Articles on this page are available in 1 other language: Spanish (20) (learn more)

Overview

Brief Summary

Biology

Primarily a tree-dwelling reptile (3), the green iguana is a specialised leaf-eater, consuming the tender green leaves and flowers of a selection of trees, shrubs and herb vegetation (4). For over 90 percent of the time, green iguanas are inactive and often when they do move, they travel slowly. However, if required, green iguanas are capable of running fast and will dive into water to escape predators (4), revealing their excellent swimming abilities. This explains the iguana's preference for habitat close to watercourses (3). Green iguanas are territorial during the breeding season (4), and will defend their home range against intruders (3). If a green iguana ventures into the territory of another it will be met firstly with pronounced head-nodding behaviour, believed to be an intimidating action. This may be followed by an extensive threat ritual, when the iguanas vertically flatten their bodies and erect their dorsal crests to create the appearance of being much larger. If the altercation does not end there, serious fights with injuries can follow. The dewlap, which can be lowered by a bone in the neck, is also used in threat displays, as well as for communicating with other green iguanas (3). Green iguanas breed during the dry season, during which time a territorial male occupies his territory with several females (4). A month or two after mating, the females move to communal nesting sites where they lay a clutch of 17 to 76 eggs in burrows dug into the ground. Iguana hatchlings emerge from the nest after three months of incubation, coinciding with the onset of the rainy season, a strategy to ensure plentiful, lush, green vegetation for the growing iguanas to feed on (4). Green iguana hatchlings are incredibly vulnerable to predators, including other reptiles, birds and mammals (7), and only about 2.6 percent live to the age of one year. Sexual maturity is reached after two to three years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The green iguana is one of the best-known reptiles due to its popularity in zoos and with private reptile keepers (3). It has a very distinctive appearance, with a large head, a pronounced dewlap, and an impressive crest of comb-like spines that runs down the centre of the back and tail (3) (5), measuring around three centimetres high (2). While, like its name suggests, this iguana is usually a shade of green, (from dull, grassy green to vivid turquoise), bright orange individuals may occur in the northern parts of its range (3), and the colour may also vary with temperature, particularly when young, being bright green when hot and dull and dark when cold (2). The green iguana's scaly skin is either uniformly coloured, or bears blackish stripes or a contrasting brownish pattern (3). Prominent large, circular scales are present on the lower jaw below the clearly visible tympanum. Male green iguanas can be distinguished from females by the more pronounced spiny crest and larger head (5), the more noticeable femoral pores (2), and the broader cloaca opening (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The green iguana, Iguana iguana is a popular pet trade species not native to Florida, but increasingly encountered as an escaped exotic in the southern half of the state.I. iguana is variable in color, young animals being bright green and then becoming more uniform grayish green in color with age. Green iguanas also have a limited ability to alter color based on mood or social interaction or in response to environmental conditions, with males exhibiting more color variation than females (Frye 1995).A prominent hanging dewlap under the throat, a dorsal crest of robust dermal spines running from neck to tail, a set of large scales on each side of the head, a membrane-covered tympanum, and a long, tapering, variably ringed tail are distinguishing features of the species (Oldham and Smith 1975, De Vosjoli 1992; Frye 1995, Gingell and Harding 2005). The eyes are laterally positioned and are protected by an immovable upperlid and a movable lower eyelid. A light-sensing organ-the parietal "eye"-is present on top of the head and is important in cueing diel coordination and gonadal maturation. The parietal eye exhibits rudimentary visual sensory abilities, namely the ability to perceive shadows from above the animal (Frye 1995).
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Green iguanas, Iguana iguana, occur throughout Central and South America, from Sinaloa and Veracruz, Mexico, south to the Tropic of Capricorn in Paraguay and southeast Brazil. This large lizard also inhabits many islands throughout the Caribbean region and the coastal eastern Pacific, and has been introduced into southern Florida and in Hawaii. This is the largest known lizard to occur within the borders of the United States (Conant and Collins, 1998; Campbell, 1998).

Biogeographic Regions: nearctic (Introduced , Native ); neotropical (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to Neotropics. Present on many West Indies islands. Virgin Islands: St. Thomas and some satellites, St. John (including Whistling Cay), St. Croix, Tortola, Virgin Gorda; Cayman Islands: Grand Cayman; Saba, Montserrat, Guadeloupe, Iles des Saintes, St. Lucia, St. Vincent, Grenadines, Grenada; Swan Island; islas San Andres and Providencia. Introduced in southern Florida (Townsend et al., 2002, Herpetol. Rev. 33:75; Meshaka et al. 2004; Krysko et al. 2005); Trujillo Alto, Puerto Rico; Hawaii (established on Oahu; McKeown 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America Caribbean South-America North-America
Distribution: USA (introduced to Florida and Hawaii) S Mexico (Yucatan, Campeche), Nicaragua, Guatemala, El Salvador, Honduras, Belize,  Costa Rica, Panama Colombia, Brazil (Bahia, Pernambuco), Venezuela, Isla Margarita, Guyana, Surinam, French French Guiana,  Peru, Bolivia (Beni, Pando, Santa Cruz), Paraguay, Antilles: Virgin Island, Cayman Island, St. Barthelemy, Montserrat, Guadeloupe,  Ile Desecheo Saintes, St. Lucia, St. Vincent, Grenadines, Grenada, Swan Island, Trinidad, Tobago, La Tortuga Island, Isla San Andres, Isla de Providencia, Puerto Rico  
Type locality: “Indiis”
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The green iguana is native to Latin America, including parts of Mexico, mainland and island regions of Central- and South America, and the Lesser Antilles. It has been introduced into Florida, Hawaii and Puerto Rico where it is considered a serious pest (McKeown 1996, Engeman Smith and Constantin 2005, ISSG). Iguana iguana has been reported from south Florida (Dade County) since 1966, and has probably been established and breeding there since 1980 (King and Krakauer 1966, Butterfield et al. 1997). More recently (2003), a presumed new breeding population has been identified from Palm Beach County, while an increasing number of animals (not reported breeding) are being encountered in Martin and St. Lucie counties (Krysko et al. 2005).The apparent northward expansion of I. iguana into the central India River Lagoon watershed is of potential concern. Animal Control offices in both Martin and St. Lucie Counties have reported an increase in the number of green iguana sightings throughout the Treasure Coast area (Indian River Press Journal 2007).
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The green iguana has a wide distribution ranging from the Mexican states of Sinaloa and Veracruz, through Central America and into South America as far south as Peru, Paraguay and northern Argentina, including many neotropical islands (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Within three years, a young, 12 gram hatchling iguana can become a 1 kg adult (de Vosjoli, 1992). Upon hatching, the length of green iguanas ranges from 17 to 25 cm. Most mature iguanas weigh between 4 and 6 kg, but some in South America, with proper diet can reach up to 8 kg. These large lizards can reach head to tail lengths of around 2 m.

Although called green iguanas, these animals are actually variable in color. The adults become more uniform in color with age, whereas the young may appear more blotchy or banded between green and brown. Color of an individual may also vary based upon its mood, temperature, health, or social status. Such color alteration may aide these animals in thermoregulation. In the morning, while body temperature is low, skin color will be darker, helping the lizard to absorb heat from sunlight. However, as the hot mid-day sun radiates upon them, these animals become lighter or paler, helping to reflect the sun rays and minimizing the heat absorbed. Active dominant iguanas usually have a darker color than lower-ranked iguanas living the same environment (Frye, 1995). Most color variation seen in this species is exhibited by males, and may be attributed in part to sex steroids. Six to eight weeks prior to and during courtship, males may acquire a bright orange or gold hue, although coloration is still related to dominance status (Frye, 1995). Mature females, for the most part, retain their green coloring.

Other distinguishing features of this species include a pendulous dewlap under the throat, a dorsal crest made up of dermal spines that run from the mid neck to the tail base, and a long tapering tail. The dewlap is more developed in adult males than females. Extensions of the hyoid bones stiffen and support the leading edge of this structure, which is used in territorial defense or when the animal is frightened. This fleshy structure also serves in heat absorption and dissipation when it is extended.

The laterally situated eyes are protected mainly by a immovable eyelid and freely mobile lower eyelid (Oldham and Smith, 1975). On the dorsal midline of the skull behind the eyes is a parietal eye. This sense organ, although not a true "eye," serves as a meter for solar energy, and aids in the maturation of sex organs, thyroid gland, and endocrine glands (Frye, 1995). The visual effect of this "eye" is mostly limited to the detection of predatory shadows from above.

The scales or plates on the head are larger and more irregular than the scales on the rest of the body. Below the tympanum there is a large rounded scale called the subtympanic plate.

Range mass: 4 to 8 kg.

Average mass: 7 kg.

Range length: 2 (high) m.

Average length: 1.75 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; sexes colored or patterned differently; male more colorful; ornamentation

  • Oldham, J., H. Smith. 1975. Laboratory Anatomy of the Iguana. Dubuque, Iowa: WM. C. Brown Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 200 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hatchlings are typically 17-25 cm in length. Growth is relatively rapid, and a 12 g hatchling can grow to a 1 kg adult in 3 years. Mature animals can attain total lengths of 2 m and can weigh as much as 8 kg, although 4-6 kg is more typical (De Vosjoli 1992, Gingell and Harding 2005).Captive-reared green iguanas can live for more than 20 years, while wild individuals are believed to have a lifespan of around 8 years (De Vosjoli 1992, Frye 1995).
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Although a growing assortment of exotic iguanids, polychrotids (anoles), geckonids (geckos), and other non-native lizards are now encountered in Florida, relatively few of these could be easily misidentified as I. iguana. Black spinytail iguanas (Ctenosaura similis) and Mexican spinytail iguanas (C. pectinata) are potential exceptions, but looking for the diagnostic features described above should allow Iguana iguana to be differentiated from these animals.
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Green Iguanas are arboreal lizards that live high in the tree canopy. Juveniles establish areas lower in the canopies while older mature iguanas reside higher up. This tree dwelling habit allows them to bask in the sun, rarely coming down except when females dig burrows to lay eggs. Although preferring an arboreal (forested) environment, they can adjust well to a more open area. No matter where they inhabit, they prefer to have water around as they are excellent swimmers and will dive beneath the water to avoid predators (Conant and Collins 1998).

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Wetlands: swamp

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Acacia thickets, mangrove edge; near water in otherwise xeric areas; in bushes and trees, on open rocky ground, cliff faces, rocky crevices (Schwartz and Henderson 1991). Mostly arboreal; juveniles sleep in low trees and bushes; adults probably in large trees, rock piles, rock crevices, or burrows (Schwartz and Henderson 1991). Small juveniles more terrestrial (Fitch and Henderson 1977). Good swimmer. In Panama, usually stayed close to lake shoreline (Bock et al. 1989, Rand et al. 1989). Eggs are laid in burrows dug in open areas, often a sand bank (Fitch and Henderson 1977). Usually returns to same nesting site each year (Bock et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Green iguanas most commonly inhabit tropical forest close to water (3), from sea level up to an altitude of 1,000 metres (4), although they avoid areas of deep forest where the sun cannot reach the ground to incubate the nest (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Green iguanas are primarily herbivorous. They occasionally eat a small amount of carrion or invertebrates. Green leafy plants or ripe fruits are their preferred foods.

Green iguanas use their tongues to help manipulate the food and bite small enough pieces to swallow, with little or no chewing. The food mixes with enzymes in the stomach before moving to the small intestine where pancreatic enzymes and bile are mixed with it. Most digestion occurs in the sacculated colon, where microflora break down the cellulose (Frye, 1995). Microflora are essential for hind-gut digestion of the hard to digest diet of this species. Hatchling iguanas are inclined to eat feces from adults, which may be an adaptation for acquiring this much need microflora (Alberts et.al., 2004). This microflora breaks the food down and makes it available for absorption.

Iguanas require a high amount of dietary protein in their first two to three years for adequately fast growth. During this time period, young iguanas may consume insects and spiders. Older iguanas that have reached close to maximum growth consume a low phosphorous, high calcium, leafy diet for their maintenance requirements.

Iguanas are ectothermic. Their body temperature is mainly dependent upon the environmental temperature. Low environmental temperatures inhibit an iguana's appetite and digestive enzymes. Active eating usually occurs when the environmental temperatures are between 77 and 95 degrees Fahrenheit (Frye, 1995). Basking is an important aid to digestion. Iguanas may cease eating prior to or during skin shedding. Females may refuse to eat during later stages of egg development. Individuals who are overly stressed or in a new environment may also refuse to eat.

Animal Foods: eggs; insects; terrestrial worms

Plant Foods: leaves; fruit; flowers

Primary Diet: herbivore (Folivore , Frugivore ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly leaves, flowers, and fruits of trees and vines. Also eats invertebrates, small vertebrates, and carrion. (Fitch and Henderson 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Iguana iguana is primarily herbivorous, consuming leafy plants and ripe fruits as preferred dietary items. A small percentage of invertebrate matter and carrion is also typically consumed (Gingell and Harding 2005).
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

In addition to helping disperse seeds, iguanas provide a source of food for larger predatory animals, including humans. Like other amphibians and reptiles, iguanas can be indicators of environmental changes (Kaplan, 2002). Reptiles are more sensitive to environmental changes than are humans, and by watching their responses, we can be alerted to possible problems before they are large enough for us to detect with our own senses.

Ecosystem Impact: disperses seeds

  • Phillips, J. 1990. Iguana iguana: a model species for studying the ontogeny of behavior/hormone interactions. Exp Zool Suppl, 4: 167-169. Accessed January 03, 2005 at http://www.anapsid.org/iguana/sight2.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

One of the best methods for iguanas to avoid predation is their cryptic coloration. Because they look like so much of their green environment, they can remain immobile when a predator has been spotted, and go unnoticed themselves. Young iguanas may be found in small groups, and use the "selfish-herd" or "more eyes are better" strategy to avoid predators. Iguanas prefer to bask in tree limbs that over-hang water so when threatened by a predator they can dive into the water and swim swiftly away. In addition to these strategies for avoiding predation, green iguanas are able to shed a large portion of their tail, thus distracting predators and allowing the "rest" of the animal to escape.

Hawks and other large birds are potential predators of juvenile iguanas. Humans are another one of major predators of green iguanas. Humans eat both iguanas and their eggs. Humans also use these reptiles for crocodile bait, and poach them for the pet trade.

Like many other animals, green iguanas also suffer from habitat destruction.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Green iguanas are known carriers of several Salmonella spp. bacterial strains considered to be pathogenic. Salmonella colonize the intestines and is shed in feces. Tortora at al. (1998) note that the carriage rate in pet reptiles may be as high as 90%.Invasion History: The pet trade has provided a steady source of introduction of Iguana iguana to Florida. Iguanas escaped from captivity were reported from south Florida as early as 1966, at Key Biscayne, Hialeah, Coral Gables, and near the Miami International Airport (King and Krakauer 1966). Populations have since become established at least as far north as Palm Beach County on the Atlantic coast and Lee County on the Gulf coast of the state, and an increasing number of animals (not yet reported breeding) are now reported from Martin and St. Lucie counties (Bartlett 1980, Bartlett and Bartlett 1999, Townsend et al. 2002, Krysko et al. 2005). The animals are frequently encountered in Everglades National Park, and have been reported in the Keys at least as far south as Stock Island (Meshaka et al. 2000).In addition to Florida, I. iguana has been introduced to Hawaii where it is also a nuisance species (McKeown 1996). Potential to Compete With Natives: I. iguana is the largest known lizard to occur in the U.S. (Conant and Collins 1998, Campbell 1998). McKie et al. (2005) reported concern over the potential for iguanas to disrupt native bird nests or destroy nestlings and eggs. Possible Economic Consequences of Invasion: The potential economic consequences associated with expanding Florida green iguana populations are believed to be minor, mostly related to the destruction of tropical garden and landscape foliage caused by iguana foraging (Gingell and Harding 2005). Health-related issues arising from iguanas being carriers of Salmonella are anticipated to be very minimal.In other parts of the world, green iguanas are an important source of food and leather, but they are unlikely to be utilized in this manner in Florida.
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Data collated by the Florida Fish and Wildlife Conservation Commission suggests breeding populations of I. iguana are established in at least 5 Florida counties. The statewide trend appears to be expansion of the overall population and invasive range.
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Hatchlings in Panama dispersed average of 250 m (maximum 1750 m) from nest site to hatchling habitat where they became sedentary; females traveled average of 425 m (maximum 1400 m) from home range to nesting site (Bock and McCracken 1988); 2 females moved 470 m and 1140 m from center of home range to nesting area (Rand et al. 1989); regarded as sedentary outside breeding season, core area of home range over 6 months ranged from about 1200 sq m in a juvenile to about 9500 sq m in large adult male (another study found smaller male home range size) (Rand et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

These animals are known to use visual signals, such as head bobbing and dewlap extension, as means of communicating with rivals. In extreme cases, physical contact is involved in altercations. In addition, males scent mark females as well as branches. Hissing, which is a form of auditory communication, sometimes occurs.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: mimicry ; pheromones ; scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active all year in native range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Approximately 65 days after mating, a female is ready to lay her eggs. The size and number of eggs produced varies depending upon her size, her nutritional status, and her maturity. Eggs measure around 15.4 mm in diameter, and 35 to 40 mm in length (Frye, 1995). Over a three day period, an average of 10 to 30 leathery white or pale-cream colored eggs are deposited into a nest. Nests are located 45 cm to more than a meter deep, and may be shared with other females if nesting areas are limited. After laying the eggs, females may return to the nest several times but do not stay to guard it.

Incubation lasts from 90 to 120 days. Temperature should range from 85 to 91 degrees Fahrenheit. The hatchlings pip the egg open using a special egg tooth, called the caruncle, that falls off shortly after hatching. Absorbed yolk provides most of the nourishment for the first week or two of an iguana's life.

There are no major morphological changes in these animals as they age, except that they grow. However, diet is related to age. The young, with higher need for protein, are more likely to consume insects and eggs than are mature individuals.

  • Kaplan, M. 2002. "Journal Abstracts: Iguana iguana Visual and Chemical Reception" (On-line). Accessed July 14, 2005 at http://www.anapsid.org/iguana/sight2.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Iguanas can live for more than 20 years in captivity, although wild iguanas are thought to live only about 8 years. Proper nutrition for growth is a concern for captive management of these animals. Improper housing and nutrition can shorten a captive iguana's lifespan.

Range lifespan

Status: captivity:
20 (high) years.

Average lifespan

Status: wild:
8 years.

Average lifespan

Status: captivity:
10 years.

Average lifespan

Sex: female

Status: captivity:
12.4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.8 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Most green iguanas reach sexual maturity between three and four years of age, although maturity can be reached earlier. Iguanas tend to breed in the dry season, ensuring that young hatch in the wet season when food is more readily available (de Vosjoli, 1992).

Mating appears to be polygynandrous. Courtship occurs within a defined territory where more than one female may be present. Conflicts between males are not uncommon. Courtship behavior of males includes head bobbing, extending and retraction of the dewlap, and nuzzling or biting a female’s neck (Frye, 1995). Dominant males may also mark rocks, branches, and females with a waxy pheromone-containing substance secreted from their femoral pores.

During mating, the male approachs the female and climbs on her back, straddling her. To restrain his mate, he grips the her shoulder skin with his teeth, sometimes causing wounds. The male then pairs his cloacal vent up with the female's and inserts one of his hemipenes into her cloaca. Copulation can last for several minutes. Female iguanas can can save sperm for several years (Frye, 1995), allowing them to fertilize eggs at a much later date.

Mating System: polygynandrous (promiscuous)

Females lay their eggs about 65 days after mating (eggs take 59 to 84 days to develop before they are laid). Over the course of three days, females may up to 65 eggs, each measuring around 15.4 mm in diameter, and 35 to 40 mm in length (Frye, 1995). Eggs are deposited into nests which are located 45 cm to more than a meter deep, and may be shared with other females if nesting areas are limited.

Incubation lasts from 90 to 120 days. Temperature should range from 85 to 91 degrees Fahrenheit. The hatchlings pip the egg open using a special egg tooth, called the caruncle, that falls off shortly after hatching. Absorbed yolk provides most of the nourishment for the first week or two of an iguana's life. Young are independent from birth.

Timing of sexual maturity varies. Animals may be able to breed as early as their second year, but may not breed until as late as their fifth year.

Breeding interval: These animals breed annually.

Breeding season: Green iguanas breed in the dry season.

Range number of offspring: 65 (high) .

Average number of offspring: 10-30.

Range gestation period: 59 to 84 days.

Average gestation period: 65 days.

Range age at sexual or reproductive maturity (female): 2.5 to 5 years.

Average age at sexual or reproductive maturity (female): 3-4 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous ; sperm-storing

Parental investment includes the risk of mating and laying eggs. Eggs are provisioned with nutrients by the mother. Females choose nesting sites, presumably as a means of caring for their offspring. However, after eggs are laid, there is no direct investment in the young.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oviposition strongly synchronous (February-March) in Panama (Bock and Rand 1989). Nesting occurred mainly from mid-April through May on Curacao (Copeia 1993:790-798). Clutch size 11-54, largest in large females. Most eggs hatch in about 10 weeks, April to June (Fitch and Henderson 1977). See Mora (1989) for information on communal nesting in Costa Rica. Excessive soil moisture due to above average rainfall may result in nesting failure (Bock and Rand 1989). Large males may do most of breeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction is sexual, sexes are separate and fertilization is internal. Individuals generally become reproductive at 3-4 years of age, although some animals mature up to a year earlier or later. Females remain reproductive for several years (Frye 1995). Peak breeding occurs in the dry season, ensuring that most young hatch in the wet season when food resources are most abundant.A polygynandrous mating system (both males and females pair with multiple mates) seems to be typical of the species, and a variety of male-male antagonistic displays (e.g., head bobbing, dewlap exhibiting) and male-female courtship displays (e.g., nuzzling, biting) are usually involved. Dominant males mark territories and mates with a pheromone-containing substance secreted from femoral pores (De Vosjoli 1992, Frye 1995, Meshaka et al. 2004).Females can store sperm for several years after mating, using it to fertilize eggs at a later date (De Vosjoli 1992, Frye 1995).
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Clutch sizes are relatively large, averaging 20-70 eggs. Females deposit eggs approximately 65 days after mating, usually over the course of three days, into nests excavated to a depth of 0.45-1 m. If suitable nesting sites are limited, several females can share nests (De Vosjoli 1992, Frye 1995).Incubation takes 90 to 120 days at a nest tenperature of 30-32°C. Hatchlings break through egg shells with the aid of a caruncle (egg tooth) that is shed shortly after hatching. Young are precocial and independent from the time of hatching, but they derive most of their nourishment in the first few weeks of life from yolk that has already been absorbed (Gingell and Harding 2005).
  • Bartlett R.D. and P.P. Bartlett. 1999. A Field Guide to Florida Reptiles and Amphibians. Gulf Publishing Company, Houston,Texas. 280 p.
  • Campbell J. 1998. Amphibians and Reptiles of Norther Guatemala, the Yucatan, and Belize. University of Oklahoma Press. OK. 400 p.
  • Conant R. and J. Collins. 1998. Peterson Field Guides: Reptiles and Amphibians of Eastern & Central North America, 3rd Edition. Houghton Mifflin Company, NY. 522 p.
  • De Vosjoli P. 1992. The Green Iguana Mannual. Lakeside, California: Advanced Vivarium Systems. 71 p.
  • Frye F. 1995. Iguana iguana, Guide for Successful Captive Care. Krieger Publishing Company, FL. 178 p.
  • Gingell F., Biology of Amphibians and Reptiles and J. Harding. 2005. "Iguana iguana". Animal Diversity Web. Available online.
  • Indian River Press Journal. June 26, 2007. Appetite for destruction. A1 and A8.
  • King F.W. and T. Krakauer. 1966. The exotic herpetofauna of southeast Florida. Quarterly Journal of the Florida Academy of Sciences 29:144-154.
  • Krysko K.L., Enge K.M., Townsend J.H., Langan E.M., Johnson S.A., and T.S. Campbell. 2005. New county records of amphibians and reptiles from Florida. Herpetological Review 36:85-87.
  • Krysko K.L., King F.W., Enge K.M., and A.T. Reppas Distribution of the introduced black spiny-tailed iguana (Ctenosaura similes) on the southwestern coast of Florida. 2003. Florida Scientist 66:74-79.
  • McKie A.C., Hammond J.E., Smith H.T., and W.E. Meshaka. 2005. Invasive Green Iguana Interactions in a Burrowing Owl Colony in Florida, Florida Field Naturalist 33:125-127.
  • McKeown S. 1996. A Field Guide to Amphibians and Reptiles in the Hawaiian Islands. Diamond Head Publishing, Los Osos, California. 172 p.
  • Meshaka W.E., Bartlett R.D., and H.T Smith. 2004. Colonisation success by Green Iguana in Florida. Iguana 11:154-161.
  • Oldham J., and H. Smith. 1975. Laboratory Anatomy of the Iguana. William C. Brown Company, Dubuque, Iowa. 106 p.
  • Tortora G.J., Funke B.R., and C.L. Case. 1998. Microbiology: An Introduction. Benjamin Cummings, CA. 944 p.
  • Townsend, J.H., Krysko, K.L., Reppas, A.T. and C.M. Sheehy2002. Noteworthy records of introduced reptiles and amphibians from Florida, USA. Herpetological Review 33:75.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Pores expel fluid: iguana
 

A gland in the leg of the iguana excretes liquid via epidermal and dermal tubes and pores in the skin.

   
  "[The iguana] excretes liquid (sometimes volatile lipids) from a gland on ventral side of the femur. The liquid is expelled through epidermal and dermal tubes ending in a row of pores on the skin. Gland length varies depending on the season, especially in males." (Biomimicry Guild unpublished report)
  Learn more about this functional adaptation.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Iguana iguana

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC1522-06|NC_002793|Iguana iguana| ACCCGTTGATTCTTCTCAACCAACCACAAAGATATCGGCACCCTTTACTTAGTCTTCGGTGCCTGAGCCGGCATGGTCGGAACTGCCCTC---AGCCTGCTAATTCGAGCAGAACTTAGCCAACCAGGGGCCCTTCTCGGCGAC---GACCAAATTTACAACGTTATTGTAACCGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATGCCCGTCATAATCGGAGGATTCGGAAACTGATTAGTCCCTCTAATG---ATCGGCGCACCAGACATGGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCGTCCTTTCTGCTCCTCTTAGCCTCCTCTGGCATTGAGGCCGGAGCCGGTACAGGCTGAACTGTTTACCCCCCACTAGCGGGCAACCTAGCACATGCAGGCGCCTCAGTAGACCTT---ACAATTTTCTCCCTCCACCTGGCCGGAATCTCATCCATCCTAGGAGCAATCAACTTTATCACAACATCTATCAACATAAAACCCCCCACAATAACCCAGTATCAAACACCCTTGTTTGTCTGATCCGTACTAATTACGGCCGTACTACTTCTGCTATCTCTACCCGTCCTAGCAGCA---GGTATTACAATACTACTCACCGACCGCAACTTAAACACCTCATTCTTTGACCCCGCAGGAGGGGGGGACCCAATTCTTTACCAACACTTATTTTGATTTTTTGGCCACCCTGAAGTCTACATTCTCATCCTCCCCGGATTCGGAATAATCTCCCACATCGTTACCTACTACGCCGGTAAAAAA---GAGCCCTTCGGGTACATGGGCATGGTCTGAGCTATAATATCAATCGGCTTCCTAGGATTCATCGTATGGGCCCACCATATGTTCACAGTCGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Iguana iguana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Although some populations have suffered from poaching and collection for the pet trade, green iguanas are not considered a conservation risk at this time. All Iguana species are listed under CITES Appendix II.

US Federal List: no special status

CITES: appendix ii

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Listed on Appendix II of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Throughout Latin America, the green iguana is hunted for its beautiful, commercially-valuable skin, prized flesh, and eggs (4) (8). It is one of the neotropical reptiles most frequently hunted for food, to feed the family or for sale, and is killed by rifles or captured by dogs. They are also captured live; newly-hatched iguanas may be exported for the pet trade, while captured females may be cut open to extract the eggs and then released (4); these females subsequently die (2). This level of exploitation, in combination with deforestation, has decimated populations in some parts of its range (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Bock and McCracken (1988) recommended that genetic structure of populations be considered when selecting breeding stock for reintroduction efforts. See Phillips et al. (1990) for information on egg incubation methods that maximize size of offspring for release into the wild.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: See Fitch and Henderson (1977) for brief discussion of conservation issues.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

There are a number of projects currently underway in Latin America which captive breed green iguanas and release them back to the wild, to supplement the reduced wild populations; for example, the Kekoldi Indigenous Reserve in Costa Rica and Monkey Bay Wildlife Sanctuary in Belize (9) (10). The green iguana is also listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that any international trade should be carefully monitored to ensure it is compatible with the species' survival (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The most adverse effect green iguanas have on humans would be eating exotic tropical foliage in gardens. They do not pose any major problems for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Iguanas are farmed in some countries as a source of food and leather, as well as for the pet trade. Due to their large size, iguana hides provide a source of luxury leather that can be made into boots, belts or purses. The pet industry also prizes iguanas; most are sold in the United States, Europe, and Japan. Iguanas also make an interesting tourist attraction in resort areas.

Exploitation of iguanas has resulted in marked declines in their numbers in some parts of their range. (Campbell, 1998).

Positive Impacts: pet trade ; food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Hunted for meat in some areas of native range (Fitch and Henderson 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green Iguana

The Green Iguana or Common Iguana (Iguana iguana) is a large, arboreal herbivorous species of lizard of the genus Iguana native to Central, South America, and the Caribbean. The green iguana ranges over a large geographic area, from southern Brazil and Paraguay as far north as Mexico and the Caribbean Islands especially in Puerto Rico where they are also known as "Gallina de palo" and they are very common throughout the island and often eaten; and in the United States as feral populations in South Florida (including the Florida Keys), Hawaii, and the Rio Grande Valley of Texas.

A herbivore, it has adapted significantly with regard to locomotion and osmoregulation as a result of its diet. It grows to 1.5 metres (4.9 ft) in length from head to tail, although a few specimens have grown more than 2 metres (6.6 ft) with bodyweights upward of 20 pounds (9.1 kg).

Commonly found in captivity as a pet due to its calm disposition and bright colors, it can be demanding to care for properly. Space requirements and the need for special lighting and heat can prove challenging to an amateur hobbyist.

Contents

Taxonomy and etymology

The species was first officially described by Swedish botanist Carl Linnaeus in 1758.[2] In the two centuries since then, numerous subspecies have been identified, but later classified as merely regional variants of the same species.[2]

Using nuclear and mitochondrial DNA-sequence data to explore the phylogenic history of the green iguana, scientists from Utah Valley State College studied animals collected from 17 different countries.[3] The topology of phylogeny indicated that the species originated in South America and eventually radiated through Central America and the Caribbean.[3] The study revealed no unique mitochondrial DNA haplotypes for subspecific status but did indicate the deep lineage divergence between Central and South American populations.[3]

The word iguana is derived from a Spanish form of the Taíno name for the species: iwana.[4][5] In some Spanish speaking countries, males of the species are referred to as gorrobo or ministro and juveniles are called iguanita or gorrobito.[6]

Distribution and habitat

A Green Iguana on the island of St. Thomas

The native range of the Green Iguana extends from southern Mexico to central Brazil, Paraguay, and Bolivia and the Caribbean; specifically Grenada, Curaçao, Trinidad and Tobago, St. Lucia, St. Vincent, and Útila.[7][8] They have been introduced to Grand Cayman, Puerto Rico, Texas, Florida, Hawaii, and the United States Virgin Islands.[8][9][10] Though the species is not native to Martinique, a small wild colony of released or escaped Green Iguanas endures at historic Fort Saint Louis.[11]

Green Iguanas are diurnal, arboreal, and are often found near water.[12][13] Agile climbers, Iguana iguana can fall up to 50 feet (15 m) and land unhurt (iguanas use their hind leg claws to clasp leaves and branches to break a fall).[13][14][15] During cold, wet weather, green iguanas prefer to stay on the ground for greater warmth.[6] When swimming, an iguana remains submerged, letting its four legs hang limply against its side. They propel through the water with powerful tail strokes.[6]

Because of the Green Iguana's popularity in the pet trade and as a food source in Latin America, they are listed on the CITES Appendix II, which means that while they are not an endangered species, "their trade must be controlled so as to not harm the species in the future".[16]

Anatomy and morphology

Despite their name, Green Iguanas can come in different colors. In southern countries of their range, such as Peru, green iguanas appear bluish in color with bold black markings.[13] On islands such as Bonaire, Curaçao, Aruba, and Grenada, a Green Iguana's color may range from green to lavender, black, and even pink.[5][13] Green Iguanas from the western region of Costa Rica are red and animals of the northern ranges, such as Mexico, appear orange.[5][13] Juvenile Green Iguanas from El Salvador are often bright blue as babies, however they lose this color as they get older.[5]

Iguana iguana possess a row of spines along their backs and along their tails which helps to protect them from predators.[13] Their whip-like tails can be used to deliver painful strikes and like many other lizards, when grabbed by the tail, the iguana can allow it to break, so it can escape and eventually regenerate a new one.[17] In addition, iguanas have well developed dewlaps which helps regulate their body temperature.[14] This dewlap is used in courtships and territorial displays.[5][13][18]

A male green iguana with spines and dewlap

Green Iguanas have excellent vision, enabling them to detect shapes and motions at long distances.[19] As Green Iguanas have only a few Rod cells, they have poor vision in low-light conditions. At the same time, they have cells called “double cone cells” that give them sharp color vision and enable them to see ultraviolet wavelengths.[19] This ability is highly useful when basking so the animal can ensure that it absorbs enough sunlight in the forms of UVA and UVB to produce Vitamin D.[5][15]

Green Iguanas have a white photosensory organ on the top of their heads called the parietal eye (also called third eye, pineal eye or pineal gland), in contrast to most other lizards, which have lost it.[19] This "eye" does not function the same way as a normal eye does, as it has only a rudimentary retina and lens and cannot form images.[19] It is, however, sensitive to changes in light and dark and can detect movement.[19] This helps the iguana when being stalked by predators from above.[19]

Green Iguanas have very sharp teeth that are capable of shredding leaves and even human skin.[5] These teeth are shaped like a leaf, broad and flat, with serrations on the edge. The similarity of these teeth to those of one of the first dinosaurs discovered led to the dinosaur being named Iguanodon, meaning "iguana-tooth", and the incorrect assumption that it had resembled a gigantic iguana.[20] The teeth are situated on the inner sides of the jawbones which is why they are hard to see in smaller specimens.[18]

Primarily herbivorous, Green Iguanas are presented with a special problem for osmoregulation; plant matter contains more potassium and as it has less nutritional content per gram, more must be eaten to meet metabolic needs.[21] As Green Iguanas are not capable of creating liquid urine more concentrated than their bodily fluids, like birds they excrete nitrogenous wastes as urate salts through a salt gland.[21] As a result, Green iguanas have developed a lateral nasal gland to supplement renal salt secretion by expelling excess potassium and sodium chloride.[21]

Green Iguanas from Guatemala and southern Mexico predominantly have small horns on their snouts between their eyes and their nostrils, whereas others do not.[13] Naturalists once classified these iguanas as a separate subspecies (Iguana iguana rhinolopha); however, this classification has been found to be invalid based on mitochondrial DNA and iguanas with similar nose projections appear randomly in other populations and interbreed freely with those that do not share this trait.[5][13]

The Green Iguana is a large lizard, typically growing to 1.5 metres (4.9 ft) in length from head to tail.[5] Some specimens have been measured upwards of 2 metres (6.6 ft) with bodyweights greater than 20 pounds (9.1 kg).[5]

Reproductive biology

Juvenile Green iguana

Male Green Iguanas have highly developed femoral pores on the underside of their thighs which secrete a scent (females have femoral pores, but they are smaller in comparison to those of the males).[5] In addition, the dorsal spines that run along a Green iguana's back are noticeably longer and thicker in males than they are in females, making the animals somewhat sexually dimorphic.[5]

Green Iguanas are oviparous with females laying clutches of 20 to 71 eggs once per year during a synchronized nesting period.[17][22] The female Green iguana gives no parental protection after egg laying, apart from defending the nesting burrow during excavation.[22] In Panama, the Green iguana has been observed sharing nest sites with American crocodiles and in Honduras with Spectacled Caimans.[8]

The hatchlings emerge from the nest after 10–15 weeks of incubation.[17][22] Once hatched, the young iguanas look similar to the adults in color and shape, resembling adult females more so than males and lacking dorsal spines.[22]

Juveniles stay in familial groups for the first year of their lives.[22] Male Green iguanas in these groups often use their own bodies to shield and protect females from predators and it appears to be the only species of reptile which does this.[23]

Behavior

Reddish colored Green iguana

When frightened by a predator, Green Iguanas will attempt to flee, and if near a body of water, they dive into it and swim away.[6] If cornered by a threat, the Green Iguana will extend and display the dewlap under its neck, stiffen and puff up its body, hiss, and bob its head at the aggressor.[13] If threat persists the Iguana can lash with its tail, bite and use its claws in defense.[6] The wounded are more inclined to fight than uninjured prey.[6]

Green Iguanas use "head bobs" and dewlaps in a variety of ways in social interactions, such as greeting another iguana or to court a possible mate.[5] The frequency and number of head bobs have particular meanings to other iguanas.[13]

Green Iguanas are preyed upon by hawks and their fear of hawks is exploited as a ploy to catch them in the wild.[6] The sound of a hawk's whistle or scream makes the iguana freeze and it becomes easier to capture.[6]

Diet

Iguana.ogg
Iguana eating Bougainvillea leaves

Green Iguanas are primarily herbivores, feeding on leaves, flowers, fruit, and growing shoots of upwards of 100 different species of plant.[5][22] In Panama one of the Green iguana's favorite foods is wild plum, Spondias mombin.[6]

Although they will consume a wide variety of foods if offered, Green Iguanas are naturally herbivorous and require a precise ratio of minerals (2 to 1 calcium to phosphorus) in their diet.[15][24] It is important for captive iguanas to have a variety of leafy greens along with fruits and vegetables such as turnip greens, collards, butternut squash, acorn squash, mango,and parsnip.[25][26] Juvenile iguanas often eat feces from adults in order to acquire the essential microflora to digest their low-quality and hard to process vegetarian only diet.[6][22]

There is some debate as to whether captive Green Iguanas should be fed animal protein.[5] There is evidence of wild iguanas eating grasshoppers and tree snails, usually as a byproduct of eating plant material.[27][28] Wild adult Green Iguanas have been observed eating bird's eggs.[7] Zoologists, such as Adam Britton, believe that such a diet containing protein is unhealthy for the animal's digestive system resulting in severe long-term health damage including kidney failure and leading to premature death.[29] On the other side of the argument is that Green Iguanas at the Miami Seaquarium in Key Biscayne, Florida, have been observed eating dead fish and individuals kept in captivity have been known to eat mice without any ill effects.[5] De Vosjoli writes that captive animals have been known to survive and thrive on eating nothing but whole rodent block, or monkey chow, and one instance of Romaine lettuce with vitamin and calcium supplements.[5]

Captivity

A Green Iguana in a terrarium

The American pet trade has put a great demand on the Green Iguana; 800,000 iguanas were imported into the U.S. in 1995 alone, primarily originating from captive farming operations based in their native countries (Honduras, El Salvador, Colombia, and Panama).[30] However, these animals are demanding to care for properly over their lifetime, and many die within a few years of acquisition.[5][31]

Although, in captivity, Green Iguanas will eat meat if presented with it, excessive consumption of animal protein results in severe kidney problems and possible premature death.[5][29] Misinformed pet owners tend to feed iguanas iceberg lettuce, which provides iguanas with water but has no other nutritional value.[15] A captive Green Iguana's diet should consist of fresh leafy vegetables such as mustard greens, collard greens, dandelion, arugula, or kale and access to fresh water.[5]

Green Iguanas will thrive only in temperatures of 79 °F (26 °C) to 95 °F (35 °C) and must have appropriate sources of UVB and UVA lighting, or else their bodies cannot produce vitamin D that promotes calcium absorption, which can result in a metabolic bone disease that can be fatal.[5][15] In some locales (New York City and Hawaii), iguanas are considered exotic pets, and are prohibited from ownership.[32][33] Due to the potential impact of an introduced species on Hawaii's ecosystem, the state has strict regulations regarding the import and possession of Green Iguanas; violators can spend three years in jail and be fined up to $200,000.[34]

As an invasive species

Wild Green Iguana in the Botanical Garden at Portoviejo, Ecuador

Caribbean

In the aftermath of two Caribbean hurricanes in 1995, a group of fifteen Green Iguanas was found to be living on Anguilla; an island where that species have never been recorded previously.[35] Biologist Ellen Censky, of the Connecticut State Museum of Natural History, believes that the new iguanas had accidentally become caught on the trees and rafted two hundred miles across the ocean from Guadeloupe, where Green iguanas are an indigenous species.[35] By examining the weather patterns and ocean currents, Censky has shown that the iguanas had spent three weeks at sea before arriving on the island.[35] This colony began breeding on the new island within two years of its arrival.[35]

In February 2012, the government of Puerto Rico proposed that the islands' iguanas, which were said to have a population of 4 million and considered to be a non-native nuisance, be eradicated and sold for meat.[36][37]

Fiji

The Green Iguana is present on some of the islands of Fiji, where it is known as the American iguana. They pose a threat to the native iguanas through the potential spread of disease and to humans by spreading salmonella. They were initially brought to Qamea in 2000 by an American who wanted them to eat the numerous insects on the island. They are now present on the islands of Laucala, Matagi and Taveuni.[38]

United States

The Green Iguana is established on Oahu and Maui, Hawaii as a feral species (despite strict legislation banning the importation of any reptiles)[39][40] and the Rio Grande Valley of Texas.[13] As most reptiles carry salmonella, this is a concern and a reason legislation has been sought to regulate the trade in Green iguanas.[8]

Due to a combination of events, the Green Iguana is considered an invasive species in South Florida and is found along the gulf coast of Florida from Key West to Pinellas County.[8][18][41] The original small populations in the Florida Keys were animals that were stowaways on ships carrying fruit from South America.[42] Over the years, other iguanas were introduced into the wild mostly originating through the pet trade. Some were escapees and some were intentionally released by their owners; these iguanas survived and then thrived in their new habitat.[41] They commonly hide in the attics of houses and on beaches. They often destroy gardens and landscaping.[41] They seem to be fond of eating a native endangered plant, Cordia globosa and feeding on Nickernut (Caesalpinia) a primary food plant of the endangered Miami Blue Butterfly (Cyclargus thomasi bethunebakeri); additionally on Marco Island, Green Iguanas have been observed using the burrows of the Florida Burrowing Owl, a species of special concern, all of which can make them more of a serious threat to Florida's ecosystem than originally believed.[8][42]

In January 2008, large numbers of feral iguanas in Florida dropped from the trees in which they lived, due to uncommonly cold nights causing them to go into brumation in which they lost their grips on the tree branches.[43] Though no specific numbers were provided by local wildlife officials, local media described the phenomenon as a "frozen iguana shower" in which dozens "littered" local bike paths. Upon the return of daytime warmth many (but not all) of the iguanas "woke up" and resumed their normal activities.[44] This occurred again in January 2010 after a prolonged cold front once again hit southern Florida.[45]

Cultural references

The Moche people of ancient Peru worshipped animals and often depicted Green Iguanas in their art.[46] The Green iguana and its relative the Black iguana (Ctenosaura similis) have been used as a food source in Central and South America for the past 7000 years.[4] It is possible that some of the populations in the Caribbean were translocated there from the mainland by various tribes as a food source.[4] In Central and South America, Green Iguanas are still used as a source of meat and are often referred to as gallina de palo, "bamboo chicken" or "chicken of the tree,"[6] because they are said to taste like chicken.[47]

References

  1. ^ "Iguana iguana (Linnaeus, 1758)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=173930. Retrieved 4 September 2008. 
  2. ^ a b Hollingsworth, Bradford D. (2004), "The Evolution of Iguanas an Overview and a Checklist of Species", Iguanas: Biology and Conservation (University of California Press): pp. 40–41, ISBN 978-0-520-23854-1 
  3. ^ a b c Stephen, Catherine (2006), "Genetic Studies Update", Iguana Journal of the International Iguana Society 13 (2): 127 
  4. ^ a b c Coles, William (2002), "Green Iguana" (PDF), U.S.V.I. Animal Fact Sheet #08 (Department of Planning and Natural Resources US Virgin Islands Division of Fish and Wildlife), http://www.vifishandwildlife.com/Education/FactSheet/PDF_Docs/08GreenIguana.pdf 
  5. ^ a b c d e f g h i j k l m n o p q r s t u De Vosjoli, Phillipe; Susan Donoghue, Roger Klingenberg, David Blair (2003), The Green Iguana Manual, Advanced Vivarium Systems, ISBN 978-1-882770-67-0 
  6. ^ a b c d e f g h i j k Swanson, Paul L (1950), "The Iguana: Iguana iguana iguana", Herpetolgica 6: 187–193 
  7. ^ a b Lazell, J.D. (1973), "The lizard genus Iguana in the Lesser Antilles", Bulletin of the Museum of Comparative Zoology (New York) 145: pp. 1–28 
  8. ^ a b c d e f Krysko, Kenneth L; Enge, Kevin M; Donlan, Ellen M; Seitz, Jason C (2007), "Distribution, Natural History, and Impacts of the Introduced Green Iguana in Florida", Iguana: Conservation, Natural History, and Husbandry of Reptiles (International Reptile Conservation Foundation) 14 (3): 142–151 
  9. ^ Mani, Bina (2002-07-17), Wild Blue Iguanas plummeting towards extinction, http://www.blueiguana.ky/wild-blue-iguanas-plummeting-towards-extinction-2, retrieved 2007-10-28 Scholar search 
  10. ^ Seidel, M; Franz, R (1994), "Amphibians and reptiles (exclusive of marine turtles) of the Cayman Islands", The Cayman Islands: natural history and biogeography (The Netherlands: Kluwer Academic Publishers): pp. 407–434, ISBN 978-0-7923-2462-1 
  11. ^ Breuil, Michel (2000). "Taxon reports: i. delicatissima and i. iguana" (in English) (PDF). West Indian Iguana Specialist Group Newsletter (IUCN) 3 (1): 4–5. http://www.iucn-isg.org/files/9ee5b5ca-cb43-4ed5-8ed9-7eb9e891b454.pdf. Retrieved 14 February 2012. 
  12. ^ Cogger, Harold; Zweifel, Richard (1992), Reptiles & Amphibians, Sydney, Australia: Weldon Owen, pp. 140, ISBN 0-8317-2786-1 
  13. ^ a b c d e f g h i j k l Samuelson, Phillip (1995-06-01), "The Lizard King", Reptiles Magazine 3 (2): 64–84 
  14. ^ a b Bebler, John L.; King, F. Wayne (1979), The Audubon Society Field Guide to Reptiles and Amphibians of North America, New York: Alfred A. Knopf, pp. 511–512, ISBN 0-394-50824-6 
  15. ^ a b c d e Rosenfeld, Arthur (1989), Exotic Pets, New York: Simon & Schuster, pp. 105, ISBN 0-671-47654-8 
  16. ^ "Appendices I,II, and III", Convention on International Trade in Endangered Species of Wild Fauna and Flora, 2007-09-13, archived from the original on 2007-10-16, http://web.archive.org/web/20071016044552/http://www.cites.org/eng/app/appendices.shtml, retrieved 2007-10-28 
  17. ^ a b c Capula, Massimo; Behler (1989), Simon & Schuster's Guide to Reptiles and Amphibians of the World, New York: Simon & Schuster, ISBN 0-671-69098-1 
  18. ^ a b c Conant, Roger; Collins, Joseph (1991), A Field Guide to Reptiles and Amphibians Eastern/Central North America, Boston, Massachusetts: Houghton Mifflin Company, pp. 94–95, ISBN 0-395-58389-6 
  19. ^ a b c d e f Brames, Henry (2007), "Aspects of Light and Reptile Immunity", Iguana: Conservation, Natural History, and Husbandry of Reptiles (International Reptile Conservation Foundation) 14 (1): 19–23 
  20. ^ Norman, David B. (2004), "Basal Iguanodontia", in Weishampel, D.B., Dodson, P., and Osmólska, H. (eds.), The Dinosauria (2nd ed.), Berkeley: University of California Press, pp. 413–437, ISBN 0-520-24209-2 
  21. ^ a b c Hazard, Lisa C. (2004), "Sodium and Potassium Secretion by Iguana Salt Glands", Iguanas: Biology and Conservation (University of California Press): pp. 84–85, ISBN 978-0-520-23854-1 
  22. ^ a b c d e f g Burghart, Gordon (2004), "Iguana Research: Looking Back and Looking Ahead", Iguanas: Biology and Conservation (University of California Press): pp. 5–10, ISBN 978-0-520-23854-1 
  23. ^ Rivas, Jesus; Levin, Luis E (2004), "Sexually Dimorphic Antipredator Behavior in Juvenile Green Iguanas", Iguanas: Biology and Conservation (University of California Press): pp. 121, ISBN 978-0-520-23854-1 
  24. ^ Kaplan, Melissa (2007-04-19). "'MK Diet' - The Short Version". Melissa Kaplan's Herp Care Collection. anapsid.org. http://www.anapsid.org/iguana/igdiet.html. Retrieved 2007-06-27. 
  25. ^ "Food Information Chart". Green Iguana Society. http://greenigsociety.org/foodchart.htm. 
  26. ^ "Food Chart". Iguana Zone. http://tesa.proboards.com/index.cgi?board=diet&action=display&thread=3578. 
  27. ^ Townsend, Josiah H.; John Slapcinsky, Kenneth L. Krysko, Ellen M. Donlan, and Elizabeth A. Golden (2005). "Predation of a Tree Snail Drymaeus multilineatus (Gastropoda: Bulimulidae) by Iguana iguana(Reptilia: Iguanidae) on Key Biscayne, Florida" (pdf). SouthEastern Naturalist. pp. 361–364. http://www.naherpetology.org/pdf_files/393.pdf. Retrieved 2009-08-08. 
  28. ^ Meshaka, Walter; Bartlett, Richard; Smith, Henry (2007-04-19), Iguana: Journal of the International Iguana Society (State Museum of Pennsylvania, Zoology and Botany). 
  29. ^ a b Britton, Adam (2007-04-19). "Animal Protein and Claw Trimming". Melissa Kaplan's Herp Care Collection. anapsid.org. http://www.anapsid.org/adambritton.html. Retrieved 2007-06-27. 
  30. ^ "Green Iguana", Reptiles and Amphibians Fact Sheets (Smithsonian National Zoological Park), 2007, http://nationalzoo.si.edu/Animals/ReptilesAmphibians/Facts/FactSheets/Greeniguana.cfm 
  31. ^ Loukopoulos P, Komnenou A, Papadopoulos E , Psychas V. Lethal Ozolaimus megatyphlon infection in a green iguana (Iguana iguana rhinolopa). Journal of Zoo and Wildlife Medicine 2007; 38:131-134
  32. ^ Blood, Michael R (1999-06-30), "Exotic Pets' Days Numbered", New York Daily News 
  33. ^ ""Green Iguana Society Adoption Board" (discussion board)". Boardhost.com. http://members2.boardhost.com/gisadoptions. Retrieved 2007-06-27. 
  34. ^ Iguana & Illegal Lizard Turned In Under Amnesty, State of Hawaii Department of Agriculture, 2002-04-16, http://www.hawaiiag.org/hdoa/newsrelease/02-08.htm 
  35. ^ a b c d Censky, Ellen (December 27, 1998), "Rafting Iguanas and a Job in Storrs", Article (The New York Times), http://query.nytimes.com/gst/fullpage.html?res=9404E3D8153BF93BA35753C1A96E958260&sec=&spon=&pagewanted=all 
  36. ^ "Puerto Rico plans to kill iguanas, export meat to help eradicate species". Associated Press. February 3, 2012. http://www.washingtonpost.com/world/americas/puerto-rico-plans-to-kill-iguanas-export-meat-to-help-eradicate-species/2012/02/03/gIQAduuFnQ_story.html. Retrieved February 7, 2012. [dead link]
  37. ^ "Puerto Rico, Cayman Islands to cull populations of invasive green iguanas". Green Antilles. February 6, 2012. http://www.greenantilles.com/2012/02/06/puerto-rico-cayman-islands-to-cull-populations-of-invasive-green-iguanas/. Retrieved February 7, 2012. 
  38. ^ See:
  39. ^ Perry, Brian (2006-04-12), "Leaping lizards! Girl sights iguana in Kahului", The Maui News, http://www.mauinews.com/page/content.detail/id/18635.html 
  40. ^ Hawaii Dept. of Agriculture News Release - NR09-03, 2009-02-05, http://hawaii.gov/hdoa/news/2009-news-releases/news 
  41. ^ a b c Lush, Tamara (2005-07-26), "Florida's Iguana Infestation", St. Petersburg Times, http://www.sptimes.com/2005/07/26/State/Florida_s_iguana_infe.shtml 
  42. ^ a b Youth, Howard (2005), "Florida's Creeping Crawlers", Zoogoer 20 (3), http://nationalzoo.si.edu/Publications/ZooGoer/2005/3/reptilefeature.cfm 
  43. ^ Cold Snap Causes Frozen Iguana Shower, WESH, 2008, http://www.wesh.com/weather/14973518/detail.html 
  44. ^ "Alien Iguanas Fall From Florida Trees During Cold Snap", Associated Press (National Geographic Society), 2008, http://news.nationalgeographic.com/news/2008/01/080107-AP-cold-iguana.html 
  45. ^ "Cold Tightens Grip, All The Way to Fla. Iguanas", Yahoo News (Yahoo! News), 2010, http://news.yahoo.com/s/ap/20100106/ap_on_bi_ge/us_winter_weather [dead link]
  46. ^ Berrin, Katherine & Larco Museum. The Spirit of Ancient Peru:Treasures from the Museo Arqueológico Rafael Larco Herrera. New York: Thames & Hudson, 1997.
  47. ^ Gruson, Lindsey (1989-08-22). "A Plan to Save Iguanas, and Rain Forests in the Bargain". The New York Times. http://query.nytimes.com/gst/fullpage.html?res=950DE5D7173DF931A1575BC0A96F948260. Retrieved 2008-07-17. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Bock and McCracken (1988) for information on genetic variability in Panama and Venezuela.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!