Overview

Distribution

Range Description

This chameleon is distributed in the south-western Arabian Peninsula, in an area stretching from the Asir Province in Saudi Arabia to the surroundings of Aden in Yemen (Nečas 1999). Because of the pet trade, this species is now reported to be established in Florida and a feral population is also present in Hawaii (Krysko et al. 2004, Kraus and Fern 2004). This species is found between 1,200 and 2,000 m above sea level, and its extent of occurrence is estimated as approximately 136,600 km2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Border between Yemen and Saudi Arabia: The veiled chameleon occupies high, dry plateaus and is found near the border of Yemen and Saudi Arabia along the foot of the escarpment and local wadis (inland river valley), to an elevation of almost 3,000 feet.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Near-East
Distribution: Yemen, SW Saudi Arabia (up to 2500 m).  Introduced to USA (Florida)  calyptratus: Yemen  calcarifer: SW Saudi Arabia, Yemen (?)  
Type locality: Bembatuka [= Bombetoka] (in error for Arabian Peninsula; probably near Aden, Yemen).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The veiled chameleon is characterized as an aggressive, brightly colored chameleon. They have a casque found on top of their heads, which is a tiny swelling when a hatchling, but grows to two inches in height. They typically have bold bands circling their body primarily of bright gold, green and blue mixed with yellow, orange or black. They also have very long cones on their gular crest. There is sexual dimorphism.

Males have a larger body and casque (head crest or helmet) when mature. They are born with tarsal spurs which makes sexing them very easy. Male body length can reach between 17 to 24 inches from head to the tip of the tail. Pastel green as hatchlings, mature males will develop a pattern of several colors such as turquoise, yellow, orange, green and black. They are also usually thin in appearance. Females have a smaller head and casque, and reach their full growth between 10 to 14 inches, within their first year. The female's casque is smaller than the males, but they are heavy bodied. Mature females are shades of green mottled with shades of tan, orange, white, and sometimes yellow (Crabtree, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This arboreal species occurs in the most vegetated area of the Arabian Peninsula. It does not prefer any specific habitat, and can be found on acacia branches, on shrubs and even cultivated plants (Nečas 1999). It can also be found in tree alleys along busy road-ways and on trees in village gardens.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Veiled chameleons are arboreal lizards, meaning they prefer to live high up in trees or lower near the ground in bushes and shrubs. They can live in dry areas and are found on plateaus of mountainous regions, forests and valleys of southern Saudi Arabia and Yemen. They are one of the few species of chameleons which can tolerate wide temperate ranges, though they prefer to live in a temperature range of 75 to 95 degrees F.

Terrestrial Biomes: desert or dune ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The veiled chameleon is an insectivore. They have the ability to capture prey by projecting their sticky tongue. Their tongues are also used for smell and taste. They have also been observed as having a preference for certain prey types. Green insects seem to be a favorite. However, they are one of the few chameleons that also enjoy the taste of plants. They adapted to eating leaves of plants as a source of water during the dry seasons (Crabtree, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The lifespan of a veiled chameleon is usually five years for females and up to eight years for males (Crabtree, 1999). They reach sexual maturity within 4 to 5 months (8-12 inches). During the breeding season, females turn from their usual light green to a blackish-green with blue and yellow spots on their bodies within 18 hours of a successful mating. Egg laying will occur between 20 - 30 days after mating. Their typical clutch size is 35 - 85 eggs, and breeding may occur up to three times a year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chamaeleo calyptratus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6840-09|EF222192|Chamaeleo calyptratus| CTTCGCTGACTTCTTTCAACTAACCACAAAGACATCGGTACCATGTATTTTTTATTTGGACTGGCCGCAGGACTTGTTGGA---GCCACCTCAAGCCTACTAATACGTACAAAACTTGGTCAGCCAGGATTCTCCCTCGGAGAC---GACCACGCCTATAACGTCTTAATTACCCTCCACGGGCTAACCATAATTTTCTTCATGGTTATACCAATCATGATCGGGGGATTTGGAAATTGACTTGTACCCCTAATG---CTTGGAGCACCTGACATGGCCTTTCCACGCATAAACAACATAAGCTTCTGGCTTCTTCCACCATCATTTATGCTTCTATTAGCATCATCAAAAACTGGTACCGGGGTTGGAACAGGATGAACTATTTACCCACCACTATCTGGAAACATAGCACATTCAGGCCCATCCATAGATCTA---GCAATCTTCTCACTACACCTAGCAGGAATCTCTTCCATTCTTGCCTCAATCAATTTCATTACAACTAGCATTAACATGAAACCACACCACATAGTCCTCTATAATTTACCCCTATTTGTATGATCAGTCATATTAACTGCAATCCTACTAATCCTAGCCCTACCAGTATTGGCTGCA---GCCATCACAATACTCCTAACAGATCGAAACTTAAACACAGCATTCTTCGATCCTGTGGGGGGCGGGGATCCCGTACTATTCCAACACCTATTCTGATTCTTTGGACACCCAGAAGTATATATTCTCATCCTACCAGGATTTGGAATTATCTCGCATATTATCACACACTACTCATGTAAAAAG---GAACCATTTGGATACATAAGCATGGTATGAGCCATACTTGCAATCACCATTCTAGGATTTATAGTATGAGCCCACCATATGTTCACGGTAGGACTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chamaeleo calyptratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Anderson, S.C. & Carpenter, A.I.

Reviewer/s
Bohm, M, Collen, B. & Ram, M.

Contributor/s
De Silva, R., Milligan, HT, Wearn, O.R., Wren, S., Zamin, T., Sears, J., Wilson, P., Lewis, S., Lintott, P. & Powney, G.

Justification
Chamaeleo calyptratus has been assessed as Least Concern owing to its tolerance of a broad range of habitats, including human environments. Although part of the pet trade, this currently stems from captive or non-indigenous sources and hence does not cause declines in wild populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Wild chameleon populations are experiencing growing pressures on a variety of fronts, causing some environmentalists to sound alarms concerning the long-term survival of these animals. It is yet to be seen whether these chameleons will be able to withstand large-scale commercial exploitation and extensive habitat loss.

Growing human populations in their native habitat causes increasing competition for economic resources. Land is consumed to house growing human populations. Land previously considered sacred is cleared, burned, mined or logged to exploit natural

resource for its current economic value. Chameleon populations are ultra-sensitive to the problems associated with habitat loss.

Due to their slow-moving nature, and their inability to relocate quickly, chameleons have evolved in small, often isolated pockets. To these small, isolated populations, habitat loss can prove to be disastrous. Chameleons are exploited by the locals in their native habitat, and by foreigners. Locally, they are sold live to be used for a variety of purposes. Some natives believe that throwing a live chameleon into a fire will bring them good luck. Chameleon parts are sometimes sold to be used in magic rituals. Growing demand by tourists for chameleon body parts (which are sold a souvenirs) adds yet another demand for chameleons in the local markets (Fry, 1997).

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species. However, in certain parts of its range, this species is found in high densities.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
It is unlikely that any major threat is impacting this species. This species has been collected for the pet trade, however, trade has declined in recent years, and any individuals traded have come from non-indigenous sources in North America and Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix II, however, no export quotas have been listed for the species over the last years. There are no further species-specific conservation measures in place, or needed, for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Live and dead chameleons are sold for rituals and souvenirs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Veiled chameleon

The veiled chameleon, Chamaeleo calyptratus, is a large species of chameleon found in the mountain regions of Yemen, United Arab Emirates and Saudi Arabia. It is also sometimes referred to as the Yemen Chameleon.

The male veiled chameleon is green in color and, depending on the animal's emotional state, this green will range from a bright lime green to a red olive drab. Surroundings only partly contribute to a chameleon's "decision" to change color. The green base color is marked with stripes and spots of yellow, brown, and blue. Non-breeding females and juvenile chameleons are generally a uniform green color with some white markings. Breeding and gravid females are a very dark green with blue and yellow spots. The prominence of these markings is dependent on several factors including health, mood, and temperature of the lizard.

Male chameleons of the species have small spurs or heels on the back their rear feet; while females do not. This spur is present on males from hatching, and can grow larger with maturity. Adult male Veiled chameleons are relatively large for reptiles. It is possible for them to reach an overall length of 24 inches (60 cm). Most specimens usually reach between 14 to 18 inches (35–45 cm). Females are smaller with the average overall length being just under 12 inches (30 cm). Males and females both have a decorative growth called a "casque" on their heads. The casque of a male chameleon is much taller than the female's.

Like most chameleons, veiled chameleons are specialized tree dwellers. They have a flattened body meant to mimic a leaf and feet specially designed for grasping limbs and branches. They have a prehensile tail that acts as a fifth appendage and aids in climbing. Their eyes work independently of one another allowing the chameleon to look in front of and behind itself at the same time. They have a long sticky tongue that they use to capture their insect prey. Veiled chameleons are ambush predators and are capable of lying still for very long periods of time waiting for an unsuspecting locust to wander by.

An adult female, with a relatively small casque
Veiled Chameleon P9240100.JPG

Veiled chameleons are omnivores. While their main diet consists of insects, they will occasionally consume the leaves, blossoms, and fruit of various plants. This is especially true in times of drought when water is scarce. Like all chameleons, veiled chameleons prefer to drink water that is in drops or on leaves. They do not always recognize standing water and may dehydrate if that is their only source.

Female veiled chameleons can produce up to three clutches of eggs a year, as early from 4–6 months of age. Each clutch may contain 20–70 eggs. The eggs dissimilar to chickens. They retain sperm, which is why they lay so many clutches. Egg-laying sand must be provided for mature females in an incubated bucket or etc. with approximately 8-10 inches of organic garden soil, or they can die of egg binding.

Veiled chameleons are often kept in captivity because they are hearty when compared to other chameleon species often offered for sale. Like most old-world chameleons, they must be kept individually in a screened enclosure, and provided with a basking light, and a source of UVB/UVA light. As with all exotic pets, a qualified herpetologist veterinarian should be consulted when getting a new animal, and when any health or behavior problems are observed.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!