Overview

Brief Summary

Biology

Usually found amongst the branches of trees and bushes, the flap-necked chameleon will occasionally descend to the ground in order to seek out new feeding grounds or a mate (6) (7). Like other chameleon species, the flap-necked chameleon has a number of special adaptations for hunting. Its eyes are located on cone-shaped turrets, which can move independently, allowing it to look in two different directions simultaneously, while searching for its insect prey. Once spotted, prey is caught by means of the flap-necked chameleon's remarkable, extensile tongue. The contraction of special muscles within the tongue rapidly propels it towards the prey, which is snared by a combination of the tongue's sticky mucous coating and a vacuum created by muscles in the tip (8). When threatened, the flap-necked chameleon presents a dramatic display, rocking from side-to-side, while raising its neck flaps, expanding its throat pouch and gaping its mouth (3) (4). Female flap-necked chameleons are larger than the males and outcompete them for the most favourable areas within their habitat, where prey is most abundant (7). The short mating season is the only time when females will allow males to approach them without conflict. After mating, the female once again becomes aggressive to males, turning black and butting heads with any that approach (6). After a gestation period of around one month (6), the female digs a hole in which the eggs are buried (2). While clutch sizes of up to 60 eggs have been recorded in captivity, in the wild, clutch size may be significantly smaller (2). Hatching takes place around 9 months later (4), with the young reaching sexual maturity after 9 to 12 months (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The flap-necked chameleon's common name derives from the large, movable flaps that protrude from either side of the upper surface of its neck (2) (3). Normally these flaps lie flat, over a bony protuberance at the back of the head called a “casque” (2), but during threat displays to deter rivals or predators, they can be raised and angled at 90 degrees to the head (2) (3). Males can be distinguished from females by their taller casques, larger flaps and by the small spurs which protrude from the hind legs of some subspecies. At rest, the flap-necked chameleon's body colouration is usually light green, brown or yellow, with a light or dark stripe extending across the flanks. The flap-necked chameleon's body is diffusely marked with numerous dark spots, which become bright yellow or orange when it is excited or ready to mate (2). Two low crests formed from large conical scales run down the centre of the upper and lower surfaces of the body (2), with the lower crest beginning at the throat and continuing unbroken over the belly (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed throughout southern and eastern Africa. It has been described as far west as Cameroon (Welch 1982) and possibly Nigeria, east to Kenya and Somalia and south through Tanzania into Botswana, Namibia, Malawi, Mozambique and South Africa (Patterson 1987). There are limited records of the species occurring in Rwanda and Burundi (Spawls et al. 2002), however, this could be attributed to low recorder effort rather than the absence of the species from the area. The species has recently been confirmed on Lolui island in Uganda (S. Spawls pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: Africa
Distribution: Congo, Angola, Cameroon, Congo, Equatorial Guinea, Gabon, Kenya, Malawi (Shire Highlands), Namibia, Nigeria, Republic of South Africa, Swaziland, Botswana, Somalia, Tanzania, Uganda (see note), Democratic Republic of the Congo (Zaire; except in the north), Zambia, Burundi, Uganda, E Zaire, Tanzania (Pemba Island), Mozambique, Central African Republic ?, Ethiopia, Zimbabwe  
Type locality: Congo 
Type locality: Pemba Island [martensi]  ruspolii: Ethiopia, NW Somalia;
Type locality: Ogaden, Somaliland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

One of the most widely distributed chameleon species (2) (5), the flap-necked chameleon is found throughout almost all of southern and central Africa, with the northern limits of its range extending from Nigeria and Cameroon in the west to Somalia and Ethiopia in the east (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits coastal forest, both moist and dry savanna, woodland and bushy grasslands, it has also been found in urban areas (Spawls et al. 2002, Patterson 1987). The species is arboreal , however, it is not as exclusively arboeal as many of the other chameleon taxa (Bergmann et al. 2003).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The flap-necked chameleon occupies forest, bush and grassland savannah (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 4 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chamaeleo dilepis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6843-09|EF222189 AF128460|Chamaeleo dilepis| CTTCGTTGACTTCTTTCAACAAACCACAAAGACATCGGCACCATGTATTTTTTATTTGGGTTAGCCGCAGGACTTGTAGGA---GCCACCTCAAGCCTGTTAATACGTACAAAACTTAGCCAGCCTGGATTTTCCCTCGGAGAC---GACCATGCTTATAACGTCTTAATTACCCTTCACGGACTTACCATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTTGTACCCCTAATA---CTTGGAGCACCTGACATAGCTTTTCCACGTATAAATAATATAAGTTTTTGACTTCTCCCACCATCATTCATATTACTATTAGCATCATCAAAAACTGGAACTGGAGTCGGAACAGGATGAACCATCTATCCCCCACTATCAGGAAATATAGCACACTCAGGCCCATCCATAGACCTA---GCAATTTTTTCACTTCATCTAGCAGGAATCTCATCAATTCTTGCTTCAATCAACTTTATTACAACAAGCATTAACATAAAACCACACCACATAGTACTCTACAATTTACCTTTATTTGTATGATCAGTTATATTAACTGCAATTCTACTAATCTTAGCCTTACCAGTATTAGCCGCA---GCTATCACAATACTCCTAACCGATCGAAACTTAAACACAGCATTCTTTGATCCTGTGGGGGGCGGAGATCCAATTCTATTTCAACACCTATTCTGATTCTTTGGTCACCCAGAGGTATATATTCTCATTTTACCAGGATTTGGAATTATCTCACACATCATTACACACTATTCATGCAAAAAA---GAACCATTTGGCTACATAAGCATAGTATGAGCCATATTAGCAATCACAATTCTAGGATTTATAGTCTGAGCCCACCACATATTTACTGTAGGGCTTG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chamaeleo dilepis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Carpenter, A.I. & Spawls, S.

Reviewer/s
Bohm, M, Collen, B. & Ram, M.

Contributor/s
De Silva, R., Milligan, HT, Wearn, O.R., Wren, S., Zamin, T., Sears, J., Wilson, P., Lewis, S., Lintott, P. & Powney, G.

Justification
Chamaeleo dilepis has been assessed as Least Concern owing to its large distribution, abundance, and its tolerance of an anthropogenic environment. Although collected for the pet trade, there are currently no known or observed effects of removal for the pet trade on natural populations. Careful attention should be paid to detect early warning signs for declines in the population, because of gaps in our knowledge on the population biology and taxonomy of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Listed on Appendix II of CITES (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is relatively abundant.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is collected for the international pet trade with the greatest demand coming from the USA. Between 1977 and 2001, 49,836 individuals were traded (Carpenter et al. 2004). To date, there are no known or observed effects of removal for the pet trade on natural populations. Regardless, because population sizes are not known, there are no estimates of survival or rates of population increase, and the taxonomy regarding the status of sub-species is uncertain, careful attention should be paid for any warning signs of declines.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The flap-necked chameleon is one of the most extensively exported chameleon species with almost 50,000 individuals exported between 1977 and 2001. The greatest demand for these chameleons comes from the U.S.A. pet trade (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed under Appendix II of CITES (CITES 2007). There are no other species-specific conservation measures in place for this species, however, in places its distribution coincides with protected areas. No further conservation measures are required at this time. There is uncertainty about the status of subspecies, so that research is needed to clarify the taxonomy of the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The flap-necked chameleon is listed on Appendix II of the Convention of International Trade in Endangered Species (CITES) and any international trade in this species is therefore strictly controlled and regulated by annual maximum export quotas (1). Despite its popularity in the pet trade, at the present time this species appears to be widespread and common (6). Nevertheless, without proper monitoring of the effects of harvesting for the pet trade, the flap-necked chameleon's population is at risk of undergoing a significant, but undetected, population decline (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chamaeleo dilepis

The Flap-necked Chameleon, Chamaeleo dilepis, is native to Sub-Saharan Africa. It is a large chameleon, reaching 35 centimetres (14 in). Like other chameleons, this species can change colour and pattern to suit the surroundings. Colouring ranges through various shades of green, yellow and brown. There is usually a pale stripe on the lower flanks and one to three pale patches higher on the flanks. These chameleons lay 25 to 50 eggs in a hole dug in soil, which is covered over again by the female. Food includes grasshoppers, butterflies and flies.

Gallery

A Juvenile Chamaeleo dilepis from Amanzimtoti, South Africa
 
 
 
 
 
 

Bibliography

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!