically the impacts and benefits from Opuntia and other invasive vegetation, is desirable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

International trade in radiated tortoises is prohibited by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (3). A number of conservation initiatives have recently begun under the jurisdiction of international conservation organisations such as the Wildlife Conservation Society (WCS) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Radiated tortoise

The radiated tortoise (Astrochelys radiata) is a species in the family Testudinidae.[3] Although this species is native to and most abundant in southern Madagascar, it can be also be found in the rest of this island, and has been introduced to the islands of Réunion and Mauritius.[4] As the radiated tortoises are herbivores, grazing constitutes 80-90% of their diets, while they also eat fruits and succulent plants.[5] A favorite food in the wild is the Opuntia cacti. They are known to graze regularly in the same area, thus keeping the vegetation in that area closely trimmed. They seem to prefer new growth rather than mature growth because of the high-protein, low-fiber content. These tortoises are, however, endangered, mainly because of the destruction of their habitat by humans and because of poaching.[5]

The oldest radiated tortoise ever recorded was Tu'i Malila, which died at an estimated age of 188, the oldest tortoise being Adwaita.

The Radiated Tortoise[edit]

Growing to a carapace length of up to 16 in (41 cm) and weighing up to 35 lb (16 kg), the radiated tortoise is considered to be one of the world's most beautiful tortoises.

This tortoise has the basic "tortoise" body shape, which consists of the high-domed carapace, a blunt head, and elephantine feet. The legs, feet, and head are yellow except for a variably sized black patch on top of the head.

The carapace of the radiated tortoise is brilliantly marked with yellow lines radiating from the center of each dark plate of the shell, hence its name. This "star" pattern is more finely detailed and intricate than the normal pattern of other star-patterned tortoise species, such as G. elegans of India. The radiated tortoise is also larger than G. elegans, and the scutes of the carapace are smooth, and not raised up into a bumpy, pyramidal shape as is commonly seen in the latter species. There is slight sexual dimorphism. Compared to females, male radiated tortoises usually have longer tails and the notches beneath their tails are more noticeable. The Radiated Tortoise is endemic to Madagascar.

Range and distribution[edit]

Radiated tortoises occur naturally only in the extreme southern and southwestern part of the island of Madagascar. They have also been introduced to the nearby island of Reunion. They prefer dry regions of brush, thorn (Diderae) forests, and woodlands of southern Madagascar.

Reproduction[edit]

Males first mate upon attaining lengths of about 12 in (31 cm); females may need to be a few inches longer. The male begins this fairly noisy procedure by bobbing his head and smelling the female's hind legs and cloaca. In some cases, the male may lift the female up with the front edge of his shell to keep her from moving away.

The male then proceeds to mount the female from the rear while striking the anal region of his plastron against the female’s carapace. Hissing and grunting by the male during mating is common. This is a very dangerous procedure and cases have been recorded where the female's shell has cracked and pierced the vaginal and anal cavities. Females lay from three to 12 eggs in a previously excavated hole 6-8 in (15–20 cm) deep, and then depart.

Incubation is quite long in this species, lasting usually between five and eight months. Juveniles are between 1.25 and 1.6 inches (3.2 to 4 cm) upon hatching. Unlike the yellow coloration of the adults, the juveniles are a white to an off-white shade. Juveniles attain the high-domed carapace soon after hatching.

Conservation[edit]

These tortoises are critically endangered due to habitat loss, being poached for food, and being over exploited in the pet trade. It is listed in Appendix I of CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora), which prohibits the import or export of the species under most conditions. However, due to the poor economic conditions of Madagascar, many of the laws are largely ignored.

No estimates of wild populations are available, but their numbers are declining, and many authorities see the potential for a rapid decline to extinction in the wild.[6] In the North American studbook, 332 specimens are listed as participating in captive-breeding programs such as the Species Survival Plan. Captive breeding has shown great promise as in the captive breeding program for the radiated tortoise at the New York Zoological Society's Wildlife Survival Center. In 2005, the Wildlife Survival Center was closed,[7] and the radiated tortoise captive-breeding program was continued with the inception of the Behler Chelonian Center.[8]

In March 2013, smugglers were arrested after carrying a single bag containing 21 radiated tortoises and 54 angonoka tortoises (Astrochelys yniphora) through Suvarnabhumi International Airport in Thailand.[9]

References[edit]

References[edit]

  1. ^ Leuteritz, T. & Rioux Paquette (2008). "Astrochelys radiata". IUCN Red List of Threatened Species. Version 2010.4. International Union for Conservation of Nature. Retrieved 5 Feb 2011. 
  2. ^ Fritz Uwe; Peter Havaš (2007). "Checklist of Chelonians of the World". Vertebrate Zoology 57 (2): 267–268. ISSN 18640-5755. Archived from the original on 2010-12-17. Retrieved 29 May 2012. 
  3. ^ Fritz, U.; Bininda-Emonds, O. R. P. (2007-07-03). "When genes meet nomenclature: Tortoise phylogeny and the shifting generic concepts of Testudo and Geochelone". Zoology (Elsevier) 110 (4): 298–307. doi:10.1016/j.zool.2007.02.003. PMID 17611092. 
  4. ^ EMYSystem Species Page
  5. ^ a b Egeler, 2000
  6. ^ http://www.science20.com/news_articles/madagascars_radiated_tortoise_could_disappear_2030
  7. ^ Feuer, Alan 2004
  8. ^ The Turtle Conservancy and Behler Chelonian Center
  9. ^ "Largest seizure of Critically Endangered Ploughshare Tortoises made in Thailand". Traffic. Retrieved 29 March 2013. 

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!