Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Milk snakes are found throughout the eastern United States, into southern Canada, and south into Mexico and Central America. They have a Nearctic distribution.

Biogeographic Regions: nearctic (Native )

  • National Audubon Society Inc, ,. 1979. National Audubon Society's Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knopf, Inc..
  • Williams, K. 1994. Reptilia:Squamata:Serpentes:Colubridae:Lampropeltis triangulum. Catalogue of American Amphibians and Reptiles: 594.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Milk snakes, Lampropeltis triangulum, have a wider geographical range than most other species of snake. They can be found in the United States almost anywhere east of the Rocky mountains (Audubon 1979).

In Canada, they range from southcentral and southeastern Ontario to southwestern Quebec. They are also found in Mexico and Central America in any non-arid area (Williams 1994).

Biogeographic Regions: nearctic (Native )

  • National Audubon Society Inc, ,. 1979. National Audubon Society's Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knopf, Inc..
  • Williams, K. 1994. Reptilia:Squamata:Serpentes:Colubridae:Lampropeltis triangulum. Catalogue of American Amphibians and Reptiles: 594.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continent: Middle-America South-America North-America
Distribution: Canada (Ontario), USA (Illinois, New Mexico, Texas, Oklahoma, Kansas, Nebraska, Minnesota, Colorado, Wyoming, Montana, Utah, Arizona, Michigan, Iowa, Missouri, Arkansas, Louisiana, Mississippi, Alabama, Georgia, Florida, South Carolina, North Carolina, Virginia, West Virginia, Kentucky, Indiana,  Illinois, Wisconsin, Ohio, Maryland, Pennsylvania, New Jersey, New York, Rhode Island, Connecticut, Massachusetts, New Hampshire, Vermont, S Maine) Mexico (Campeche etc.), Guatemala, Honduras, Belize, El Salvador, Nicaragua, Costa Rica, Panama,  Colombia, Venezuela, Ecuador; elevation (Honduras): 1140 m  abnorma: ?  amaura: SW Arkansas, SE Oklahoma south to the golf coast of Texas and Louisiana.  andesiana: Huila (Columbia), Venezuela (Tachira, Mérida) [HR 30: 174]).  annulata: S Texas, S Tamaulipas to C Nuevo Léon, S ,E Coahuila (Mexico)  arcifera: Morelos, Guerrero, Michoacán, Jalisco, W Querétaro (Mexico) blanchardi: ?  campbelli: S Puebla, E Morelos, N Oaxaca (Mexico)  celaenops: SW Texas, E New Mexico  conanti: Sierra Madre del Sur in Guerrero, Oaxaca (Mexico)  dixoni: S San Luis Potosí, NE Querétaro, Guanajuato [HR 30: 113] (Mexico)  elapsoides: N Virginia, North Carolina through S Florida (incl. St. George Island, Apalachicola Island [HR 31: 114]), Mississippi, Tennessee, S Kentucky  gaigae: mountains in Costa Rica, Panamá  gentilis: Kansas, W Oklahoma, E Colorado, Texas panhandle, C/SW Nebraska, C/W Kansas  hondurensis: carribbean side of Honduras, Nicaragua, NE Costa Rica  micropholis: Costa Rica, Panamá, Columbia, Venezuela, Ecuador;
Type locality: Panama. Holotype: (ANSP 3427).  multistrata: C/N Nebraska, C Montana, SW North Dakota, C Wyoming  nelsoni: S Guanjuato, C Jalisco, Colima, NW Michoacán, Tres Marias  oligozona: Oaxaca, Chiapas (Mexico), Esquintla (Guatemala)  polyzona: Vera Cruz, E San Luis Potosí, Tabasco, Belize  sinaloae: SW Sonora, Sinaloa, SW Chihuahua (Mexico)  smithi: SE San Luis Potosí, E Querétaro, Hidalgo, NE Puebla, Veracruz (Mexico)  stuarti: El Salvador, Honduras, Nicaragua, NW Costa Rica (pacific side)  syspila: S Indiana through NW Mississippi, W Kentucky, SE South Dakota through E Oklahoma, Kansas.  taylori: C/NE Utah, W Colorado, N Arizona  triangulum: Maine to Minnesota, Wisconsin, N Alabama, Tennessee, Georgia, North Carolina, Illinois, Kentucky, S Quebec (Canada)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The huge range extends from Montana, South Dakota, southern Minnesota, Michigan, southern Ontario, southern Quebec, and southern Maine southward through western, eastern, and southern Mexico and Central America to northwestern South America (Ecuador, northwestern Colombia, and northern Venezuela) (Williams 1994), at elevations from near sea level to around 2,740 meters (9,000 feet) (Stebbins 2003). In the United States, this snake ranges west to Utah and Arizona and east to the Atlantic coast; its range meets that of L. elapsoides in the southeastern United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Physical Description

Morphology

Physical Description

Milk snakes can be from 35 to 175 cm long, with the longest snakes being found in Mexico and Central America. In the United States lengths are usually 60 to 130 cm. They are very colorful snakes and their colors vary throughout their range. All milk snakes have a blotchy or striped appearance, with darker blotches separated by lighter stripes. The color of those darker blotches can be very light to very dark, from tan to rust colored to dark brown. The ligher areas can be orange, yellow, or white. The darker areas are always outlined in black. Milk snakes have 19 to 23 rows of smooth scales and a single anal plate.

Range length: 35 to 175 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Specimens of L. triangulum have been found in lengths ranging from 35 to 175 cm, with the neotropical populations achieving the greatest lengths. In the United States lengths are most often 60 to 130 cm.

L. triangulum is a very colorful snake. Its body may be gray or tan, having a light Y or V shaped patch on the neck. Black bordered "blotches", brown or rust colored down the sides of the body are common as are red, orange, yellow, or white "blotches" with colorful borders, depending on the subspecies. There are 25 different subspecies known throughout the snake's geographical range, all with slight color variations.

The neck has a light collar with colored, black bordered bands separated by light rings. There are no reported color differences between males and females.

L. triangulum has 19 to 23 rows of smooth scales and a single anal plate (Audubon 1979).

Range length: 35 to 175 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 199 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Williams (1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Lampropeltis triangulum
Catalog Number: USNM 2380
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Clarke, Virginia, United States, North America
  • Holotype: Baird, S. F. & Girard, C. 1853. Smithsonian Miscellaneous Collections. 2 (5): 88.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Lampropeltis triangulum
Catalog Number: USNM 10544
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1881
Locality: Gainesville, Alachua, Florida, United States, North America
  • Holotype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 385.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Lampropeltis triangulum
Catalog Number: USNM 7849
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, St. Louis =, Missouri, United States, North America
  • Syntype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 383.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Lampropeltis triangulum
Catalog Number: USNM 5449
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, District of Columbia, United States, North America
  • Syntype: Cope, E. D. 1889. Proc. U. S. Nat. Mus. 11: 383.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Lampropeltis triangulum
Catalog Number: USNM 2300
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Mississippi, United States, North America
  • Paratype: Baird, S. F. & Girard, C. 1853. Smithsonian Miscellaneous Collections. 2 (5): 88.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Montana Valley and Foothill Grasslands Habitat

This taxon can be found in the Montana valley and foothill grasslands ecoregions, along with some other North American ecoregions. This ecoregion occupies high valleys and foothill regions in the central Rocky Mountains of Montana in the USA and Alberta, Canada. The ecoregion the uppermost flatland reaches of the Missouri River drainage involving part of the Yellowstone River basin, and extends into the Clark Fork-Bitterroot drainage of the Columbia River system. The ecoregion, consisting of three chief disjunctive units, also extends marginally into a small portion of northern Wyoming. Having moderate vertebrate species richness, 321 different vertebrate taxa have been recorded here.

The dominant vegetation type of this ecoregion consists chiefly of wheatgrass (Agropyron spp.) and fescue (Festuca spp.). Certain valleys, notably the upper Madison, Ruby, and Red Rock drainages of southwestern Montana, are distinguished by extensive sagebrush (Artemisia spp.) communities as well. This is a reflection of semi-arid conditions caused by pronounced rain shadow effects and high elevation. Thus, near the Continental Divide in southwestern Montana, the ecoregion closely resembles the nearby Snake/Columbia shrub steppe.

A number of mammalian species are found in the ecoregion, including: American Pika (Ochotona princeps), a herbivore preferring talus habitat; Bighorn Sheep (Ovis canadensis), Black-tailed Prairie Dog (Cynomys ludovicianus), who live in underground towns that may occupy vast areas; Brown Bear (Ursos arctos); Hoary Marmot (Marmota caligata), a species who selects treeless meadows and talus as habitat; and the Northern River Otter (Lontra canadensis), a species that can tolerate fresh or brackish water and builds its den in the disused burrows of other animals.

There are six distinct anuran species that can be found in the Montana valleys and foothills grasslands, including: Canadian Toad (Anaxyrus hemiophrys); Western Toad (Anaxyrus boreas); Northern Leopard Frog (Lithobates pipiens); Plains Spadefoot Toad (Spea bombifrons); Columbia Spotted Frog (Rana luteiventris), an anuran that typically breeds in shallow quiet ponds; and the Boreal Chorus Frog (Pseudacris maculata).

Exactly two amphibian taxa occurr in the ecoregion: Long-toed Salamander (Ambystoma macrodactylum), a species who prefers lentic waters and spends most of its life hidden under bark or soil; Tiger Salamander (Ambystoma tigrinum).

Reptilian species within the ecoregion are: Milk Snake (Lampropeltis triangulum), an adaptable taxon that can be found on rocky slopes, prairie and near streambeds; Painted Turtle (Chrysemys picta); Western Plains Garter Snake (Thamnophis radix), a taxon that can hibernate in the burrows of rodents or crayfish or even hibernate underwater; Yellow-bellied Racer (Coluber constrictor); Spiny Softshell Turtle (Apalone spinifera); Western Terrestrial Garter Snake (Thamnophis elegans); Rubber Boa (Charina bottae); Western Skink (Plestiodon skiltonianus); and the Western Rattlesnake (Crotalis viridis).

The ecoregion supports endemic and relict fisheries: Westslope Cutthroat Trout (Oncorhynchus clarki lewisi), Yellowstone Cutthroat Trout (Oncorhynchus clarkii bouvieri), and fluvial Arctic Grayling (Thymallus arcticus), a relict species from past glaciation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Habitats vary greatly among different geographic regions: semiarid to wet, lowland valleys to mountains, grasslands and shrublands to forests and forest edges, primary forest to secondary forest, sand dunes to rocky areas, and wilderness to semiagricultural and suburban (Campbell 1998, Lee 2000, Savage 2002, Ernst and Ernst 2003, Stebbins 2003). During daylight, this secretive generally hides in logs and stumps and under surface cover but also may be found in the open. It hibernates underground or in a deep rock crevice. Eggs are laid in soil, sawdust piles, or under surface cover.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Milk snakes can thrive in a variety of habitats. They are usually found near forest edges, but can also be found in open woodlands, prairies and grasslands, near streams and rivers, on rocky hillsides, and in suburban areas and farmlands. Milk snakes are not rare but are secretive, so are rarely seen.

Range elevation: sea level to 2600 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: rivers and streams

Other Habitat Features: suburban ; agricultural ; riparian

  • Vogt, R. 1981. Natural History of Amphibians and Reptiles of Wisconsin. Milwaukee, Wisconsin: Milwaukee Public Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Milk snakes can thrive in a variety of habitats. They are usually found around coniferous or deciduous forest edges, but they can also be found in tropical hardwood forests, open woodland, dry or wet prairies, savannahs, rocky hillsides, small streams or marshes, and agricultural or suburban areas. These snakes do not fear human proximity but are secretive, so are rarely observed (Vogt 1981). They can be found anywhere from sea level to 8000 feet (Audubon 1979).

Range elevation: sea level to 2600 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: rivers and streams

Other Habitat Features: suburban ; agricultural ; riparian

  • Vogt, R. 1981. Natural History of Amphibians and Reptiles of Wisconsin. Milwaukee, Wisconsin: Milwaukee Public Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between hibernaculum and summer range in some areas (Vogt 1981, DeGraaf and Rudis 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes snakes, lizards, reptile eggs, birds and their eggs, small mammals, and occasionally insects and worms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Milk snakes are carnivorous. Adults feed mainly on rodents such as Microtus pennsylvanicus, Peromyscus leucopus, and Mus musculus , but will also eat Aves, bird eggs, Squamata, snake eggs, or other Squamata, including venomous species like coral snakes and Viperidae. Young milk snakes seem to feed mainly on other young snakes. When prey is captured, it is constricted (squeezed) until it suffocates. It is then swallowed whole.

Animal Foods: birds; mammals; reptiles; eggs

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

L. triangulum is carnivorous. Adults feed mainly on rodents such as voles, mice, and rats, but will also eat birds, bird eggs, lizards, snake eggs, or other snakes, including venomous species like coral snakes and rattlesnakes. Hatchlings seem to feed mainly on other young snakes. When prey is captured, it is contricted until it suffocates. It is then swallowed whole (Vogt 1981).

Animal Foods: birds; mammals; reptiles; eggs

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Milk snakes are important predators of small mammals, birds, and other snakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Milk snakes are prey for animals such as Procyon lotor, Vulpes vulpes, Mephitis mephitis, and Canis latrans. When they feel threatened, milk snakes will vibrate their tails, trying to look like a venomous rattlesnake. Their color pattern of alternating black, white, and reddish stripes also makes them look like another venomous snake, coral snakes. In some areas their color patterns mimic copperhead snakes, which are also venomous. By looking like dangerous snakes they avoid being preyed on by many animals, but this often backfires when humans mistake them for the dangerous snake and kill these otherwise harmless and helpful snakes.

Known Predators:

  • Procyon lotor
  • Vulpes vulpes
  • Mephitis mephitis
  • Canis latrans

Anti-predator Adaptations: mimic; aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Milk snakes are important predators of small mammals, birds, and other snakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Milk snakes are prey for animals such as raccoons, foxes, skunks, and coyotes. When it feels threatened, the snake will vibrate its tail, sounding much like a rattlesnake. This habit may scare away some predators, but it can also get the Milk snake killed by frightened humans who mistake it for a venomous rattlesnake (Audubon 1979). Another adaptation this species has to avoid death by predator is its coloration. Many of the L. triangulum subspecies practice Batesian mimicry. Their color patterns look similar to either those of the venomous copperhead or the coral snake. Again, this adaptation can also mean death for the snake when encountering humans who can't tell the difference.

Known Predators:

Anti-predator Adaptations: mimic; aposematic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Lampropeltis triangulum is prey of:
Mephitis mephitis
Procyon lotor
Canis latrans
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Lampropeltis triangulum preys on:
Reptilia
Aves
Mammalia
Storeria occipitomaculata
Thamnophis butleri

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences or subpopulations. Williams (1994) mapped several hundred collection sites rangewide; see also the detailed maps in Dundee and Rossman (1989), Degenhardt et al. (1996), Hammerson (1999), Werler and Dixon (2000), Savage (2002), and Trauth et al. (2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but probably exceeds 1,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range size estimated to be about 20 ha in Kansas study (see DeGraaf and Rudis 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Not much is known about milk snake communication. They use sight, hearing, touch, and smell to perceive their environment.

Communication Channels: chemical

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Not much is known about milk snake communication. They use sight, hearing, touch, and smell to perceive their environment. They may use chemical cues to detect sex during their spring mating.

Not much is known about milk snake communication. They use sight, hearing, touch, and smell to perceive their environment.

Communication Channels: chemical

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day or night; mostly nocturnal, especially in hot weather (see Collins 1982, Vogt 1981). May estivate during hot dry periods in some areas (Tennant 1984). Inactive during cold months (November-March in many areas) in north.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Lifespans of milk snakes aren't well known. However, on individual lived in captivity to be more than 21 years old. Most milk snakes probably die in their first year of life.

Range lifespan

Status: captivity:
21 (high) years.

Average lifespan

Status: captivity:
22.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Specific data on lifespan is not given, although it is known that one individual caught as an adult lived another 21 years in captivity.

Range lifespan

Status: captivity:
21 (high) years.

Average lifespan

Status: captivity:
22.6 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lays clutch of 2-17 eggs, usually in June-July in U.S. Eggs hatch in about 6-9 weeks, August or September. Sexually mature in 3rd or 4th year in Kansas (see DeGraaf and Rudis 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Milk snakes mate while in their hibernation spots before they emerge in the spring.

Mating System: polygynandrous (promiscuous)

Milk snakes lay from 2 to 17 (usually about 10) elliptical eggs in rotting logs or moist, warm leaf litter. They hatch after 28 to 39 days and emerge as young milk snakes that are 14 to 28 cm long. Upon hatching they are brightly colored, with oranges, reds, purples, and yellows. Their colors become more dull as they age. Young milk snakes become fully grown in 3 to 4 years.

Breeding interval: Milk snakes breed once yearly.

Breeding season: Breeding occurs in spring and early summer, from April through June.

Average number of offspring: 10.

Range gestation period: 28 to 39 days.

Average age at sexual or reproductive maturity (female): 3 to 4 years.

Average age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Milk snake females choose nest sites that are warm and humid. Once the eggs are laid there is no further parental care.

Parental Investment: no parental involvement

  • National Audubon Society Inc, ,. 1979. National Audubon Society's Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knopf, Inc..
  • Vogt, R. 1981. Natural History of Amphibians and Reptiles of Wisconsin. Milwaukee, Wisconsin: Milwaukee Public Museum.
  • Canadian Amphibian & Reptile Conservation Network, ,. March 1999. "Lampropeltis triangulum Milk Snake" (On-line). Accessed November 7, 1999 at http://cs715.cciw.ca/ecowatch/dapcan/reptiles/tour/glossary/milksnk2.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Milk snakes probably mate while still in their hibernacula. They mate in spring before emerging and dispersing to their summer ranges. Mating is probably indiscriminate.

Mating System: polygynandrous (promiscuous)

Milk snakes lay elliptical eggs in rotting logs or humus in the spring or early summer (Audubon 1979). These eggs are laid in clutch sizes of 2 to 17, usually about 10 (Vogt 1981). Eggs hatch after an incubation period of 28 to 39 days with hatchlings measuring from 14 to 28 cm long upon hatching. The young are always brightly colored, though color dulls as maturity is reached. It takes 3 to 4 years to reach full maturity.

Breeding interval: Milk snakes breed once yearly.

Breeding season: Breeding occurs in spring and early summer, from April through June.

Average number of offspring: 10.

Range gestation period: 28 to 39 days.

Average age at sexual or reproductive maturity (female): 3 to 4 years.

Average age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Milk snake females choose nest sites that are warm and humid. Once the eggs are laid there is no further parental care.

Parental Investment: no parental involvement

  • National Audubon Society Inc, ,. 1979. National Audubon Society's Field Guide to North American Reptiles and Amphibians. New York: Alfred A. Knopf, Inc..
  • Vogt, R. 1981. Natural History of Amphibians and Reptiles of Wisconsin. Milwaukee, Wisconsin: Milwaukee Public Museum.
  • Canadian Amphibian & Reptile Conservation Network, ,. March 1999. "Lampropeltis triangulum Milk Snake" (On-line). Accessed November 7, 1999 at http://cs715.cciw.ca/ecowatch/dapcan/reptiles/tour/glossary/milksnk2.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampropeltis triangulum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GCTGGTACAGGATGAACCGTCTACCCACCACTATCAGGAAACCTAGTACACTCAGGCCCATCCGTGGATCTA---GCAATCTTCTCCTTGCATCTAGCAGGCGCCTCATCTATCCTTGGGGCAATTAACTTCATTACTACATGCATCAATATAAAACCCAAATCCATACCAATATTTAACATCCCACTATTTGTCTGATCAGTACTTATTACTGCTATTATACTACTTCTAGCTCTACCTGTATTAGCAGCA---GCAATCACTATACTCTTAACCGACCGAAATCTAAACACCTCTTTCTTTGATCCCTGCGGAGGAGGAGACCCTGTATTATTCCAGCACCTGTTTTGATTCTTTGGCCACCCAGAAGTATACATTCTTATTCTACCGGGGTTTGGTATTGTATCAAGCATTATCACATTCTATACTGGAAAAAAA---AACACATTCGGATATACAAGTATAATTTGGGCAATAATATCAATTGCTGTCCTAGGCTTTGTAGTCTGAGCCCACCAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lampropeltis triangulum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Though milk snakes are often killed by humans who mistake them for venomous snakes, they are widespread and still considered abundant throughout most of their range.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Though milk snakes are often killed by humans who mistake them for venomous snakes, they are widespread and still considered abundant throughout most of their range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Currently, the extent of occurrence, area of occupancy, number of subpopulations, and population size probably are relatively stable.

Global Long Term Trend: Relatively stable to decline of 30%

Comments: Localized declines undoubtedly have occurred, but the overall extent of occurrence, area of occupancy, number of subpopulations, and population size probably have not decreased by more than 25 percent compared to the historical situation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: Intensive agricultural development and urbanization have caused localized declines, and collectors probably have depleted accessible populations near roads, but in most areas this snake is not threatened.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in national parks and other well-protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative affects of milk snakes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Milk snakes have a close relationship with humans, as they are commonly found in farmland or urban areas. These snakes are beneficial to humans as they feed on rodents that concentrate around barns or trash (Vogt 1981).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative affects of milk snakes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Milk snakes have a close relationship with humans, as they are commonly found in farmland or urban areas. These snakes are beneficial to humans as they feed on rodents that concentrate around barns or trash (Vogt 1981).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Milk snake

Lampropeltis triangulum, commonly known as a milk snake or milksnake, (French: Couleuvre tachetée; Spanish: Culebra-real coralillo)[1] is a species of king snake. There are 24 subspecies of milk snakes. Lampropeltis elapsoides, the scarlet kingsnake, was formerly classified as the subspecies L. t. elapsoides, but is now recognized as a distinct species.[1] The subspecies have strikingly different appearances, and many of them have their own common names. Some authorities suggest that this species may be split into several separate species.[1] They are not dangerous to humans.[2][3]

Geographic range[edit]

They are distributed from southeastern Canada through most of the continental United States to Central America, down to western Ecuador and northern Venezuela of northern South America.[1][4]

Description[edit]

Milk snakes grow 20 to 60 inches (51 to 152 cm) long.[1] They have smooth and shiny scales and their typical color pattern is alternating bands of red-black-yellow or white-black-red.[1] However, red blotches instead of bands are seen in some populations.[1] Some milk snakes have a striking resemblance to coral snakes and this mimicry (known as Batesian mimicry) likely scares away potential predators. While both milk snakes and coral snakes possess transverse bands of red, black and yellow, a common mnemonic can be used to properly distinguish between the deadly coral snake and the harmless milk snake:

  • "Red on yellow will kill a fellow, but red on black is a friend of Jack."
  • "Red on yellow, deadly fellow; Red on black, venom lack."
  • "Red and yellow will kill you fellow; Red and black is friend Jack."
  • "Red on yellow, kill a fellow. Red on black, you're all right Jack."
  • "Red next to black is a friend of Jack; red next to yellow will kill a fellow."
  • "Red to yellow, kill a fellow. Red to black, venom lack."
  • "If red touches black, you're okay Jack; if red touches yellow, you're a dead fellow."
  • "Red next to black, you can pat him on the back; red next to yellow, he can kill a fellow."
  • "Red next to black, venom I lack; red next to yellow, run away fellow."
  • "Red and black, friend of Jack; red and yellow kill a fellow."
  • "Red touches yellow, not a nice fellow; if red touches black, good friend of Jack."
  • "Red touch yellow, you're a dead fellow; red touch black, you're okay Jack."
  • "Red touch black, good for Jack; red touch yellow, kill a fellow."
  • "Yellow and red, you are dead; black and white you're all right."
  • "Red and black, death you lack; yellow and red, you are dead; black and white, say good night;"
  • "Red touch yellow, kill a fellow; red touch black, venom lack."
  • "Red and yellow, deadly fellow; red and black, friendly Jack."
  • "Red next to yellow, a dangerous fellow."

However, the Eastern milk snake (L. t. triangulum) does not resemble a coral snake; instead it tends to have similar markings to that of several other snakes, particularly the fox snake, scarlet snake and most importantly, the Massassauga rattlesnake. Milk, fox, and scarlet snakes are killed because of a resemblance to the venomous rattlesnake. Juvenile milk snakes, which are more reddish than adults, are often killed because they are mistaken for copperheads. There is enough distinction among the five to make the Eastern milk snake fairly easy to identify. Eastern milk snakes also have a light colored v-shaped or y-shaped patch on their neck. One subspecies is melanistic (almost all black).[1]

Habitat[edit]

Across the wide range of this species, habitat varies. Typically, milk snakes live in forested regions; however, in some regions they can be located in open prairies. In various parts across its distribution, milk snakes often abide in rocky slopes.[1]

Behavior[edit]

Milk snake activity is mostly nocturnal. They are primarily terrestrial and attempt to blend in with ground litter.

Diet[edit]

Young milk snakes typically eat slugs, insects, crickets, and earthworms.[5] Adult diet frequently includes lizards (especially skinks), and small mammals.[1] They are also known to eat birds and their eggs, frogs, fish, and other snakes.[5]

Milk snakes are much more opportunistic eaters than the fox snake or corn snake. They have been known to consume a variety of animals including rodents, eggs, birds, reptiles, amphibians, and invertebrates. Nevertheless the diet of an adult milk snake still primarily consists of rodents. They are nocturnal eaters and are often found during the day in old barns and under wood.

An early myth about milk snakes is that they suck cow udders to get the milk. The myth is entirely false, and is discredited by the fact that the milk snake does not have the physical capabilities to suck milk out of a cow. Milk snakes are, however, frequently found in and around barns, making use of their cool and dark environments, and for the easily accessed populations of rodents to feed on. This proximity to barns, and therefore cows, probably gave rise to the myth.[1]

Reproduction[edit]

Milk snakes are oviparous, laying an average of about 10 eggs per clutch, although that number may vary by region.[1] The milk snake mates from early May[5] to late June. In June and July, the female lays three to twenty-four eggs beneath logs, boards, rocks, and rotting vegetation.[5] The eggs incubate for approximately two months, and hatch around August or September.[5] Milk snakes typically live around 12 years.[5]

Conservation status[edit]

The milk snake is not listed by the IUCN (a wildlife conservation union), but in some areas, they may face significant pressure due to pet trade collection.[1] Because of this species' high value in the pet trade, many subspecies are now being bred in captivity for sale.[1]

Subspecies[edit]

Listed alphabetically by binomial name.[6]

Mexican Milk Snake, L. t. annulata

References[edit]

  1. ^ a b c d e f g h i j k l m n o Savitzky, Alan H. (2004), Hutchins, Michael; Evans, Arthur V.; Jackson, Jerome A.; Kleiman, Devra G., eds., Grzimek's Animal Life Encyclopedia, 7: Reptiles (2nd ed.), Detroit: Gale, p. 477 
  2. ^ BioKIDS - Kids' Inquiry of Diverse Species, Critter Catalog, Lampropeltis triangulum, milk snake
  3. ^ Snakes of New York
  4. ^ Armstrong, Michael P.; Frymire, David; Zimmerer, Edmund J. (December 2001), "Analysis of sympatric populations of Lampropeltis triangulum syspila and Lampropeltis triangulum elapsoides, in western Kentucky and adjacent Tennessee with relation to the taxonomic status of the scarlet kingsnake", Journal of Herpetology 35 (4): 688–93, doi:10.2307/1565915, JSTOR 1565915 
  5. ^ a b c d e f "Encyclopedia of Animals (Milk snake entry)", EBSCO Animals (EBSCO Publishing) 
  6. ^ Species Lampropeltis triangulum at The Reptile Database
  7. ^ a b Bell, Edwin L.; Smith, Hobart M.; Chiszar, David (2003), "An Annotated List of the Species-Group Names Applied to the Lizard Genus Sceloporus." (PDF), Acta Zoologica Mexicana (90): 103–174 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species exhibits considerable geographic variation in morphology, and it is suspected that this variation reflects the existence of multiple species (e.g., Savage 2002). Further study is warranted.

Collins (1991) proposed that subspecies taylori be recognized as a distinct species but presented no supporting data (see also Dowling 1993); taylori intergrades morphologically with two adjacent subspecies and does not appear to be a distinct entity (Williams 1988, Roth and Smith 1990).

Armstrong et al. (2001) examined populations of subspecies syspila and elapsoides in western Kentucky and adjacent Tennessee and concluded that the two taxa exist in sympatry with minimal, if any, gene flow between the populations.

Based on multiple nuclear and mitochondrial genes, Pyron and Burbrink (2009) determined that Lampropeltis elapsoides is well differentiated from L. triangulum. Crother et al. (in Crother 2012) listed the two taxa as distinct species. Distributional details in contact zones with other members of the L. triangulum complex have not been described.

The correct year of publication of the original description is 1789 (not 1788 as commonly cited).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!