Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Distribution

Range Description

This species' range extends from the Pacific to the Atlantic coast of North America, from southwestern Oregon, Nevada, southern Utah, southern Colorado, southeastern Nebraska, southern Iowa, Illinois, southern Indiana, southern Ohio, West Virginia, and New Jersey in the United States, south to southern Baja California, northern Sinaloa, San Luis Potosi, Tamaulipas, Texas, the U.S. Gulf Coast, and southern Florida, at elevations from sea level to around 2,130 m asl (7,000 feet) (Conant and Collins 1991, Stebbins 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Common kingsnakes are one of the only kingsnake species found throughout most of North America. There are seven subspecies of Lampropeltis getula in North America. Lampropeltis getula getula (eastern kingsnake) is found on the east coast of North America from southern New Jersey and southeast Pennsylvania to the eastern parts of West Virginia, southwest to Mobile Bay, Alabama, and east through northern Florida. Lampropeltis getula floridana (Florida kingsnake) is found on the peninsula of Florida south to Dade County. Lampropeltis getula californiae (California kingsnake) is restricted to southwestern California and Baja California. Lampropeltis getula holbrooki (speckled kingsnake) is found in southwestern Illinois, eastern Iowa, and south central Alabama. Lampropeltis getula nigra (black kingsnake) is found west of the Appalachian mountains and east of the Mississippi River; this includes the region from West Virginia to southern Ohio, southeastern Illinois, and northern Alabama. Lampropeltis getula sticticeps (Outer Banks kingsnake) is found only in North Carolina from Cape Hatteras to Cape Lookout. Lampropeltis getula nigrita (black desert kingsnake) can be found in southern Arizona and northwestern Mexico. Subspecies overlap and interbreed in several different regions across North America.

Biogeographic Regions: nearctic (Native )

  • Mitchell, J. 1994. The Reptiles of Virginia. Washington and London: Smithsonian Institution Press.
  • Bartlett, R., P. Bartlett. 2005. Guide and Reference to the Snakes of Eastern and Central North America. Florida: University Press of Florida.
  • Ernst, C., R. Barbour. 1989. Snakes of Eastern North America. Fairfax, Virginia: George Mason University Press.
  • Wright, A., A. Wright. 1957. The Handbook Of Snakes. Ithica New York: Comstock Publishing Associates.
  • Wund, M., M. Torocco, R. Zappalorti, H. Reinert. 2007. Activity Ranges and Habitat Use of Lampropeltis getula getula (Eastern Kingsnakes). Northeastern Naturalist, 14/ 3: 343-360.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The range extends from the Pacific to the Atlantic coast of North America, from southwestern Oregon, Nevada, southern Utah, southern Colorado, southeastern Nebraska, southern Iowa, Illinois, southern Indiana, southern Ohio, West Virginia, and New Jersey south to southern Baja California, northern Sinaloa, San Luis Potosi, Tamaulipas, Texas, the U.S. Gulf Coast, and southern Florida, at elevations from sea level to around 2,130 meters (7,000 feet) (Conant and Collins 1991, Stebbins 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Middle-America North-America
Distribution: USA (New Jersey, Delaware, Maryland, Virginia, North Carolina, South Carolina, Georgia, Florida, Alabama, Arizona)  getula: S New Jersey to N Florida, west to the Appalachians and S Alabama.
Type locality: ‘Carolina’ (Linnaeus 1766), restricted to Charleston, SC by Klauber (1948).  floridana: S Florida. Intergrades with getula over much of Florida.  meansi: Florida (Eastern and SW Apalachicola Lowlands between the Apalachicola and Ochlockonee rivers and south of Telogia Creek, Franklin and Liberty counties.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Because the physical description of Lampropeltis getula varies so greatly across subspecies, each will be described in turn. One measure they all share is the length of hatchlings: 20 to 28 cm at hatching.

Adult eastern kingsnakes (L. g. getula) can reach a length of 61 to 153 cm. They are large, solid, glossy black snakes with yellow (sometimes white) crossbars extending the length of the snake. The head is solid black with several yellow or white spots decorating the head scales.

Speckled kingsnakes (L. g. holbrooki) can reach a length of 51 to 132 cm as adults. They are black with yellow “specks” on and throughout its scales. The underside is pale yellow to white with some of the black scales curling around the sides.

California kingsnakes (L. g. california) can reach lengths of 91 to 106 cm. They have white crossbars intercepting black patches along the length of the back. The head is normally white with a black top and a few black scales on the side.

Adult Florida kingsnakes (L. g. floridana) can be 106 to 138 cm long. The only major difference between Florida kingsnakes and eastern kingsnakes has 60 crossbands, whereas eastern kingsnakes have only 30. The underbelly is pale yellow with alternating patterns of black scales in a “zigzag” pattern.

Black kingsnakes (L. g. niger), reach 91 to 122 cm and are rarely totally black. They normally have traces of approximately 50 to 95 faint crossbars of yellow or white spots.

Outer Banks kingsnakes (L. g. stricticeps) can reach 123 to 153 cm. They can be easily mistaken for other subspecies including eastern, speckled, and Florida kingsnakes. They have yellow crossbars and yellow “specks” between the crossbars, as well as a mostly pale yellow underbellies with some black scales extending to the sides.

Black desert kingsnakes (L. g. nigrita) can reach lengths of 106 to 132 cm. They are black and glossy with approximately 75 thin yellow crossbars. This subspecies also has yellow spots on the black scales that extend to the sides of the snake.

Range mass: 1361 to 2268 g.

Average mass: 1814 g.

Range length: 8 to 153 cm.

Average length: 130 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 208 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Lampropeltis getula
Catalog Number: USNM 61318
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1918
Locality: Indian Oasis, 27 mi W of, Pima, Arizona, United States, North America
  • Holotype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 4284
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1855
Locality: Fort Yuma, Imperial, California, United States, North America
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 37534
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1905
Locality: Yuma, Arizona, United States, North America
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 21720
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: Male;
Preparation: Ethanol
Year Collected: 1894
Locality: San Domingo, Sonora, Mexico
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 51761
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1914
Locality: Graham Mountains, Ash Creek, Graham, Arizona, United States, North America
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 54717
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1916
Locality: Calva, San Carlos Indian Reservation, Graham, Arizona, United States, North America
Elevation (m): 792 to 792
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 44530
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1889
Locality: Yuma, Arizona, United States, North America
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lampropeltis getula
Catalog Number: USNM 37532
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1905
Locality: Volcano Lake, Baja California Norte, Mexico
  • Paratype: Blanchard, F. N. 1919. Occ. Paps. Mus. Zool. Univ. Mich. (70): 6, plate 1, figure 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species' habitats vary geographically and include open coniferous forest, woodland, swamps, coastal marshes, river bottoms, farmland, prairie, chaparral, and desert. This snake is primarily terrestrial. Periods of inactivity are spent in crevices or burrow, or under rocks, logs, stumps, vegetation, or other cover.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Primary habitat varies by subspecies. Common kingsnakes can be found in forests, grasslands, desserts, and urban areas. For most subspecies of Lampropeltis getula, microhabitats can include: under wood or lumber, in trash piles, barns, along stone walls, on sunny railroad embankments, in stump holes, or in sunny clearings.  Coastal subspecies like Florida kingsnakes and some eastern kingsnakes can be found along the edges of swamps, marshes, and dikes. Other subspecies, such as California kingsnakes and black desert kingsnakes are restricted to arid areas. Elevation also varies by subspecies. For example, California kingsnakes have the widest range in elevation - from the Pacific coastline (0 m) to 915 m. Eastern kingsnakes (123 to 305 m) and black kingsnakes (153 to 305 m) share similar limited elevation ranges. Speckled kingsnakes can be found at elevations up to 610 meters.

Range elevation: 0 to 915 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest ; scrub forest ; mountains

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Mattison, C. 1995. The New Encyclopedia of Snakes. Princeton and Oxford: Princenton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitats vary geographically and include open coniferous forest, woodland, swamps, coastal marshes, river bottoms, farmland, prairie, chaparral, and desert. This snake is primarily terrestrial. Periods of inactivity are spent in crevices or burrow, or under rocks, logs, stumps, vegetation, or other cover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adult common kingsnake diet varies across subspecies and is very broad, but published reports are available for a few representative subspecies. Eastern kingsnakes and Florida kingsnakes feed mainly on other snakes, including venomous snakes (coral snakes, copperheads, massasaugas, and rattlesnakes), eastern garter snakes (Thamnophis sirtalis), northern water snakes (Nerodia sipedon), ring-neck snakes (Diadophis punctatus), smooth earth snakes (Virginia valerius), and worm snakes (Carphasphis amonenus). They also feed on five-lined skinks (Plestiodon fasciatus), white-footed mice (Peromyscus leucopus), and the eggs of northern bobwhite quail (Colinus virginianus).

Black kingsnakes feed primarily on hognosed snakes (Heterodon platirhinos), red-bellied snakes (Storeria occipitomaculata), black racers (Coluber constrictor), black rat snakes (Pantherophis obsoletus), fence lizards (Sceloporus consobrinus), red spotted newts (Notophthalmus viridescens), house mice (Mus musculus), and meadow voles (Microtus pennsylvanicus). Black desert kingsnakes prey mainly on house mice (Mus), rats (Rattus), and southern desert horned lizards (Phrynosoma platyrhinos calidiarum). Megonigal (1985) reported seeing a speckled kingsnake kill and eat an adult copperhead (Agkistrodon contortrix). They also eat other non-venomous snakes, birds, vertebrate eggs, lizards, mice, and rats. California kingsnakes prey on mice, gopher snakes (Pituophis), California alligator lizards (Elgaria multicarinata multicarinata), and racers (Coluber).

Animal Foods: birds; mammals; amphibians; reptiles; eggs; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats snakes, lizards, small turtles, reptile eggs, frogs, birds and their eggs, and small mammals (Stebbins 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Common kingsnakes are beneficial for the ecosystem. They help keep rodent and frog populations in balance as well as other snakes like rattlesnakes (Crotalus) and cottonmouths (Agkistrodon piscivorus). They are also prey for larger snakes and predatory birds and mammals. Snider and Bawler (1992) conducted a study to find if parasites were the cause of common kingsnake declines in Florida. They found suggestions of parasite activity but no direct evidence. Van Peenan and Birdwell (1968) found evidence of several species of parasites affecting common kingsnakes. These include apicomplexan species (Sarcocystis and Eimeria species).

Commensal/Parasitic Species:

  • Oldak, P. 1976. Comparison of the Scent Gland Secretion Lipids of Twenty-Five Snakes: Implications for Biochemical Systematics. Copeia, 1976/2: 320-326.
  • Van Peenan, P., T. Birdwell. 1968. Coccidian parasites of the California nanded kingsnake, Lampropeltis getula californiae. Parasitology, 58: 349-354.
  • Winne, C., J. Wilson, B. Todd, K. Andrews, J. Gibbons. 2007. Enigmatic Decline of a Protected Population of Eastern Kingsnakes, Lampropeltis getula, in South Carolina. Copeia, 2007/3: 507-519.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of Lampropeltis getula include; alligators (Alligator mississippiensis) in Florida, larger snakes, hawks, raccoons (Procyon lotor), striped skunks (Mephitis mephitis), and Virginia opossums (Didelphis virginiana). Common kingsnakes have several defenses against potential predators. The most common is hissing, striking, “S” shaped striking pose, biting, and flight. They flee when threatened, rather than hold their ground. They are also able to spread a pungent musk that serves as an alarm substance to other common kingsnakes in the area. The banded and striped pattern of California kingsnakes, and other subspecies, disguises their movement and body outline when they are fleeing from a predator. Their coloration may make them cryptic in leaf litter and against other backgrounds.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by hundreds of occurrences or subpopulations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but certainly exceeds 100,000 and probably exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is not a great deal of information about how common kingsnakes communicate. However, some research has investigated the role of their cloacal scent glands in mating and deterrents. Brisbin (1968) conducted an experiment dealing with a captive-bred eastern kingsnake female that was placed on a table with the scent of a wild-caught male Florida kingsnake. The female showed evidence of an “alarm-reaction” by twisting away and secreting her own scents from her glands (Brisbin 1968). Price and LaPointe (1981) found that kingsnakes most likely communicate with their tongues (providing sense of smell and taste), and their scent gland secretions.

Common kingsnakes often follow the scent gland secretions of the opposite sex for mating purposes. They also have been observed using tongue flicks to find chemical signatures. These behaviors could be related to sexual behaviors by use of pheromones or as a repellent. They have excellent vision, like most species of snakes. Hearing is extremely restricted to the sensing of vibrations.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic ; vibrations ; chemical

  • Brisbin, I. 1968. Evidence for the Use of Post Anal Musk as an Alarm Device in the Kingsnake Lampropeltis getula. Herpetologica, 24/1: 169-170.
  • Carpenter, C. 1977. Communication and Displays of Snakes. American Zoologist, 17/1: 217-223.
  • Price, A., J. LaPointe. 1981. Structure-Functional Aspects of the Scent Gland in Lampropeltis getulus splendida. Copeia, 1981/1: 138-144.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active April-October in north (Collins 1982, Minton 1972). In some areas, most active in morning and late afternoon and, in hot weather, at night; reportedly diurnal in West Virginia (Green and Pauley 1987). In southern Florida, activity occurs mainly in spring and fall; adults primarily diurnal, juveniles more crepuscular and nocturnal; encounter rates constrained by temperature rather than precipitation (Krysko 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

A snake’s egg contains a large amount of yolk, which contains the fats and the carbohydrates necessary for the development of the embryo. Towards the final stages of development, the yolk is absorbed by the fetal snake. Additionally, some of the calcium for the egg’s shell is extracted by the embryo and is used to form its skeleton. After the skeleton is formed, the shell becomes thinner and more flexible. Oxygen exchange decreases over time, which in turn urges the hatchling to break out of the egg, using the deciduous egg "tooth" on the nose.

After common kingsnakes hatch, they stay in the nest until they shed their skin for the first time. This normally will take about a week. The hatchlings then disperse. Information about post-hatching is scarce. Common kingsnakes reach sexual maturity at approximately half their potential maximum size from 60 to 92 cm. In captivity, Lampropeltis getula can reach sexual maturity much sooner because of an abundant food source and limited parasites and disease.

Development - Life Cycle: indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little information is available on the longevity of wild common kingsnakes. Most available information is from captive snakes. Ernst and Barbour (1989) found that the oldest wild common kingsnake was 9 years old (reported in 1937). AnAge reported that the longest living kingsnake in captivity was 33.3 years old.

Range lifespan

Status: wild:
9 (high) years.

Average lifespan

Status: wild:
5.5 years.

Range lifespan

Status: captivity:
33.3 (high) years.

Average lifespan

Status: captivity:
33.3 years.

  • Snider, A., J. Bawler. 1992. Longevity of Reptiles and Amphibians in North America Collections. Pennysilvania: Society for the Study of Amphibians and Reptiles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33.3 years (captivity) Observations: Increased reproductive output with age has been reported in these animals (Patnaik 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male common kingsnakes compete for females. If two males are in the same area they will both raise their heads, necks, and fore parts of their bodies and entwine them. Males then try to press each other to the ground. The losing male will retreat and lay coiled in a prone position with his head flat to the ground. The victorious male will return to the female who waits nearby and copulate. Males are able to find females through pheromone trails. When mating, males lie atop females and bite their necks. Males then coil their tails under the females until their cloacas align. The male uses his hemipenis to enter the females’ cloacae. Copulation can last for several minutes to several hours.

Mating System: polygynandrous (promiscuous)

Common kingsnakes mate in the spring, allowing females time to lay their eggs when the weather is still warm enough for proper incubation. Their gestation period is about 60 days. In warmer climates (e.g. Florida), courtship can begin as early as March. In northern portions of the range, courtship is delayed until April or May.

A female may produce a single clutch from multiple mates. Females may also produce more than one clutch per season as a result of more than one mating. The female chooses the nesting site, which can include rotting logs and stumps, as well as sawdust piles. Common kingsnakes breed yearly and have been known to produce more than one clutch per season. The breeding season is between March and August. The average number of offspring is 10 eggs per clutch (range 3 to 24). Average gestation period for female kingsnakes is 60 to 62 days (range 50 to 80 days). Hatchlings can weigh between 9 and 14 grams.  Females reach sexual maturity at 2 to 4 years. Males reach sexual maturity at age 1 to 4.

Breeding interval: Yearly, common kingsnakes have been known to produce more than one clutch per season.

Breeding season: Common kingsnakes breed from March to August.

Range number of offspring: 3 to 24.

Average number of offspring: 10.

Range gestation period: 50 to 80 days.

Average gestation period: 60-62 days.

Range birth mass: 9 to 14 g.

Average birth mass: 12 g.

Range time to independence: 3 to 14 days.

Average time to independence: 7 days.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Average age at sexual or reproductive maturity (female): 2-3 years.

Range age at sexual or reproductive maturity (male): 1 to 4 years.

Average age at sexual or reproductive maturity (male): 2-3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

After copulation the male will leave the female and not return to help with parental care. After the female lays her eggs she will disperse and not return to the nest.

Parental Investment: no parental involvement; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

  • Mitchell, J. 1994. The Reptiles of Virginia. Washington and London: Smithsonian Institution Press.
  • Ernst, C., R. Barbour. 1989. Snakes of Eastern North America. Fairfax, Virginia: George Mason University Press.
  • Mattison, C. 1995. The New Encyclopedia of Snakes. Princeton and Oxford: Princenton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lays clutch of 2-24 eggs, May (Florida)-August. Eggs hatch in 8-12 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampropeltis getula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCGGCACAGGATGAACTGTCTACCCGCCCCTATCAGGAAATCTAGTACATTCAGGCCCATCTGTAGATCTAGCAATTTTCTCCTTACATCTAGCAGGCGCCTCGTCCATCCTGGGAGCAATCAACTTCATTACAACATGTATCAACATAAAACCTAAATCCATACCAATATTTAACATCCCACTATTTGTCTGATCCGTACTTATTACCGCTATTATACTACTTTTAGCCCTGCCCGTATTAGCAGCGGCAATTACTATACTTCTAACTGATCGAAATCTAAATACCTCTTTCTTTGACCCCTGCGGAGGAGGGGACCCTGTACTATTCCAACACCTATTTTGATTCTTTGGCCATCCAGAAGTATACATTCTCATCCTACCAGGATTCGGTATTGTATCAAGTATTATTACATTCTATACTGGAAAAAAAAACACATTTGGATATACAAGTATAATTTGAGCAATAATATCTATTGCCGTCCTAGGCTTTGTAGTTTGAGCTCACCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lampropeltis getula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A., Frost, D.R. & Santos-Barrera, G.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Justification
Listed as Least Concern in view of the large and probably relatively stable extent of occurrence, area of occupancy, number of subpopulations, and population size. This species is not threatened across most of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common kingsnakes are listed as a “species of concern” on the U.S. Federal list. This may be because Florida kingsnakes, L. g. floridana, are in decline. Reasons for declines include anthropogenic causes through extensive pet trade, road fatalities, and habitat loss. Invasive fire ants (Solenopsis invicta) are also harming L. g. floridana populations by competing for food sources like turtle eggs.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is represented by hundreds of occurrences or subpopulations. The total adult population size is unknown but certainly exceeds 100,000 and probably exceeds 1,000,000. Its extent of occurrence, area of occupancy, number of subpopulations, and population size are probably relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Extent of occurrence, area of occupnacy, number of subpopulations, and population size probably are relatively stable.

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
No major threats have been identified. Local declines probably have occurred in areas where habitat has been intensively developed for human uses, but in most of the range this species is not threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No major threats have been identified. Local declines likely have occurred in areas where habitat has been intensively developed for human uses, but in most of the range this species is not threatened.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Many occurrences of this species are in national parks and other well-protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in national parks and other well-protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Other than the occasional defensive bite, there are no known adverse effects of Lampropeltis getula on humans.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Common kingsnakes are one of the most popular snakes to own as pets, next to boa constrictors (Boa constrictor). They play an important role in controlling populations of venomous snakes, which can pose a threat to humans.

Positive Impacts: pet trade ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lampropeltis getula

Lampropeltis getula (Common names include eastern kingsnake,[2] common kingsnake,[3] chain kingsnake,[4] (more)) is a harmless colubrid species found in the United States and Mexico. A distinct color pattern and the fact that this species actively hunts for venomous snakes help to protect them from people. It has long been a favorite among collectors.[4] Eight subspecies are currently recognized, including the nominate subspecies described here.[5]

Contents

Description

L. g. getula can be quite docile even when caught wild.

Adult specimens can range from 51 to 197 cm (20 to 78 in) in length.[6][7] Speckled Kingsnakes are the smallest race on average, at 91.5 cm (36.0 in) (in snout-to-vent length) on average, while the nominate is the largest, at 107 cm (42 in) on average.[7] Specimens up to 208.2 cm (82 inches) have been recorded.[8] Weight can vary from 285 g (10.1 oz) in a small specimen of87.2 cm (34.3 in) in length, to 2,268 g (5.00 lb) in large specimens, of over 153 cm (60 in) in length.[9][7]

The color pattern consists of a glossy black, blue-black or dark brown ground color overlaid with a series of 23-52 white chain-like rings.[4][10] King snakes from the Coastal Plain have wider bands, while those found in mountainous areas have thinner bands or may be completely black.

Common names

Eastern kingsnake,[2] common kingsnake,[3] chain kingsnake,[4] king snake, Carolina kingsnake, chain snake, bastard horn snake, black king snake, black moccasin, common chain snake, common king snake, cow sucker, eastern king snake, horse racer, master snake, North American king snake, oakleaf rattler, pied snake, pine snake, racer, rattlesnake pilot, thunder-and-lightning snake, thunderbolt, thunder snake, wamper, wampum snake.[10] Also In North Carolina it is called the Pied Piper.

Geographic range

Found in the United States in Alabama, Arizona, Arkansas, California, portions of Colorado, Delaware, Florida, Georgia, south and southwest Illinois, southern Indiana, southern Iowa, Kansas, Kentucky, Louisiana, Maryland, Mississippi, Missouri, Nebraska, southern and western Nevada, New Jersey, New Mexico, New York, North Carolina, southern Ohio, southeastern Oklahoma, southern Oregon, South Carolina, Tennessee, Texas, southern Utah, Virginia, and West Virginia. Also found in northern Mexico, including all of Baja California [Hubbs, 2009].[1]

Habitat

Open areas are preferred, particularly grassland, but also chaparral, oak woodland, abandoned farms, desert, low mountains, sand, and any type of riparian zone, including swamps, canals and streams [Hubbs, 2009].

Diet

They eat other snakes, including venomous snakes. They have developed a hunting technique to avoid being bitten by clamping down on the jaws of the venomous prey, but even if bitten, they are immune to the venom. They also eat amphibians, turtle eggs, lizards, and small mammals, which they kill by constriction.[11]

Reproduction

Oviparous, females lay up to several dozen eggs that hatch after 2-2.5 months of incubation. Hatchlings are brightly colored and feed on small snakes, lizards and rodents.[4]

Captivity

Long a favorite among collectors, they do well in captivity, living for up to 25 years or more.[4]

Subspecies

Subspecies[5]Authority[5]Common name[5]Geographic range
L. g. californiae(Blainville, 1835)California kingsnake
L. g. floridanaBlanchard, 1919Florida kingsnake
L. g. getula(Linnaeus, 1766)Eastern kingsnake
L. g. holbrookiStejneger, 1902Speckled kingsnake
L. g. nigra(Yarrow, 1882)Black kingsnake
L. g. nigritaZweifel & Norris, 1955Mexican black kingsnake
L. g. splendida(Baird & Girard, 1853)Desert kingsnake
L. g. meansiKrysko & Judd, 2006Apalachicola Lowlands KingsnakeApalachicola Lowlands, Florida

See also

References

Hubbs, Brian. 2009. Common Kingsnakes. Tricolor Books, Tempe, Arizona.

  1. ^ a b Lampropeltis getula at the Reptarium.cz Reptile Database. Accessed 29 June 2008.
  2. ^ a b Conant R. 1975. A Field Guide to Reptiles and Amphibians of Eastern and Central North America. Second Edition. First published in 1958. Houghton Mifflin Company Boston. 429 pp. 48 plates. ISBN 0-395-19979-4 (hc), ISBN 0-395-19977-8 (pb).
  3. ^ a b Behler JL, King FW. 1979. The Audubon Society Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knopf. 743 pp. LCCCN 79-2217. ISBN 0-394-50824-6.
  4. ^ a b c d e f Mehrtens JM. 1987. Living Snakes of the World in Color. New York: Sterling Publishers. 480 pp. ISBN 0-8069-6460-X.
  5. ^ a b c d "Lampropeltis getula". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=209247. Retrieved 29 June 2008.
  6. ^ Burnie D, Wilson DE. 2001. Animal. Dorling Kindersley Publishing. 624 pp. ISBN 0-7894-7764-5.
  7. ^ a b c [1]
  8. ^ [2]
  9. ^ [3]
  10. ^ a b Wright AH, Wright AA. 1957. Handbook of Snakes. 2 volumes. Comstock Publishing Associates. (7th printing, 1985). 1105 pp. ISBN 0-8014-0463-0.
  11. ^ Schmidt, K.P. and D.D. Davis. 1941. Field Book of Snakes of the United States and Canada. G.P. Putnam's Sons. New York. p. 176.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The specific name formerly was getulus (see Frost and Collins 1988). See Blaney (1977) for latest rangewide taxonomic treatment of this species.

Available morphological data suggest that this species as currently circumscribed may actually comprise mutliple species; further study using genetic methods is needed. Some of the nominal subspecies intergrade widely with other subspecies (Blaney 1977) and likely do not represent distinct evolutionary lineages.

Based on patterns of morphological variation, Means and Krysko (2001) concluded that the name L. g. goini is invalid, as is the hypothesis that Apalachicola L. getula are relict populations of intergrades between L. g. getula and L. g. floridana. They believed that the polymorphic eastern Apalachicola Lowlands populations are most closely related to L. g. getula.

See also Crother et al. (2000) for further brief discussion of taxonomic issues involving this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!